Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

בידוד מבוסס זיקה של תייג גרעינים מ doi: 10.3791/51418 Published: March 25, 2014

Summary

רקמות דרוזופילה בדרך כלל מכילות תערובת הטרוגנית של סוגי תאים. כדי לבחון ביטוי גנים בסוגי תאים מסוימים מרקמה מסוימת, גרעינים יכולים להיות מתויגים גנטי ולאחר מכן מבודד באמצעות גישה המבוססת על זיקה. גרעינים בודדים יכולים לשמש עבור יישומים במורד כגון ניתוח ביטוי גנים וimmunoprecipitation הכרומטין.

Abstract

רקמות עוברי וזחל melanogaster דרוזופילה בדרך כלל מכילות תערובת הטרוגנית מאוד של סוגי תאים, אשר יכול לסבך את הניתוח של ביטוי גנים ברקמות אלה. לכן, כדי לנתח את פרופילי ביטוי גני תא ספציפי מרקמות דרוזופילה, ייתכן שיהיה צורך לבודד את סוגי תאים ספציפיים עם טוהר גבוה ובתשואות מספיק עבור יישומים במורד כגון פרופיל תעתיק וimmunoprecipitation הכרומטין. עם זאת, המורפולוגיה בלתי סדירה הסלולרית ברקמות כגון מערכת העצבים המרכזית, בשילוב עם האוכלוסייה נדירה של סוגי תאים ספציפיים ברקמות אלה, יכול להוות אתגר לשיטות מסורתיות של בידוד תא כגון microdissection לייזר ותא הקרינה המופעל מיון (FACS) . כאן, גישה חלופית לאפיון פרופילי ביטוי גני תא ספציפי באמצעות בידוד המבוסס על זיקה של גרעינים מתויגים, ולא תאים שלמים, הוא תאר. גרעינים בג הספציפיסוג ell עניין מסומנים גנטי עם תג EGFP גרעיני מקומי מעטפה באמצעות מערכת הביטוי בינארי Gal4/UAS. יכולים להיות מבודדים גרעינים מתויג EGFP אלה באמצעות נוגדנים נגד ה-GFP שהם מצמידים את חרוזים מגנטיים. הגישה המתוארת בפרוטוקול זה מאפשר בידוד של גרעינים עולה בקנה אחד מסוגי תאים מסוימים במערכת העצבים המרכזית דרוזופילה הזחל בטוהר גבוה וברמות מספיקות לניתוח ביטוי, גם כאשר אלו סוגי תאים מהווים פחות מ -2% מכלל האוכלוסייה בתא רקמות. גישה זו יכולה לשמש כדי לבודד גרעינים ממגוון רחב של דרוזופילה עוברית וסוגי תאי זחל באמצעות Gal4 נהגים ספציפיים, ועשויה להיות שימושי עבור בידוד גרעינים מסוגי תאים שאינם מתאימים לFACS או microdissection לייזר.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

רקמות דרוזופילה כגון מערכת העצבים המרכזית מכילות תערובת מורכבת של סוגי תאים. לכן, כדי לנתח את פרופילי ביטוי גני תא ספציפי מרקמות דרוזופילה, יש צורך קודם כל לבודד אוכלוסייה הומוגנית של תאים ספציפיים בכמויות מספיקות כדי לאפשר ליישומים במורד הזרם. שיטות לבודד תאים מרקמות שלמות כוללות microdissection לייזר, ותא הקרינה המופעל מיון (FACS) של כל תאים. בעוד FACS נעשה שימוש כדי לבודד את התאים וגרעינים מעוברי דרוזופילה ומelegans Caenorhabditis לביטוי גנים והכרומטין פרופיל 1-3, FACS וmicrodissection הלייזר יכולים להיות קשים לביצוע בהצלחה ברקמות המכילות סוגים מעורבבים מאוד תא או תאים מכילים שעם מורפולוגיה לא סדירה, כגון תאי עצב. כדי להתגבר על הקושי הזה, יכול להיות מבודדים מסוגי תאים ספציפיים גרעינים ולא תאים ומשמשים לדור הבאביטוי פרופיל דואר. חשוב לציין, ניתוח ביטוי mRNA microarray המבוסס באמצעות דגימות RNA גרעיניות מראה תוצאות בדרך כלל דומות לזו שבוצעה באמצעות RNA הכולל 4, 5. יתר על כן, ניתוח ביטוי גנים באמצעות RNA הגרעיני שמש בהצלחה ללמוד ביטוי גנים באורגניזמים רבים, כולל ג elegans, thaliana ארבידופסיס, דרוזופילה, ובני אדם 4, 5 2, 3.

לאחרונה כמה גישות תוארו לבידוד של אוכלוסיות ספציפיות של גרעינים שכותרתו מרקמות דרוזופילה המתאימים לניתוח ביטוי גנים ו / או immunoprecipitation הכרומטין. הבידוד אצווה של הכרומטין רקמות ספציפיות לשיטת immunoprecipitation (סיביות שבב) מנצל FACS לבודד את גרעינים קבועים על הבסיס של ביטוי תאים מסוג מסוים של ה-GFP-לוקליזציה הגרעינית 2. גישה זו כבר successfully משמש כדי לנתח את התפלגות שינויי היסטון וגורמי שעתוק באמצעות immunoprecipitation הכרומטין של גרעינים מבודדים מהמזודרם בעוברי דרוזופילה 2. עם זאת, גישות מבוססות FACS עשויות להיות פחות מתאימות לבידוד גרעינים שכותרתו, המהווים רק חלק קטן מאוכלוסייה מעורבת בשל זמן מין המוגבר הדרוש כדי להשיג מספרים מתאימים ליישומים במורד הזרם. כדי להתגבר על מגבלות אלה, כמה קבוצות יש שימוש בטכניקות בידוד מבוסס זיקה לטהר גרעינים שמסומנים עם epitope ספציפי בסוג תא מסוים. לאחרונה הבידוד של גרעינים מתויגים בסוגי תאים מסוימים בשיטה (שלמה) שפותחו לשימוש בthaliana ארבידופסיס 6, 7 הותאם לשימוש בדרוזופילה 8. בשיטה זו, חלבון היתוך מעטפת גרעין שהוא מצע לin vivo biotinylation הוא coexpresSED עם האנזים ביוטין החיידקים Escherichia בירה בסוגי תאים ספציפיים. גרעינים שכותרתו ביוטין יכולים להיות מטוהרים לאחר מכן מאוכלוסיות מעורבות באמצעות בידוד זיקה מבוסס streptavidin. שימוש בגישה זו, גרעינים תויגו בהצלחה ומבודדת מהמזודרם בעוברי דרוזופילה בי חלבון היתוך מעטפת הגרעין באו לידי ביטוי בשליטה של משפר המזודרם ספציפי 8. המחברים גם נוצרו חלבוני איחוי מעטפת גרעין שיכול לבוא לידי ביטוי בכל סוג תא שבשליטתו של רצף הרגולציה Gal4, 9 כטב"מ. גישה זו היא מסוגלת במהירות בידוד תת קבוצות של גרעינים שכותרתו מאוכלוסיות מעורבות, אבל דורשת שלושה מבנים מהונדסים נפרדים ולכן עשוי להיות מתאים ליישומים גנטיים מסוימים. לאחרונה, גישה שתוארה שביום ראשון (S AD1 והאו"ם C-84) המכיל חלבונים תחום זה בתרגום להממברנה הפנימית של מעטפת הגרעין תויגו עםחלבוני ניאון והביע תחת שליטה של מערכת Gal4/UAS 10. גרעינים היו מבודדים בנוכחות של חומר ניקוי nonionic להסיר את הקרום החיצוני של מעטפת הגרעין, וזיקה מטוהרת באמצעות חרוזים מגנטיים מצמידים נוגדנים אנטי-GFP. גישה זו משמשת בהצלחה לבודד אוכלוסיות קטנות של גרעינים שכותרתו מתת עצביים ספציפיים במוח הבוגר בדרוזופילה 10.

כאן, פרוטוקול לבידוד של גרעינים שכותרתו מאוכלוסייה מעורבת של תאים מרקמות זחל דרוזופילה מתואר. שיטה זו פותחה באופן עצמאי, אך דומה לגישה שתוארה על ידי הנרי ואח'. 10 ראשית, גרעינים תויגו עם תג הניאון שבא לידי ביטוי רק בסוגי תאים מסוימים בדרוזופילה melanogaster כדי להקל על הבידוד הבא של גרעינים מתויגים מאוכלוסיות מעורבות באמצעות גישה המבוססת על זיקה. כדי לתייג את הגרעינים,תחום KASH (larsicht K / omology שעות yne NC-1 / S) נוצל. תחום KASH הוא תחום הטרנסממברני שמתאים להממברנה החיצונית של מעטפת הגרעין, בחלקו דרך אינטראקציות עם חלבונים המכיל תחום SUN בתוך המרחב perinuclear 11. תחום KASH טרמינל C-של חלבונים כגון דרוזופילה MSP-300 וKlarsicht מעגן את החלבונים האלה קרום הגרעין החיצוני, בעוד תחומים N-מסוף שלהם אינטראקציה עם חלבוני שלד תא, כגון אקטין או microtubules ב12-14 ציטופלסמה. בונה נוצרה בי תחום KASH של דרוזופילה MSP-300 היה התמזגו לC-הסופית של EGFP, תחת שליטה של רצף Gal4 רגולציה, כטב"מ בוקטור pUAST-attB 15, 16. באמצעות אינטגרציה באתר ספציפי phiC31, זבובים מהונדסים נוצרו בי כטב"מ-EGFP :: transgene MSP-300 KASH הוכנס בלוקוסי attP2 על כרומוזום3L 17. כטב"מ-EGFP :: MSP-300 KASH זבובים ניתן חצו עם זבובים המבטאים את נהג Gal4 בסוג תא מסוים, וכתוצאה מכך הביטוי הממוקד של EGFP בקרום הגרעין החיצוני בסוג התא של עניין. אז יכולים להיות מטוהרים גרעינים שכותרתו מאוכלוסיות תאים מעורבים באמצעות נוגדנים נגד ה-GFP מצמידים את החרוזים מגנטיים. בגישה זו, השימוש בחומרי ניקוי nonionic לא נדרש כי תג EGFP הוא מקומי לצד cytoplasmic של קרום הגרעין החיצוני, ולכן נגיש לנוגדנים.

הפרוטוקול המתואר להלן יכול לשמש כדי לבודד / להעשיר את הגרעינים שכותרתו EGFP מסוגי תאים ספציפיים ברקמות זחל דרוזופילה, לכמת את טוהר ואת התשואה של גרעינים מבודדים, וכדי לחלץ RNA הגרעיני מתאים לתגובת שרשרת כמותיים הפוך שעתוק פולימרז (qRT -PCR) ניתוח ביטוי גנים. הבידוד וזיקה לטיהור של גרעינים (לא כולל Tissuנתיחת דואר) יכולה להתבצע בפחות משעה. תוצאות מוצגות מראים כי גרעיני גליה ניתן לבודד בהצלחה מהאונה אופטי זחל ודיסק דמותי בעיניים, ומשמשים לניתוח ביטוי גנים שלאחר מכן. זה צפוי כי גישה זו תהיה שימושית עבור הבידוד / ההעשרה של גרעינים שכותרתו מרקמות עוברי וזחל שבו תאי היעד מהווים פחות מ -5% מכלל האוכלוסייה. כל מניות דרוזופילה ופלסמידים שנוצרו במחקר זה הם זמינים מהמחברים על פי דרישה.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. דור ואפיון של EGFP :: KASH דרוזופילה

  1. נהג הצלב Gal4 טס לכטב"מ-EGFP :: MSP-300 KASH זבובים. לחלופין, זבובי רקומביננטי שנושאים גם את נהג Gal4 וtransgene כטב"מ-EGFP :: MSP-300 KASH יכולים להיות שנוצרו תוך שימוש בטכניקות גנטיות סטנדרטיות. גישה שנייה זה יתרון אם מספרים גדולים של צאצאים נדרשים.
  2. לאפיין ביטוי של סמן EGFP :: KASH תוך שימוש בטכניקות במיקרוסקופ רגיל. הערה: ביטוי EGFP ניתן לצפות על ידי טכניקות מיקרוסקופ רגילות ברקמות דרוזופילה גזורים, קבועים, או בכל זחלים, ואינו דורש שימוש בנוגדן.
    1. לקבוע את דפוס הביטוי של EGFP :: סמן KASH בהאורגניזם כולו תחת מיקרוסקופ פלואורסצנטי לנתח (ראה PDF חומרים). הערה: נהגי Gal4 רבים, כולל נהג repo-GAL4 מוצג באיור 1, n התערוכהדפוסי onspecific ביטוי ברקמות זחל אחרים כגון בלוטת הרוק (ראו תוצאות).
    2. נתח את דפוס ביטוי EGFP :: KASH ברקמה גזור של עניין באמצעות מיקרוסקופיה confocal.
      1. לתקן את הרקמות של עניין באמצעות פורמלדהיד בריכוז סופי של 4%, וה-DNA כתם באמצעות DAPI בריכוז סופי של 0.1 מיקרוגרם / מיליליטר כדי להמחיש את הלוקליזציה של EGFP :: KASH תג ביחס ל-DNA.
      2. לרכוש תמונות או באמצעות אובייקטיבי 40X / 1.30 שמן טבילה או אובייקטיבי 20X / 0.75 טבילת שמן, תלוי בגודל של הרקמה של עניין. תנאי עירור / הפליטה הבאה יכולים לשמש לרכישת תמונה: 408 nm/425-475 ננומטר (DAPI); 488 ננומטר / 525-550 ננומטר (GFP).

2. לבודד את הגרעינים מרקמות הזחל דרוזופילה

  1. הכן את הציוד לנתיחת רקמות הזחל ובידוד גרעינים שלאחר מכן. שים לב כיעובר Dechorionated השלם יכול לשמש גם כחומר מוצא אם תרצה בכך. מומלץ להשתמש ברקמות זחל גזורים באופן חלקי ולא כל זחלים אם סוג התא של עניין נמצא ברקמות ספציפיות, כגון דיסק דמותי. הפעולה זו מפחיתה ספציפי מחייב, וגם מבטלת בעיות שיכולים להיגרם על ידי ביטוי של כמה נהגי Gal4 בתאי nontarget.
    1. הכן שני זוגות מלקחיים חדים (ראה חומרים PDF), צלחת זכוכית אחד siliconized 9 היטב (ראה חומרים PDF), וPBT (1x PBS, pH 7.4; 20-Tween 0.1%).
    2. Prebind נוגדן ה-GFP לחרוזים המגנטיים. יש להתחיל את הצעד הזה לפני תחילת הניתוח. הוסף 10 μl של חרוזים המגנטיים (Invitrogen, ראה חומרים PDF) ו -2 מיקרוגרם של נוגדן ה-GFP (רוש, ראה חומרים PDF) ל400 μl של חיץ לשטוף (1x PBS, pH 7.4; 2.5 מ"מ MgCl 2) בצינור 1.5 מיליליטר . כמות חרוזים ונוגדנים המשמשים יכולה להיות מותאמת במידת צורך על בסיס הסכום של היעד בסאםple והזיקה המחייבת של הנוגדן לחרוזים.
    3. דגירה חרוזים ונוגדנים עם סיבוב לפחות 30 דקות בטמפרטורת חדר.
    4. מניחים את צינור 1.5 מיליליטר המכיל חרוזים ונוגדנים במעמד המגנטי (ראה חומרים PDF) ולאפשר חרוזים להיקשר המגנטי למשך כ 1-2 דקות. הסר את supernatant המכיל את הנוגדנים מאוגדים ולשטוף חיץ באמצעות פיפטה 1 מיליליטר. חרוזים יישארו מחויבים לקיר של צינור 1.5 מיליליטר בצד הסמוך למגנט.
    5. יש לשטוף את החרוזים פעמיים עם 1 מיליליטר של הצפה לשטוף בכל פעם כאמורה בסעיף 2.1.4. הסר את צינור 1.5 מיליליטר מהמדף המגנטי ולהפוך לרגע כדי לערבב את חרוזים ולשטוף חיץ במהלך כל שלב לשטוף.
    6. אחסן את חרוזים הנכנס נוגדנים בחיץ לשטוף עד מוכן להמשיך עם צעד 2.7. לא צריכים להיות מותר חרוזים להתייבש בכל שלב של הפרוטוקול.
  2. לנתח רקמות זחל בPBT ולהעביר את רקמות גזורים לגם של המנה 9 היטב אחד. בדרך כלל, דיסקציה של האונה אופטית ודיסק דמותי עין מ100 זחלי instar שלישיים מספקת מספיק חומר לניתוח ביטוי גנים במורד הזרם הבא בידוד גרעינים.
  3. יש לשטוף את הרקמות המבודדות במיצוי מאגר גרעיני (10 HEPES מ"מ-KOH, pH 7.5; 2.5 מ"מ MgCl 2; 10 מ"מ KCl) בצינור 1.5 מיליליטר. העבר את רקמות זחל בודדות למיליליטר Dounce Homogenizer 1 (ראה חומרים PDF) על קרח המכיל 1 מיליליטר של מיצוי מאגר גרעיני טרי. לדגור על קרח למשך 5 דקות. אין צורך להוסיף מעכבי פרוטאז אם RNA הוא להיעקר הבא בידוד גרעינים.
  4. לשבש את הרקמה על ידי 20 משיכות עם העלי הרופף ולאחר מכן דגירה מדגם על קרח דק 10 לאפשר לתאים להתנפח. חלץ את הגרעינים מהתאים באמצעות 15 משיכות עם העלי ההדוק. מספר משיכות עם העלי הרופף והדוק צריך להיות מותאם לרקמות שונות וסוגי תאים; המגון עודף יכול לגרוםטעון גרעינים, בעוד המגון מספיק לא לחלץ את כל הגרעינים מהרקמות.
  5. סנן את homogenate, אשר מכיל את הגרעינים ופסולת הסלולר, דרך מסננת נקבובית בגודל 40 מיקרומטר (ראה חומרים PDF) שכבר prerinsed עם חיץ המגון גרעיני. לאסוף את homogenate המסונן בצינור טרי.
  6. לאסוף דגימות טרום בידוד לניתוח שלאחר מכן כדי לקבוע תשואת גרעינים, שלמות גרעינים, וכדי לקבוע את רמות תעתיק של גנים המטרה לפני גרעיני בידוד.
    1. העברה 50 μl של homogenate המסונן לצינור 1.5 מיליליטר טרי באמצעות פיפטה. זה הוא המדגם טרום הבידוד. הוסף 500 μl של מגיב Trizol (ראה PDF חומרים, זהירות), להפוך לערבב, ולאחסן ב -20 ° C לבידוד לאחר RNA (שלב 3.1).
    2. העברה 20 μl של homogenate המסונן לצינור מיליליטר טרי 1.5.
      1. להוסיף DAPI לריכוז סופי של 0.1 מיקרוגרם / מיליליטר, וincמדגם ubate על קרח דק 10.
      2. העבר את הגרעינים צבעוניים DAPI לcoverslip המצופה פולי-ליזין, ומניח בשקופית מיקרוסקופ. לאטום את coverslip באמצעות לק השקוף.
      3. בדוק את שלמות הגרעינים, ונוכחותם של גרעיני GFP-tagged של עניין באמצעות מיקרוסקופ פלואורסצנטי. הערה: אין צורך לתקן את הגרעינים, או כתם של ה-GFP אם שקופיות אלה מנותחות במהירות סבירה לאחר הכנה (בתוך 24 hr).
    3. העברה 10 μl של homogenate המסונן לצינור מיליליטר טרי 1.5 ולהוסיף 90 μl של חיץ לשטוף (1x PBS, pH 7.4; 2.5 מ"מ MgCl 2). להוסיף DAPI לריכוז סופי של 0.1 מיקרוגרם / מיליליטר, ולדגור על קרח למשך 10 דקות. לקבוע את תשואת הגרעינים במדגם טרום הבידוד באמצעות hemocytometer לספור את גרעיני DAPI החיובי באמצעות epifluorescence תחת מטרת מיזוג 10X.
  7. מניחים את צינור 1.5 מיליליטר המכיל חרוזים בכריכת הנוגדנים (שהוכנו בסעיף 2.1.6) במעמד מגנטי,ולאפשר את חרוזים המגנטיים להיקשר לאבן שואבת עבור לפחות 2 דקות כפי שתוארו בסעיף 2.1.4. הסר את החיץ לשטוף מהחרוזים הנכנס נוגדנים באמצעות פיפטה 1 מיליליטר, ולהוסיף את homogenate המסונן משלב 2.5 לצינור 1.5 מיליליטר באמצעות פיפטה 1 מיליליטר.
  8. בעדינות להפוך את הצינור מספר פעמים על מנת לערבב, ודגירה על 4 מעלות צלזיוס במשך 30 דקות עם תסיסה קצה על הקצה. למנוע בועות בצינור במידת האפשר שכן אלו יכולים לגרום להתקבצות של הגרעינים.
  9. מניחים את צינור 1.5 מיליליטר המכיל חרוזים בכריכת הנוגדנים וhomogenate במעמד מגנטי, ולאפשר את חרוזים המגנטיים להיקשר לאבן שואבת עבור לפחות 2 דקות כפי שתוארו בסעיף 2.1.4. הסר את homogenate המכיל שבריר הגרעינים מאוגד באמצעות פיפטה 1 מיליליטר.
  10. לשטוף את המדגם 3x עם 1 מיליליטר של הצפה לשטוף בכל פעם. הסר את צינור 1.5 מיליליטר המכיל חרוזים, גרעינים ולשטוף חיץ מהמדף ולהפוך לערבב כמה פעמים, ואז למקם את הצינור במעמד המגנטי כמתוארבשלב 2.9 ולהסיר את supernatant באמצעות פיפטה 1 מיליליטר.
  11. הוסף 150 μl של חיץ לשטוף את החרוזים, אשר אמור להיות מחויב לגרעיני היעד. זה הוא המדגם שלאחר הבידוד. הכן את הדגימות לבדיקה מיקרוסקופית ומיצוי RNA שלאחר מכן.
    1. העברת 20 μl של מדגם הודעה הבידוד לצינור 1.5 מיליליטר טרי וכתם עם DAPI ולנתח כאמור בסעיף 2.6.2. לספור את ה-GFP / + + DAPI וGFP-/DAPI + גרעינים שנתפסו על ידי חרוזים מגנטיים כדי לקבוע את הטוהר של ה-GFP המועשר + גרעינים במדגם שלאחר הבידוד.
    2. הוסף 1 מיליליטר של מגיב Trizol לשאר מדגם הודעה הבידוד, להפוך לערבב, ולאחסן ב -20 ° C לבידוד לאחר RNA (שלב 3.1). הערה: דוגמאות בTrizol יכולות להיות מאוחסנות במשך כמה שבועות אם יש צורך ב -20 ° C. אין זה הכרחי כדי elute הגרעינים מהחרוזים המגנטיים לפני מיצוי RNA באמצעות מגיב Trizol, becausדואר חרוזים לא להפריע לבידוד RNA שלאחר מכן.

3. לקבוע רמות תמליל בגרעינים מבודדות מרקמות הזחל

  1. בודד RNA מהדגימות טרום בידוד ולאחר בידוד הכנה בסעיפים 2.6.1 ו2.11.2 באמצעות הפרוטוקול הסטנדרטי תאר להפקת RNA מבוססת Trizol (ראה חומרים PDF) בשינויים הבאים:
    1. בעקבות משקעים של גלולה RNA, להוסיף 19.2 μl מים RNase חינם ו0.8 μl של מגיב RNASecure (ראה חומרים PDF) לגלולה ולדגור על 60 מעלות צלזיוס למשך 20 דקות כדי להשבית RNases.
  2. קבע את ריכוז RNA עם פלורסנט לצבוע-RNA מחייב, דוגמת ערכת assay RNA קיוביט (ראה חומרים PDF) באמצעות fluorometer QubitR 2.0 הבאות הפרוטוקול של היצרן.
  3. לסנתז cDNA באמצעות טרנסקריפטאז הפוך הגברה כגון EpiScrIPT הפוך ערכת טרנסקריפטאז ופריימרים oligodT הבאה הוראות היצרן. הערה: בדרך כלל, 50-100 ng של RNA יוצר cDNA מספיק כדי לבצע ביטוי גנים מרובה מנתח. יש להשתמש בכמויות שווה ערך של טרום בידוד ו-RNA הודעה הבידוד לייצר cDNA.
  4. הוספת 180 μl מים nuclease ללא מדגם cDNA 20 μl לדלל את הניתוח הזה פי 10 לפני זמן אמת PCR כמוני (qPCR). דילול זה הוא צעד חשוב, כי דגימות cDNA חי יכולות לעכב את qPCR.
  5. הכן תערובת אב qPCR עם פולימראז וdNTPs, 4 pmoles כל אחד מקדימה לאחור תחל, מורכב עם מים סטריליים לסופית עוצמת התגובה של 20 μl.
    1. לתכנן פריימרים qPCR למקד גנים אשר צפוי לבוא לידי ביטוי בסוג התא של עניין, ובשלב ההתפתחותי שבו הרקמה שנאסף. פריימרים עיצוב תוחלת אינטרון אם אפשר, כך שגנומיניתן להבחין בין מוצרי cDNA-PCR. הערה: אם פרופיל ביטוי גנים מסוג תא היעד אינו ידוע, פריימרים נגד eGFP, שצריך לבוא לידי ביטוי באופן ספציפי באוכלוסיית הגרעינים מתויגת, ניתן להשתמש בם כדי לייעל את הפרוטוקול לסוג תא מסוים ורקמות (טבלה 1).
  6. לקבוע את רמות התמליל היחסית של כל גן של עניין בדגימות טרום בידוד והודעת בידוד בהשוואה לסדרת דילול של cDNA שהוכנה מכל הרקמה. רמות התעתיק של גנים המטרה צריכה להיות מנורמלות לגן התייחסות כגון Rpl32 (או רצוי כמה גנים התייחסות).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

נהג repo-GAL4 (מספר המניות בלומינגטון 7415) בא לידי ביטוי במיוחד בתאי גליה במערכת העצבים דרוזופילה בשלבים שונים של פיתוח 18. זבובים שנוצרו ביציבות להביע כטב"מ-EGFP :: MSP-300 KASH תחת שליטה של נהג repo-GAL4 תוך שימוש בטכניקות גנטיות סטנדרטיות. כדי לאפיין את דפוס הביטוי של EGFP :: transgene KASH בזבובים אלה, הדפוס של ביטוי ה-GFP באונה אופטית גזור ודיסק דמותי עין מזחלי instar שלישיים נבדק באמצעות מיקרוסקופיה confocal. רקמות גזורים היו counterstained עם DAPI לסמן DNA ועם α-chaoptin 19 לתייג אקסונים קולטי אור (mAb24B10, ראה חומרים PDF). איור 1A מראה כי EGFP מונע repo-GAL4 :: transgene KASH בא לידי הביטוי בגליה באונות אופטיות ודיסק דמותי עין בדפוס הביטוי הצפוי. תחת הגדלה גבוהה יותר,ביטוי EGFP הוא ציין בתבנית עגולה המקיפה את ה-DNA DAPI החיובי, עולה בקנה אחד עם לוקליזציה גרעינית מעטפה של EGFP :: תג KASH (איור 1). ביטוי EGFP יכול להתגלות גם ברכוש קבוע וברקמות מבולבל ללא הצורך בהגברת אות באמצעות נוגדן כנגד GFP; נוגדנים נגד ה-GFP לא שימשו כדי להמחיש את EGFP :: ביטוי KASH בתמונות שמוצגים באיורים 1 ו -2. כדי לקבוע אם transgene EGFP :: KASH מתבטא nonspecifically בכל רקמות אחרות בזחלי דרוזופילה, הביטוי של GFP נבחן בזחלי instar השלישי כולו באמצעות הקרינה לנתח מיקרוסקופ. יש לציין, ביטוי ספציפי של EGFP :: transgene KASH נצפה ברמות גבוהות בבלוטות הרוק של זחלי instar שלישיים. זה מצביע על כך יש לנהג repo-GAL4 פעילות בכמה סוגי תאים אחרים מאשר גליה בשלב הזחל של פיתוח. לפיכך, כדי לבודד Gli במיוחדגרעיני אל, האונה אופטית ודיסק דמותי עין מזחלי instar שלישיים היו מבודדים באמצעות נתיחה לפני המגון וזיקה בידוד.

כדי לוודא שפרוטוקול זה מתאים למיצוי של גרעינים מרקמות דרוזופילה, וכדי להעריך את אחוז הגרעינים מתויגים נוכח ברקמה מסוימת, המדגם טרום הבידוד (סעיף 2.6.2) מhomogenates מתקבלת מהאונה אופטית ועין דיסק דמותי של repo-GAL4, כטב"מ-EGFP :: זחלי instar השלישי MSP-300 KASH נבדקו. איור 2A מציג תמונה מייצגת של המדגם טרום הבידוד הושג באמצעות מיקרוסקופיה confocal. בתמונה זו, נוכחותם של גרעינים מסומנת על ידי אירועי DAPI חיובי. מספר קטן של, גרעיני DAPI החיובי GFP החיובי מפוזרים בדלילות גליה גם נצפה. אנו מעריכים כי גרעיני GFP חיובי מהווים פחות מ -2% מאוכלוסיית הגרעינים הכוללת בזהמדגם (איור 2 א). תשואת הגרעינים הכוללת מאונה אופטית ודיסקים דמותי העין שנותחו מ100 זחלים נקבעה למדגם טרום הבידוד כאמור בסעיף 2.6.3 (טבלה 2). מדגם טרום בידוד טיפוסי מ100 דיסקים גזורים אונה אופטית והעין דמותי הכילו בין 0.8 ו1.2 x 10 7 גרעינים, מתוכם כ 2% היו GFP חיובי. איור 2B מראה תמונה מייצגת של גרעיני DAPI החיוביים באזור מוגדר של hemocytometer. שים לב שהגרעינים הם שלמים, ולשמור על צורה עגולה עקבית בתנאי החילוץ בשימוש בפרוטוקול (2A דמויות ו2B).

כדי לקבוע אם פרוטוקול זה יכול לשמש כדי לבודד ו / או מאוד להעשיר את האוכלוסיות ספציפיות של גרעינים שכותרתו מרקמות שמכילות אוכלוסיות תאים מעורבים, חרוזים מגנטיים המצופים בנוגדנים α-GFP היו שימושד לבודד את הגרעינים מתויגים מhomogenates מתקבלת מהאונה אופטית והדיסק דמותי עין 100 repo-GAL4, כטב"מ-EGFP :: זחלי instar השלישי MSP-300 KASH. ב2C דמויות ו2D, ניתן לראות כי EGFP :: KASH מתויג לאגד גרעיני גליה לחרוזים המגנטיים α-GFP המצופה והם נצפו במדגם שלאחר הבידוד (הסעיף 2.11.1) לאחר הפרדה מגנטית. למרות חרוזים המגנטיים תערוכה כמה autofluorescence בערוץ ה-GFP, אלה יכולים להיות מובחנים בקלות מגרעינים מאוגד חרוז על ידי הגודל שלהם קטן יותר (2.8 מיקרומטר לחרוזים המגנטיים לעומת כ 5 מיקרומטר לגרעינים) וחוסר מכתים DAPI. ה-GFP + / DAPI + הגרעינים מהווים יותר מ 95% מאירועים חיוביים DAPI בהודעת מדגם הבידוד. לפיכך, היעד מתויג אוכלוסיית גרעינים מועשרים בהודעת בידוד המדגם ביחס לטרום הבידודמדגם. רוב הגרעינים בקרינת הצג הודעה מדגם בידוד החזקה גרעינית המעטפה המקומית ה-GFP, והם בדרך כלל מוקפים בחרוזים. עם זאת, לא מן הנמנע כי מספר קטן של גרעינים לא מתויגים גם יכול להיות נוכח במדגם זה. כך, למרות שהתוצאות באיור 2C ובניתוח ביטוי גנים באיור 3 (ראה בהמשך) מצביעות על כך שהיעד מתויג אוכלוסיית גרעיני גליה היא מועשרת ביותר, את האפשרות שכמה גרעינים מכמה סוגי תאים ספציפיים אחרים גם בהווה במדגם לא ניתן לשלול. מומלץ שמשתמשים לייעל את פרוטוקול זה לסוג המסוים שלהם תאים ורקמות של עניין על מנת למקסם את העשרתה של אוכלוסיית גרעין היעד, ולחסל את גרעינים לא ספציפיים מחייב. בפרט, היחס מתחיל יחסי מהותי לנוגדנים וחרוזים עשוי להיות חשוב להעשרה אופטימלית של גרעיני יעד. מסיבה זו, הטווחים בסך הכלמספרי גרעיני הווה בדגימות טרום הבידוד הטיפוסית שלנו מוצגים בטבלה 2. בהתבסס על המספרים הכולל הגרעינים הנוכחיים במדגם טרום הבידוד, והשיעור המוערך של תאי גלייה באוכלוסייה המעורבת מהאונה אופטית והדיסק דמותי עיניים, הייתה צפויה תשואת גרעינים המרבית במדגם ההודעה הבידוד להיות בין 1.6 x 10 5 ו2.4 x 10 5 גרעינים. עם זאת, השימוש בhemocytometer כדי לקבוע את תשואת הגרעינים כמתואר בשלב 2.6.3, תשואת הגרעינים המתקבלת בפועל במדגם שלאחר הבידוד הייתה בין 1.3 x 10 4 ו2.7 x 10 4 גרעינים. תשואות גרעינים אלה מייצגות הערכות גסות מאוד מכיוון שנראה כי חרוזים הנוכחיים במדגם ההודעה הבידוד-להשפיע טעינה מדויקת של hemocytometer. גרעיני GFP החיובי חלקם נצפו בhomogenate מאוגד, מצביעים על כך שלא כל גרעיני GFP חיובי ביםלאגד מספיק חרוזים ביעילות בתנאי השימוש בפרוטוקול זה. הגדלת הזמן מחייב או ביצוע צעדי בידוד רציפים עלולה להגדיל את התשואה הזאת, אבל זה עלול לבוא במחיר של שניהם טוהר ושלמות RNA. שימוש בתנאים שתוארו בפרוטוקול זה, ניתן לקבל כמויות מספיקות של RNA במדגם ההודעה הבידוד לצורך ניתוח ביטוי גנים במורד הזרם ידי qRT-PCR (טבלה 2). לפיכך, פרוטוקול זה הוא מסוגל במהירות ובקפדנות בידוד גרעיני יעד מרקמות שמכילות אוכלוסיות מעורבות של תאים. יתר על כן, הוא מסוגל לבודד במיוחד גרעיני היעד שמהווים רק חלק קטן, פחות מ -5%, של התאים באוכלוסיית נתונה.

כדי לאשר עוד כי הודעה מדגם הבידוד היה מועשר ברמה גבוהה לאוכלוסיית הגרעינים שלנו יעד גליה, הרמות של תמלילים ל4 גנים שונים בטרום הבידוד ופוסט בידוד-הושוו על ידי RT-qPCR. רמות תמליל elav, nrv2 וeGFP נקבעו בשתי דגימות, ומנורמל לגן ההתייחסות, Rpl32, אשר באו לידי ביטוי ברמות מקבילות בתאי גלייה ובמערכת העצבים המרכזיות שמסביב (איור 3). ההבדל של פי המדגם שלאחר הבידוד מוצג ביחס למדגם טרום הבידוד, אשר מוגדר לאחד. באיור 3, מדגם הודעה הבידוד מראה רמות נמוכות משמעותי של התמליל העצבי ספציפי elav הגן ביחס למדגם טרום הבידוד. זה מצביע על כך גרעינים מהתאים עצביים נמצאים בהודעת מדגם הבידוד תחת הייצוג. לעומת זאת, רמות גבוהות יותר של התמליל הן את הגן מועשר גליה nrv2 10 וeGFP נמצאות בהודעת Isola-tion מדגם ביחס למדגם טרום הבידוד. תוצאה זו מצביעה על כך שהודעת מדגם הבידוד הוא מועשר ביותר לאוכלוסיית גרעיני גליה היעד. חשוב לציין כי רמות התמליל נמדדו בפרוטוקול זה מייצגים תמלילים גרעיניים, ולכן הם עשויים להצביע על רמות שעתוק פעיל ולא mRNA מצב יציב. ביטוי לשחזור של ריפו לא זוהה בכל הדגימות טרום הבידוד או הודעה בידוד שלנו, מה שמראה כי חלבון Gal4 לידי ביטוי על ידי נהג repo-GAL4 עלול להימשך לאחר שעתוק פעיל של הגן ריפו אנדוגני חדל. זה עולה בקנה אחד עם תוצאות ממחקרים אחרים שבהם גרעינים שכותרתו באמצעות אמרגן הטווי לא מראים רמות מועשרת של תמלילי טווי, אולי בשל הבדלים בעיתוי ההתפתחותי של שעתוק לעומת יציבות חלבון 8. Taken יחד, תוצאות אלו מראות כי הפרוטוקול המתואר יכול לשמש בהצלחה למאוד להעשיר את גרעיני יעד מרקמות שמכילות אוכלוסיות מעורבות של תאים, וכי הגרעינים המבודדים מתאימים לניתוח ביטוי גנים.

איור 1
איור 1. דפוס ביטוי של repo-GAL4, כטב"מ-EGFP :: MSP-300 KASH לטוס קו. (א) בזחלי instar שלישיים, repo-GAL4 מניע ביטוי של transgene כטב"מ-EGFP :: MSP-300 KASH בתאי גלייה באופטי אונה, גבעול אופטי (OS) ודיסק עין דמותי (ED). מעטפת הגרעין בתאי גליה מתויגת עם EGFP :: KASH (ירוק). R1 - האקסונים של תאי קולטי אור R8 מסומנים עם α-chaoptin (mAB24B10, אדום) להשוואה, וה-DNA הוא staלעצמה עם DAPI (סגול). גרעיני גליה-GFP שכותרתו נראים לאורך lamina (לה) באונה אופטית (מסומן בחצים). סרגל קנה מידה, 50 מיקרומטר. (ב) תמונה בהגדלה גבוהה יותר של גרעיני lamina של האונה אופטית המכילה EGFP :: KASH כותרתו גרעיני תאי גליה. סרגל קנה מידה, 50 מיקרומטר. תמונות confocal נרכשו באמצעות אחת   40X / 1.30 נפט או   20X / 0.75 אובייקטיבי שמן טבילה, ושימוש באורכי גל עירור / פליטה של 408 nm/425-475 ננומטר (DAPI); 488 nm/525-550 ננומטר (GFP); 561 nm/595-620 ננומטר (Alexa 5,6,8 ). אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2. אפיון של גרעיניםובדגימות "טרום בידוד" "הודעה בידוד". (א) תמונת נציג מריפים-GAL4, כטב"מ-EGFP :: מדגם טרום בידוד MSP-300 KASH נותח באמצעות X 20 / 0.75 אובייקטיבי טבילת שמן וסטנדרטי מיקרוסקופ confocal. ה-DNA הוא מוכתמת בDAPI (כחול), וEGFP :: KASH מתויג גרעיני גליה מוצגים בירוק (מסומנת בחצים). סרגל קנה מידה, 50 מיקרומטר. (ב) תמונת נציג של גרעינים צבעוניים DAPI ממדגם טרום בידוד על hemocytometer באמצעות מטרת אוויר X 10 ומיקרוסקופ epifluorescence הסטנדרטי. רשתות hemocytometer מוצגות בצבע אפור בהיר. גרעינים רק DAPI החיובי מוצגים בתמונה זו, כמו הקרינה ה-GFP לא הייתה גלויה מתחת ליעד זה במיקרוסקופ epifluorescence. (ג) תמונת נציג מrepo-GAL4, כטב"מ-EGFP :: הודעה מדגם בידוד-MSP-300 KASHניתח כפי שתואר לפנל. EGFP המבודד :: KASH מתויג גרעיני גליה (מסומנים בחצים) כתם באופן חיובי לDAPI, ומוקף בחרוזים, שautofluoresce ברמות נמוכות בערוץ ה-GFP. סרגל קנה מידה, 50 מיקרומטר. תמונה בהגדלה גבוהה (D) של EGFP המבודד אופייני :: KASH מתויגת גרעיני גליה (מסומנים בחץ) מוקפים בחרוזים. סרגל קנה מידה, 5 מיקרומטר. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3. נתוני qRT-PCR נציג "טרום בידוד" ודוגמאות "פוסט בידוד". רמות תעתיק של גנים המטרה נקבעו על ידי qRT-PCR של טרום Isolדגימות ation והודעת בידוד המתקבלות מrepo-GAL4, כטב"מ-EGFP :: אונות אופטיות MSP-300 KASH ודיסקים דמותי עין. כל רמות התמליל מנורמלות לרמות תמליל Rpl32, והמדגם טרום בידוד לכל יעד גן מוגדר אחד. נציג תוצאות מניסוי אחד ביולוגי מוצגות לגנים הבאים: elav, nrv2 וeGFP.

גן רצף פריימר (5 '-3') מוצר ה-PCR גודל (נ"ב)
eGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
elav GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

טבלת 1. צבעי יסוד המשמשים לניתוח qRT-PCR.

מספר כולל של גרעינים במדגם טרום בידוד מספר כולל משוער של גרעינים במדגם שלאחר הבידוד תשואת RNA מהודעת מדגם בידוד (NG)
0.8-1.2 x 10 7 1.3-2.7 x 10 4 160-220 ng

טבלה 2. גרעיני נציג ותשואות RNA שהושגו.טווחים אופייניים של גרעינים ותשואות RNA המתקבלים דגימות טרום בידוד ולאחר בידוד מ100 אונה אופטית גזור ודיסקים דמותי עין מrepo-GAL4, כטב"מ-EGFP :: גנוטיפ MSP-300 KASH, שבו תאי גליה מסומנים עם EGFP :: KASH. גרעינים היו לכמת כמתואר ב2.6.3 ו-RNA היה לכמת כמתואר ב3.1.2.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

פרוטוקול זה יכול לשמש כדי לבודד או מאוד להעשיר במיוחד גרעינים מתויגים מאוכלוסיות תאים מעורבות בעוברי דרוזופילה או רקמות זחל. באמצעות פרוטוקול זה, ניתן לבודד מרקמות גזורים גרעינים בכ 1 שעות. טוהר והתשואה של הגרעינים המבודדים חייבים להיקבע באופן ניסיוני לכל סוג תא. זה יכול להיות קשה לכמת את הגרעינים מאוגדים חרוז בשלב שלאחר הבידוד של הפרוטוקול באמצעות hemocytometer בגלל חרוזים ההווה במדגם. לכן, אם מספרים של גרעינים מדויקים הנדרשים ליישום במורד הזרם, יהיה צורך להעריך תשואת גרעינים המבוססים על שיטה חלופית כגון תוכן ה-DNA. חישובים מדויקים של תשואת גרעינים אינם נחוצים לצורך ניתוח ביטוי גנים אם RNA יכול להיות מבודד בהצלחה וכימות. מומלץ להשתמש בשיטה המבוססת על הקרינה לכימות תשואת RNA, שכן מצאו כי נחישות spectrophotometric ריכוז RNAבדגימות ריכוז נמוכות אלה הוא משתנים מאוד.

ישנם שני היבטים חשובים של הפרוטוקול שישפיעו על הצלחתו: הבחירה של חרוזים ונוגדנים מגנטיים. חרוזים מגנטיים שהם מצמידים לGFP או חלבון G זמינים מסחרי מכמה מקורות שונים. עם זאת, מומלץ מאוד להשתמש בחלבון חרוזים המגנטיים G זמינים Invitrogen להליך מתואר בפרוטוקול זה משתי סיבות עיקריות. ראשית, בגודל של חרוזים Invitrogen ב2.8 מיקרומטר הוא מעט קטן יותר מהגודל הממוצע של הגרעינים בסוגי התאים שנבדקנו, המהווה כ 5 מיקרומטר (איור 2 ד). חרוזים מגנטיים כי הם קטנים יותר (למשל 50 ננומטר, μMACS α-GFP, Miltenyi ביוטק) לא להיקשר במהירות למגנטי סגנון אצווה לשטוף, והעמודות הניתנות לחרוזים אלה יכולים לסתום עם תמציות רקמות זחל. חרוזים מגנטיים גדולים יותר (למשל 10 מיקרומטר, חלבון PureProteome ב מגנטי GEADS, Millipore) לא להיקשר גם לגרעינים בבדיקות הראשוניות שלנו, ואלה גם תערוכת autofluorescence החזק באותם אפיקים כמו גם DAPI וה-GFP, ולכן קשה לזהות גרעינים במדגם מאוגד חרוז על ידי טכניקות במיקרוסקופ רגילות. בנוסף לבחירה של חרוזים מגנטיים, חשוב להשתמש בנוגדן ה-GFP שעובד היטב עבור immunoprecipitation אבל שאין לה רקע ספציפי גבוה. כדי לסייע בשחזור של פרוטוקול זה, יש לנו להשתמש בעכבר נוגדן חד שבטי כנגד ה-GFP. נוגדני ארנב polyclonal נגד ה-GFP גם trialed בהצלחה במחקרים הראשוניים שלנו, אבל אלה נטו יש רקע ספציפי גבוהה יותר. נוגדנים חד שבטיים אחרים גם נבדקו (למשל מחקרים Hybridoma בנק התפתחותית), עם רמות שונות של הצלחה. לכן, בחירה של נוגדן היא גורם חשוב בבידוד המוצלח של גרעינים שכותרתו.

אמנם בפרוטוקול זה אנו מתארים שיטות לDetרמות תעתיק גן סמור בגרעינים מבודדים, שצפוי שהגישה המתוארת בצעדים 2.1-2.11 תהיה גם מתאימה לבידוד גרעינים שיכולים לשמש לניתוח immunoprecipitation הכרומטין שלאחר מכן. אם רקמה קבועה בפורמלדהיד 1% לפני הומוגניזציה (שלב 2.3), ניתן לאסוף רקמות לאחר מכן גזורים על פני כמה ימים ומספיק חומר מבודד לבצע ניתוח immunoprecipitation הכרומטין. בהתבסס על סעיפים שהושגו באמצעות hemocytometer, המספקים רק הערכות גסות כפי שפורט לעיל, אנו בדרך כלל מתקבלים 1.3 x 10 4 ו2.7 x 10 4 גרעיני גליה מהדיסק דמותי העיניים והאונה אופטית של 100 זחלים (טבלה 2). לפיכך, שימוש בגישה שלנו, זה צריך להיות אפשרי כדי להשיג חומר מספיק כדי לבצע ניתוח immunoprecipitation הכרומטין, בהתאם לשפע של סוג התא הממוקד, וepitope של עניין.

יישום גנטי שימושי אחד techni זהque הוא שהוא יכול לשמש תווית חיובית גרעינים בסוגי תאים מסוימים בעוברים או זחלים שהם הומוזיגוטים לאלל מוטנטי הקטלני רצסיבי. כדי להשיג זאת, שתי מניות זבוב נפרדות חייבת להיות שנוצרו שבו אלל מוטנטי של ריבית recombined עם נהג Gal4 ספציפי, או עם transgene כטב"מ-EGFP :: MSP-300 KASH על כרומוזום השלישי. אם זבובים נושאים אלל מוטנטי ונהג Gal4 הם חצו לזבובים שנשאו אללים מוטנטים וtransgene כטב"מ-EGFP :: MSP-300 KASH, רק צאצאים שיש להם שני העותקים של אלל מוטנטי יהיה מסומן עם GFP ברקמות שבי נהג Gal4 בא לידי ביטוי. לפיכך, ניתן לבחון השפעות תא ספציפי של אללים קטלניים רצסיבי בשלבים העובריים או זחל, לפני השלב של הקטלניות. טכניקה גנטית זו שימשה בעבר לתווית חיובית תאים בשריר עוברי שהיו הומוזיגוטים למוטציות במקטע SAGA, sgf11 1 </ Sup>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

יש המחברים אין לחשוף.

Acknowledgments

אנו מודים לג'ניס פישר למתן פלסמיד כטב"מ-EGFP :: MSP-300 KASH. נוגדן mAB24B10 הושג ממחקרי Hybridoma הבנק התפתחותית שפותח בחסות NICHD ומתוחזק על ידי אוניברסיטת איווה, המחלקה לביולוגיה. מניית repo-GAL4 (BL7415) התקבלה ממרכז מלאי בלומינגטון באוניברסיטת אינדיאנה. תמיכה מהאגודה האמריקנית לסרטן המוסדי מענק המחקר (IRG # 58-006-53) למרכז אוניברסיטת פרדו לחקר הסרטן היא הודה בהכרת תודה. Jingqun מא נתמך על ידי מחקר חקלאי בבית הפרד assistantship במזון וחקלאות מאוניברסיטת פרדו.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
בידוד מבוסס זיקה של תייג גרעינים מ<em&gt; דרוזופילה</em&gt; רקמות לניתוח ביטוי גנים
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter