Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Affinity basert Isolering av Tagged Nuclei fra doi: 10.3791/51418 Published: March 25, 2014

Summary

Drosophila vev inneholder ofte en heterogen blanding av celletyper. For å undersøke genekspresjon i spesifikke celletyper fra et bestemt vev, kan kjerner bli genetisk kodet og deretter isolert ved hjelp av en affinitets-baserte metode. Isolerte cellekjerner kan brukes til nedstrøms applikasjoner som genekspresjonsanalyse og kromatin immunoutfelling.

Abstract

Drosophila melanogaster embryonale og larve vev inneholder ofte en svært heterogen blanding av celletyper, noe som kan vanskeliggjøre analyse av genekspresjon i disse vev. Således, for å analysere cellespesifikk genekspresjonsprofiler fra Drosophila vev, kan det være nødvendig å isolere spesifikke celletyper med høy renhet og i tilstrekkelige utbytter for nedstrøms applikasjoner som transcriptional profilering og kromatin immunoutfelling. Imidlertid kan de irregulært cellulær morfologi i vev som det sentrale nervesystemet, kombinert med den sjeldne populasjon av spesifikke celletyper i disse vev, by på utfordringer for tradisjonelle metoder for celleisolasjon som laser mikrodisseksjon og fluorescens-aktivert cellesortering (FACS) . Her er en alternativ tilnærming for å karakterisere celle-spesifikk genekspresjon profiler ved hjelp av affinitets-baserte isolering av merkede kjerner, i stedet for hele celler, er beskrevet. Kjerner i den spesifikke cell type interesse er genetisk merket med et kjernefysisk konvolutt-lokaliserte EGFP tag bruker Gal4/UAS binære uttrykk system. Disse EGFP-merkede kjerner kan bli isolert ved hjelp av antistoffer mot GFP som er koplet til magnetiske kuler. Fremgangsmåten som beskrives i denne protokollen muliggjør jevn isolering av kjerner fra spesifikke celletyper i Drosophila larvesentralnervesystemet ved høy renhet og i tilstrekkelige nivåer for ekspresjon analyse, selv når disse celletypene utgjør mindre enn 2% av den totale cellepopulasjon i vev. Denne tilnærmingen kan brukes for å isolere kjernen fra et bredt utvalg av Drosophila embryo-og larvecelletyper ved å bruke spesifikke Gal4-drivere, og kan være nyttig for å isolere kjernen av celletyper som ikke er egnet for FACS eller laser mikrodisseksjon.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Drosophila vev slik som sentralnerve-systemet inneholder en kompleks blanding av celletyper. Således, for å analysere cellespesifikk genekspresjonsprofiler fra Drosophila vev, er det først nødvendig å isolere en homogen populasjon av bestemte celler i tilstrekkelige mengder til å muliggjøre nedstrøms applikasjoner. Metoder for å isolere celler fra intakt vev omfatter laser mikrodisseksjon, og fluorescens-aktivert cellesortering (FACS) av hele celler. Mens FACS har blitt brukt for å isolere celler og kjerner fra Drosophila embryo og fra Caenorhabditis elegans for genekspresjon og kromatin profilering 1-3, kan FACS og laser mikrodisseksjon være vanskelig å utføre med hell i vev som inneholder svært blandede celletyper eller som inneholder celler med uregelmessig morfologi, slik som nerveceller. For å overvinne denne vanskelighet, kan kjerner i stedet for cellene blir isolert fra bestemte celletyper, og som brukes for etterfølgende gene uttrykk profilering. Viktigere, microarray-baserte mRNA uttrykk analyse ved hjelp av kjernefysiske RNA prøver viser generelt sammenlignbare resultater med det utføres ved hjelp av total RNA fire, fem. Videre har genekspresjonsanalyser bruker atom RNA blitt brukt til å studere genuttrykk i flere organismer inkludert C. elegans, Arabidopsis thaliana, Drosophila, og mennesker 4, 5 2, 3.

En rekke angrepsmåter har nylig blitt beskrevet for isolering av spesifikke populasjoner av merkede kjerner fra Drosophila vev som er egnet genekspresjonsanalyse og / eller kromatin immunoutfelling for. Batchen isolering av vev-spesifikk kromatin for immunoutfelling (bits-chip)-metoden benytter FACS for å isolere faste kjerner på grunnlag av celletype spesifikk ekspresjon av atom lokalisert GFP 2. Denne tilnærmingen har vært successfully brukt for å analysere fordelingen av histon modifikasjoner og transkripsjonsfaktorer ved hjelp av kromatin immunoutfelling av isolerte kjerner fra mesoderm of Drosophila embryo 2. Imidlertid kan FACS-baserte metoder være mindre egnet til å isolere merkede kjerner som utgjør bare en liten andel av en blandet befolkning på grunn av økt sorterings tiden som er nødvendig for å oppnå passende tall for nedstrøms-anvendelser. For å overvinne disse begrensninger har flere grupper benyttet affinitets-baserte isolasjonsteknikker for å rense kjerner som er merket med en spesifikk epitop i et bestemt celletype. Isoleringen av atomkjerner merket i spesifikke celletyper (INTACT)-metoden som er utviklet for bruk i Arabidopsis thaliana 6, 7 har nylig blitt tilpasset for bruk i Drosophila 8.. I denne metode blir et atom konvolutt fusjonsprotein som et substrat for in vivo biotinylering er coexpressed med Escherichia coli biotin ligase Bira i bestemte celletyper. Biotin-merkede kjerner kan deretter renses fra blandede populasjoner ved hjelp av streptavidin-baserte affinitet isolasjon. Ved hjelp av denne metode, ble det atomkjerner med hell merket og isolert fra mesoderm of Drosophila embryo i hvilken en kjernefysisk konvolutt fusjonsprotein som ble uttrykt under kontroll av en mesoderm-spesifikk forsterknings 8.. Forfatterne har også generert atom konvolutt fusjonsproteiner som kan uttrykkes i en hvilken som helst celletype under kontroll av Gal4 regulatorisk sekvens, UAS 9.. Denne tilnærmingen er i stand til raskt å isolere undergrupper av merket kjerner fra blandede bestander, men krever tre separate transgene konstruksjoner og kan derfor være uegnet for spesielle genetiske programmer. Nylig har en tilnærming blitt beskrevet som SUN (S ad1 og FN-C-84) domene inneholder proteiner som lokalisere til den indre membran av kjernefysiske konvolutten ble merket medfluorescerende proteiner og uttrykkes under kontroll av Gal4/UAS systemet 10. Nuclei ble isolert i nærvær av ikke-ionisk tensid for å fjerne den ytre membran av atom konvolutten, og affinitets-renset ved anvendelse av magnetiske kuler koblet til anti-GFP antistoffer. Denne tilnærmingen ble brukt til å isolere små populasjoner av merket kjerner fra spesifikke nevronale undergrupper innenfor den voksne hjernen av Drosophila 10.

Her er en protokoll for isolering av merkede kjerner fra en blandet populasjon av celler fra Drosophila larve vev er beskrevet. Denne metoden ble utviklet uavhengig av hverandre, men er lik den metode som er beskrevet av Henry et al. 10. Først ble kjerner som er merket med et fluorescent merke som er uttrykt i spesielle celletyper i Drosophila melanogaster for å lette den etterfølgende isolering av merkede kjerner fra blandede populasjoner ved hjelp av en affinitets-baserte metode. Slik merker kjerner,den KASH (K larsicht / A nc-1 / S yn h omology) domenet ble benyttet. Den KASH domenet er en transmembrane domene som lokaliserer til den ytre membran av kjernefysiske konvolutten, blant annet gjennom samhandling med søn domene inneholder proteiner innenfor oppklaring rundt kjernen plass 11. Den C-terminale domene KASH av proteiner slik som Drosophila MSP-300 og Klarsicht forankrer disse proteinene i den ytre kjernemembranen, mens de N-terminale domener samhandle med cytoskjelett proteiner som aktin eller mikrotubuli i cytoplasma 12-14. Konstrukter ble samlet hvori KASH domenet til Drosophila MSP-300 ble fusjonert til C-terminalen av EGFP, under kontroll av Gal4 regulatorisk sekvens, UAS i pUAST-attB vektor 15, 16. Bruke phiC31 stedsspesifikke integrasjon, ble transgene fluer generert der UAS-EGFP :: Msp-300 KASH transgenet ble satt inn i attP2 loci på kromosom3L 17. Den UAS-EGFP :: MSP-300 KASH fluer kan krysses med fluer som uttrykker Gal4 driver i en bestemt celletype, noe som resulterer i målrettet ekspresjon av EGFP på den ytre kjernemembranen i celletype av interesse. Merkede kjerner kan deretter bli renset fra blandede cellepopulasjoner ved å bruke antistoffer mot GFP koplet til magnetiske kuler. I denne fremgangsmåten, er bruken av ikke-ionisk tensid er ikke nødvendig fordi EGFP-koden er lokalisert til den cytoplasmatiske side av den ytre kjernemembranen, og er derfor tilgjengelig for antistoffer.

Den protokoll som er beskrevet nedenfor, kan brukes til å isolere / berike EGFP-merkede kjerner fra spesifikke celletyper i Drosophila larve vev, for å kvantifisere renhet og utbytte av isolerte kjerner, og for å trekke ut kjerne RNA egnet for kvantitativ revers-transkripsjon polymerasekjedereaksjon (QRT genekspresjonsanalyser-PCR). Isoleringen og affinitets-rensing av kjerner (unntatt tissue disseksjon) kan utføres i mindre enn én time. Resultatene er presentert som viser at glial kjerner kan med hell isolert fra larveoptiske lobe og øye imaginal plate, og som brukes for etterfølgende genekspresjon analyse. Det er forventet at denne tilnærmingen er nyttig for isolering / anrikning av merkede kjerner fra embryoniske-og larve vev hvori målcellene utgjør mindre enn 5% av den totale populasjonen. Alle Drosophila aksjer og plasmider som genereres i denne studien er tilgjengelige fra forfatterne på forespørsel.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En. Generasjon og karakterisering av EGFP :: KASH Drosophila

  1. Cross Gal4 driver flyr til UAS-EGFP :: Msp-300 KASH flyr. Alternativt kan rekombinante fluer som bærer både Gal4 driver og UAS-EGFP :: Msp-300 KASH transgenet bli generert ved hjelp av standard genetiske teknikker. Denne andre fremgangsmåten er fordelaktig hvis et stort antall avkom er nødvendig.
  2. Karakter uttrykk for EGFP :: KASH markør ved hjelp av standard mikroskopi teknikker. Merk: EGFP uttrykk kan bli observert av standard mikroskopi teknikker i dissekert, faste Drosophila vev, eller i hele larver, og krever ikke bruk av et antistoff.
    1. Bestem uttrykket mønster av EGFP :: KASH markør på hele organismen under et fluorescens dissekere mikroskop (se Materialer PDF). Merk: Mange Gal4 drivere, inkludert repo-Gal4 driver vist i figur 1, utstillings nonspecific mønstre uttrykk i andre larve vev som spyttkjertelen (se resultater).
    2. Analyser EGFP :: KASH uttrykk mønster i dissekert vev av interesse å bruke konfokalmikroskopi.
      1. Fiks vev av interesse ved bruk av formaldehyd ved en sluttkonsentrasjon på 4%, og beis-DNA ved hjelp av DAPI ved en endelig konsentrasjon på 0,1 ug / ml for å visualisere lokaliseringen av EGFP :: KASH signal relativt til DNA.
      2. Innhente bilder ved hjelp av enten en 40X / 1,30 oljeneddyppingsobjektivet eller en 20X / 0,75 oljeneddyppingsobjektivet, avhengig av størrelsen av vevet av interesse. Følgende eksitasjon / utslippsforhold kan brukes for bildeopptak: 408 nm/425-475 nm (DAPI), 488 nm / 525-550 nm (GFP).

2. Isoler Nuclei fra Drosophila Larve Vev

  1. Forbered utstyr for larve vev disseksjon og påfølgende kjerner isolasjon. Legg merke til atHele dechorionated embryoer kan også brukes som utgangsmateriale, om ønskelig. Det anbefales å bruke delvis dissekert larve vev i stedet for hele larver hvis cellen type interesse er til stede i et bestemt vev som imaginal plate. Dette reduserer ikke-spesifikk binding, og eliminerer problemer som kan være forårsaket av uttrykk for noen Gal4 drivere i targetnukleinsyre celler også.
    1. Forbered to par skarpe tang (se Materialer PDF), en silikonisert 9-vel glassplate (se Materialer PDF), og PBT (1x PBS, pH 7,4, 0,1% Tween-20).
    2. Prebind GFP antistoff til de magnetiske kuler. Dette trinnet bør startes før disseksjon. Tilsett 10 pl av de magnetiske perler (Invitrogen, se Materialer PDF) og 2 ug av GFP-antistoff (Roche, se Materialer PDF) til 400 ul av vaskebuffer (1 x PBS, pH 7,4, 2,5 mM MgCl 2) i et 1,5 ml rør . Mengden av perler og antistoff som brukes kan optimaliseres ved behov basert på mengden av target i sample og bindingsaffiniteten av antistoffet til kulene.
    3. Inkubering av kulene og antistoff med rotasjon i minst 30 min ved romtemperatur.
    4. Plasser 1,5 ml rør inneholdende perler og antistoff i det magnetiske stativet (se Materialer PDF) og tillate kulene å binde seg til den magnetiske ca 1-2 min. Fjern supernatanten inneholdende ubundet antistoff og vaskebuffer ved hjelp av en 1 ml-pipette. Perlene vil forbli bundet til veggen av 1,5 ml rør på den siden som grenser til magneten.
    5. Skyll perlene to ganger med 1 ml vaskebuffer hver gang som beskrevet i seksjon 2.1.4. Fjern 1,5 ml rør fra magnetstativ og invertere kort for å blande perlene og vaske-buffer i løpet av hvert vasketrinn.
    6. Oppbevar antistoff-bundet perler i vaskebuffer til den er klar til å fortsette med trinn 2.7. Perlene bør ikke få lov til å tørke ut på ethvert stadium av protokollen.
  2. Dissekere larve vev i PBT og overføre dissekert vev tilén brønn av en 9-vel fatet. Vanligvis disseksjon av syns lapp og øyet imaginal plate fra 100 tredje stadiums larver gir tilstrekkelig materiale for nedstrøms genekspresjonsanalyser følgende atomkjerner isolasjon.
  3. Skyll det isolerte vev i atom ekstraksjon buffer (10 mM HEPES-KOH, pH 7,5, 2,5 mM MgCl2, 10 mM KCl) i et 1,5 ml rør. Overfør isolerte larve vev til en 1 ml Douce-Homogenizer (se Materialer PDF) på is som inneholder 1 ml friskt buffer atom ekstraksjon. Inkuber på is i 5 min. Det er ikke nødvendig å tilsette proteaseinhibitorer dersom RNA som skal ekstraheres følgende kjerner isolasjon.
  4. Bryt vevet ved 20 slag med den løse støter og deretter inkubere prøven på is i 10 min for å tillate cellene å svelle. Pakk kjernene fra cellene ved hjelp av 15 slag med den stramme stampe. Antall slag med de løse og stramme pestles må være optimalisert for ulike vev og celletyper; overflødig homogenisering kan resultere iskåret kjerner, mens utilstrekkelig homogenisering ikke vil trekke ut alle kjerner fra vevet.
  5. Filtrer homogenatet, som inneholder atomkjerner og celle-debris, gjennom en 40 um pore-størrelse silen (se Materialer PDF) som har blitt prerinsed med atom homogenisering buffer. Samle filtrert homogenat i et friskt rør.
  6. Samle pre-isolasjonsprøver for senere analyse for å fastslå atomkjerner yield, atomkjerner integritet, og å bestemme karakterutskrift nivåer av målgener før atomkjerner isolasjon.
    1. Overføring 50 pl av det filtrerte homogenatet til en frisk 1,5 ml rør ved hjelp av en pipette. Dette er den pre-isolasjon prøven. Legg 500 mL av Trizol reagens (se Materialer PDF, FORSIKTIG), invertsukker å blande, og oppbevar ved -20 ° C for senere RNA isolering (trinn 3,1).
    2. Overføring 20 pl av den filtrerte homogenatet til en frisk 1,5 ml rør.
      1. Legg DAPI til en endelig konsentrasjon på 0,1 mikrogram / ml, og det økesUbate prøven på is i 10 min.
      2. Overfør DAPI-farget atomkjerner til en poly-lysin belagt dekkglass, og legg på et objektglass. Tett dekk bruker klar neglelakk.
      3. Kontroller atomkjerner integritet, og tilstedeværelsen av GFP-merket kjerner av interesse ved hjelp av fluorescerende mikroskop. Merk: Det er ikke nødvendig å fikse kjernen, eller å farge for GFP hvis disse lysbildene er analysert rimelig raskt etter tilberedning (innen 24 timer).
    3. Overføring 10 pl av den filtrerte homogenatet til en frisk 1,5 ml rør og tilsett 90 pl vaskebuffer (1 x PBS, pH 7,4, 2,5 mM MgCl2). Legg DAPI til en endelig konsentrasjon på 0,1 mikrogram / ml, og inkuberes på is i 10 min. Bestem nuclei utbytte i for-isolasjonsprøve ved å bruke et hemocytometer for å telle DAPI-positive kjerner ved hjelp epifluorescence under en luft 10X objektiv.
  7. Plasser 1,5 ml rør inneholdende antistoff-bundet perler (fremstilt i avsnitt 2.1.6) i et magnetisk stativ,og la de magnetiske kuler til å binde seg til magneten i minst 2 min, som beskrevet i seksjon 2.1.4. Fjern vaskebufferen fra de antistoffbundne kuler ved bruk av en 1 ml-pipette, og tilsett den filtrerte homogenatet fra trinn 2,5 til 1,5 ml rør ved hjelp av en 1 ml-pipette.
  8. Snu røret forsiktig flere ganger for å blandes, og inkuber ved 4 ° C i 30 min med ende-over-ende omrøring. Unngå bobler i røret dersom det er mulig, siden dette kan resultere i klumpdannelse av kjernene.
  9. Plasser 1,5 ml rør inneholdende antistoff-bundet perler og homogenat i et magnetisk stativ, og la de magnetiske kuler til å binde seg til magneten i minst 2 min, som beskrevet i seksjon 2.1.4. Fjern homogenat inneholdende den ubundne fraksjon kjerner ved hjelp av en 1 ml-pipette.
  10. Vask prøven 3x med 1 ml vaskebuffer hver gang. Fjern 1,5 ml tube inneholder perler, bundet atomkjerner og vaske buffer fra stativet og invertere å blande flere ganger, og sett slangen i magnetstativ som beskreveti trinn 2.9 og fjern supernatanten ved bruk av en 1 ml-pipette.
  11. Tilsett 150 ul vaskebuffer til perlene, som skal bindes til mål-kjerner. Dette er den post-isolasjon prøven. Forbered prøver for mikroskopi analyse og påfølgende RNA ekstraksjon.
    1. Overføring 20 pl av den etter-isolering prøven til en frisk 1,5 ml rør og flekken med DAPI og analyser som er beskrevet i avsnitt 2.6.2. Tell GFP + / DAPI + og GFP-/DAPI + kjerner fanget av magnetiske kuler til å bestemme renheten av beriket GFP + kjerner i den post-isolasjon prøven.
    2. Tilsett 1 ml av Trizol reagens til den resterende del av etter-isolering prøven, inverterer å blande, og oppbevar ved -20 ° C for påfølgende RNA-isolering (trinn 3.1). Merk: Prøver i Trizol kan lagres i flere uker dersom det er nødvendig ved -20 ° C. Det er ikke nødvendig å eluere kjernene fra de magnetiske perler før RNA-ekstraksjon ved hjelp av Trizol reagens, because perlene ikke forstyrrer den etterfølgende RNA-isolering.

Tre. Bestem Tran Nivåer i Nuclei isolert fra Larve Vev

  1. Isoler RNA fra de pre-isolering og etterisolerings prøver utarbeidet i avsnitt 2.6.1 og 2.11.2 hjelp av standardprotokollen beskrevet for Trizol-basert RNA ekstraksjon (se Materialer PDF) med følgende endringer:
    1. Etter utfelling av RNA pelleten, tilsett 19,2 pl RNase-fritt vann og 0,8 pl av RNASecure reagens (se Materialer PDF) til pelleten og inkuber ved 60 ° C i 20 min for å inaktivere RNases.
  2. Bestem RNA konsentrasjon med et fluorescerende-RNA bindende fargestoff som Qubit RNA analysen kit (se Materialer PDF) ved hjelp av QubitR 2,0 Fluorometer følge produsentens protokoll.
  3. Syntetisere cDNA ved hjelp av en forsterkning av revers transkriptase, slik som EpiScrIPT reverstranskriptase kit og oligodT primere etter produsentens anvisninger. Merk: Typisk, 50 til 100 ng av RNA genererer tilstrekkelig cDNA til å utføre multippel genekspresjon analyser. Ekvivalente mengder av pre-isolering og etterisolerings RNA skal benyttes for å generere cDNA.
  4. Til 180 mL av nuclease-fritt vann til 20 ul cDNA-prøve for å fortynne denne 10-fold før sanntid kvantitativ PCR (qPCR) analyse. Denne fortynningen er et viktig skritt, fordi ufortynnet cDNA prøver kan hemme qPCR.
  5. Tilbered en qPCR konsentrat-blanding med polymerase og dNTP'er, 4 pmol hver av forover og revers primer, gjort opp med sterilt vann til den endelige reaksjonsvolum på 20 pl.
    1. Utform qPCR primere for å målrette gener som er forventet å bli uttrykt på celletypen av interesse, og ved den utviklingsmessige stadiet hvor vevet er oppsamlet. Design primere for å strekker seg over et intron hvis mulig, slik at genomisk ogcDNA PCR-produkter kan skilles. Merk: Hvis genekspresjon profil av target celletype er ikke kjent, primere mot eGFP, som skal uttrykkes spesifikt i den kodede nuclei populasjon, kan brukes til å optimalisere protokoll for en bestemt celletype og-vev (tabell 1).
  6. Bestem de relative transkriptnivåer for hvert gen av interesse i de pre-isolerings-og post-isolasjonsprøver ved sammenligning med en fortynning serie av cDNA fremstilt fra hele vevet. Transcript nivåer av målgener bør være normalisert til en referanse-genet som Rpl32 (eller fortrinnsvis flere referansegener).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Repo-Gal4 driver (Bloomington lager nummer 7415) er spesielt uttrykt i gliacellene i Drosophila nervesystemet på flere stadier av utviklingen 18. Fluer ble generert som stabilt uttrykke UAS-EGFP :: Msp-300 KASH under kontroll av repo-Gal4 driveren ved hjelp av standard genetiske teknikker. Å karakterisere uttrykket mønster av EGFP :: KASH transgenet i disse fluene, ble mønsteret av GFP uttrykk i dissekert optisk lapp og øyet imaginal plate fra tredje stadiums larver undersøkt ved hjelp konfokalmikroskopi. Dissekert vev ble kontra med DAPI å markere DNA og med α-chaoptin 19 å merke fotoreseptorlidelser axoner (mAb24B10, se Materials PDF). Figur 1a viser at repo-Gal4 drevet EGFP :: KASH transgenet er uttrykt i gliaceller i de optiske lapper og øye imaginal plate i forventet uttrykk mønster. Under høyere forstørrelse,EGFP uttrykk er observert i et sirkulært mønster rundt DAPI-positiv DNA, i samsvar med kjernefysisk-konvolutt lokalisering av EGFP :: KASH tag (Figur 1B). EGFP ekspresjon kan påvises både i fast og i ufestede vev uten behov for signalforsterkning ved hjelp av et antistoff mot GFP, antistoffer mot GFP ble ikke brukt til å visualisere EGFP :: KASH ekspresjon i bildene som er vist i figurene 1 og 2. Smp. For å finne ut om EGFP :: KASH transgenet uttrykkes nonspecifically i andre vev i Drosophila larver, ble GFP uttrykk undersøkt i hele tredje stadiums larver ved hjelp av en fluorescens dissekere mikroskop. Spesielt, uspesifikke uttrykk for EGFP :: KASH transgenet ble observert ved høye nivåer i spyttkjertlene av tredje stadiums larver. Dette indikerer at repo-Gal4 sjåfør har aktivitet i noen andre enn gliaceller i larvestadiet av utvikling celletyper. Derfor, for å spesifikt isolere glial kjerner, ble syns lapp og øyet imaginal plate fra tredje stadiums larver isolert ved hjelp av disseksjon før homogenisering og affinitet-isolasjon.

For å bekrefte at denne protokollen er egnet for ekstraksjon av kjerner fra Drosophila vev, og for å beregne prosentandelen av merkede kjerner tilstede i et gitt vev, pre-isolasjon prøve (avsnitt 2.6.2) fra homogenater fremstilt av den optiske lobe og øye imaginal plate av repo-Gal4, UAS-EGFP :: Msp-300 KASH tredje stadiums larver ble undersøkt. Figur 2A viser et representativt bilde av den pre-isolasjon prøve innhentet ved hjelp konfokalmikroskopi. I dette bilde, er tilstedeværelse av kjerner angitt med DAPI-positive arrangementer. Et lite antall tynt spredt GFP-positive, DAPI-positive glial kjerner er også observert. Vi regner med at de GFP-positive kjerner utgjør mindre enn 2% av den totale populasjonen kjerner i dennesample (Figur 2A). Den totale atomkjerner utbytte fra optisk lapp og øye imaginal plater som ble dissekert fra 100 larver ble bestemt for den pre-isolasjon prøven som beskrevet i avsnitt 2.6.3 (tabell 2). En typisk pre-isolasjon prøve fra 100 dissekert optisk lapp og øye imaginal plater inneholdt mellom 0,8 og 1,2 x 10 7 kjerner, hvorav ca 2% var GFP-positive. Figur 2B viser et representativt bilde av DAPI-positive kjerner i et definert område av hemocytometer. Legg merke til at kjernene er intakte, og opprettholde en jevn sirkulær form under uttreknings betingelser anvendt i protokollen, (figurene 2A og 2B).

For å finne ut om denne protokollen kan brukes for å isolere og / eller sterkt berike spesifikke populasjoner av merkede kjerner fra vev som inneholder blandede cellepopulasjoner, α-GFP antistoff-belagte magnetiske kuler var brukend å isolere merkede kjerner fra homogenates hentet fra syns lapp og øyet imaginal plate av 100 repo-Gal4, UAS-EGFP :: Msp-300 KASH tredje stadiums larver. I figurene 2C og 2D, hvor det kan sees at EGFP :: KASH tagget glial nuclei binder til α-GFP belagte magnetiske perler, og det observeres i post-isolasjon prøve (avsnitt 2.11.1) etter magnetisk separasjon. Selv om de magnetiske kuler stille ut noen autofluorescence i GFP kanalen, disse kan lett skilles fra perle-bundet atomkjerner av sin mindre størrelse (2,8 mikrometer for de magnetiske kuler versus ca 5 mikrometer for kjerner) og mangel på DAPI farging. GFP + / DAPI + kjerner utgjør mer enn 95% av DAPI positive hendelser i post-isolasjon prøven. Således målet tagget kjerner populasjon er sterkt anriket på det post-isolasjonsprøven i forhold til den pre-isolasjonprøven. Flertallet av kjernene i den post-isolasjon prøven viser sterke kjerne-konvolutt lokalisert GFP fluorescens, og er vanligvis omgitt av perler. Det er imidlertid mulig at et lite antall ukodede kjerner kan også være tilstede i denne prøven. Således, selv om resultatene i figur 2C og i genekspresjonsanalyse i figur 3 (se nedenfor) indikerer at målet tagget glial nuclei populasjon er sterkt anriket, muligheten for at enkelte kjerner fra noen andre ikke-spesifikke celletyper er også til stede i prøven kan ikke utelukkes. Det anbefales at brukerne optimalisere denne protokollen for deres bestemt celletype og vev av interesse å maksimere berikelse av målet kjerner befolkningen, og å eliminere uspesifikke kjerner bindende. Spesielt er forholdet mellom utgangsmaterialet i forhold til antistoff og perler sannsynlig å være viktig for optimal anrikning av mål-kjerner. Av denne grunn er de områder av totalkjerner tall som er tilstede i våre typiske pre-isolasjonsprøver er vist i tabell 2.. Basert på det totale antall kjerner som er tilstede i den pre-isolasjonsprøve, og den beregnede andel av gliaceller i den blandede populasjon fra den optiske lobe og øye imaginal plate, ble det maksimale utbyttet atomkjerner i det etter-isolering prøven forventet å være mellom 1.6 5 x 10 og 2,4 x 10 5 kjerner. Imidlertid, ved hjelp av hemocytometer for å bestemme kjerner utbytte som beskrevet under punkt 2.6.3, selve kjernene utbyttet oppnådd i det etter-isolering prøven var mellom 1,3 x 10 og 2,7 x 4 10 4 kjerner. Disse kjerner avkastning representerer svært grove estimater fordi perlene som finnes i den post-isolasjon prøven synes å påvirke nøyaktig lasting av hemocytometer. Noen GFP-positive kjerner er observert i den ubundne homogenat, noe som indikerer at ikke alle GFP-positive kjerner i sgod binding til perlene effektivt under betingelser som brukes i denne protokollen. Økende tid til å binde eller å utføre sekvensielle isoleringstrinn kan potensielt øke denne kapasitet, men dette kan komme på bekostning av både renhet og RNA integritet. Ved hjelp av vilkårene som er beskrevet i denne protokollen, kan tilstrekkelige mengder av RNA fås i den post-isolasjon prøve for nedstrøms analyse av genuttrykk ved QRT-PCR (tabell 2). Dermed er denne protokollen i stand til raskt og strengt isolere target kjerner fra vev som inneholder blandede populasjoner av celler. Dessuten er det i stand til å spesifikt å isolere target kjerner som utgjør bare en liten andel, mindre enn 5%, av cellene i en gitt populasjon.

For å være helt sikker på at det etterisolerings prøven var sterkt anriket på målet glial nuclei populasjon, nivåene av transkripter for fire forskjellige gener i pre-isolasjon etter isolasjon prøver ble sammenlignet med RT-qPCR. Transkripsjonen nivåer av elav, nrv2 og eGFP ble bestemt i de to prøver, og normalisert til referanse genet, Rpl32, som er uttrykt på tilsvarende nivåer i gliaceller og i det omgivende sentralnervesystemet (figur 3). Den gangers forskjell i tiden etter isolering prøven er vist i forhold til den pre-isolasjon prøven, som er satt til en. I figur 3 viser den etter-isolering prøven betydelig lavere nivåer av transkripsjon av neuronal-spesifikt gen elav i forhold til den pre-isolasjon prøven. Dette indikerer at atomkjerner fra nerveceller er underrepresentert i den post-isolasjon prøven. I kontrast, økt transkripsjon nivåer av både glial-anrikede nrv2 gen 10 og eGFP er tilstede i post-isolasjon prøven i forhold til den pre-isolasjon prøven. Dette resultatet indikerer at den post-isolasjonsprøven er sterkt anriket for målet glial kjerner populasjon. Det er viktig å merke seg at de transkriptnivåene målt i denne protokollen representerer atom transkripter, og derfor er trolig å indikere nivåer av aktiv transkripsjon i stedet for steady-state-mRNA. Reproduserbar uttrykk for repo ble ikke oppdaget i enten våre pre-isolasjon eller post-isolasjonsprøver, noe som tyder på at Gal4 protein uttrykt av repo-Gal4 sjåføren kan vedvare etter aktiv transkripsjon av endogene repo genet har opphørt. Dette er i tråd med resultater fra andre studier der kjerner merket ved hjelp av twi arrangøren ikke viser beriket nivåer av twi transkripsjoner, kanskje på grunn av forskjeller i utviklings timing av transkripsjon versus protein stabilitet åtte. Taken sammen, disse resultater viser at den beskrevne protokoll kan med hell brukes til å berike sterkt mål-kjerner fra vev som inneholder blandede populasjoner av celler, og at de isolerte kjerner er egnet genekspresjonsanalyse.

Figur 1
Figur 1. Expression mønster av repo-Gal4, UAS-EGFP :: Msp-300 KASH fluesnøre. (A) I tredje stadiums larver, driver repo-Gal4 uttrykk for UAS-EGFP :: Msp-300 KASH transgenet i gliacellene i syns lapp, optisk stengel (os) og øye imaginal plate (ed). Den kjernefysiske konvolutten i gliacellene er merket med EGFP :: KASH (grønn). R1 - R8 fotoreseptoren celle axons er merket med α-chaoptin (mAB24B10, rød) for sammenligning, og DNA er stastilt med DAPI (lilla). GFP-merket glial kjerner er synlige langs platen (la) inne i optikk lobe (merket med piler). Scale bar, 50 mikrometer. (B) Høyere forstørrelse bilde av lamina ganglia av syns lobe som inneholder EGFP :: KASH merket glial cellekjerner. Scale bar, 50 mikrometer. Confocal bildene ble anskaffet ved hjelp av enten en   40X / 1,30 olje eller en   20X / 0,75 oljeneddyppingsobjektivet, og ved hjelp av eksitasjon / utslipp bølgelengder av 408 nm/425-475 nm (DAPI); 488 nm/525-550 nm (GFP), 561 nm/595-620 nm (Alexa 5,6,8 ). Vennligst klikk her for å se en større versjon av dette tallet.

Fig. 2
Figur 2. Karakterisering av atomkjerneri "pre-isolasjon" og "post-isolasjon" prøver. (A) Representant bilde fra en repo-Gal4, UAS-EGFP :: Msp-300 KASH pre-isolasjon prøven analysert ved hjelp av en X 20 / 0,75 oljeneddyppingsobjektivet og standard konfokalmikroskop. DNA er farget med DAPI (blå), og EGFP :: KASH tagget glial atomkjerner er vist i grønt (merket med piler). Scale bar, 50 mikrometer. (B) Representative bilde av DAPI-fargede kjerner fra en pre-isolasjonsprøve på et hemocytometer ved hjelp av en X 10 luft objektiv og standard epifluorescence mikroskop. Hemocytometer nett vises i lys grå. Bare DAPI-positive atomkjerner er vist i dette bildet, som GFP fluorescens var ikke synlig under dette målet på epifluorescence mikroskop. (C) Representant bilde fra en repo-Gal4, UAS-EGFP :: Msp-300 KASH post-isolasjon prøveanalysert som beskrevet for panel A. Den isolerte EGFP :: KASH tagget glial kjerner (markert med piler) beis positivt for DAPI, og er omgitt av perler, som autofluoresce på lave nivåer i GFP kanalen. Scale bar, 50 mikrometer. (D) Høyere forstørrelse bilde av en typisk isolert EGFP :: KASH tagget glial kjerner (markert med pil) omgitt av perler. Scale bar, 5 mikrometer. Vennligst klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. Representative QRT-PCR-data fra "pre-isolasjon" og "post-isolasjon" prøver. Transkripsjon nivåer av målet gener ble bestemt av QRT-PCR av pre-isolasjon og post-isolasjonsprøver innhentet fra repo-Gal4, UAS-EGFP :: Msp-300 Kash optiske fliker og øye imaginal plater. Alle transkripsjon nivåene er normalisert til Rpl32 transkripsjon nivåer, og den pre-isolasjon prøve for hvert gen Målet er satt til én. Representative resultater fra en biologisk eksperiment vises for følgende gener: elav, nrv2 og eGFP.

Gene Primer-sekvens (5 '-3') Størrelse PCR produkt (bp)
eGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
elav GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

Tabell 1. Primere som brukes for QRT-PCR-analyse.

Totalt antall kjerner i pre-isolasjon prøve Beregnet totale antall kjerner i post-isolasjon prøven RNA utbytte fra post-isolasjon sample (ng)
0,8 til 1,2 x 10 7 01.03 til 02.07 x 10 4 160-220 ng

Tabell 2. Representative kjerner og RNA avkastning som oppnås.Typiske områder av atomkjerner og RNA avkastning hentet fra pre-isolering og etterisolasjonsprøver fra 100 dissekert optisk lapp og øye imaginal plater fra repo-Gal4, UAS-EGFP :: Msp-300 KASH genotype, der gliaceller er merket med EGFP :: KASH. Nuclei ble kvantifisert som beskrevet i 2.6.3 og RNA ble kvantifisert som beskrevet i 3.1.2.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Denne protokollen kan brukes til å isolere eller svært berike spesielt merket kjerner fra blandede cellepopulasjoner i Drosophila embryonale eller larve vev. Ved hjelp av denne protokollen, kan atomkjerner isoleres fra dissekert vev i ca 1 time. Den renhet og utbytte av de isolerte kjerner må være eksperimentelt bestemt for hver celletype. Det kan være vanskelig å kvantifisere bead bundne kjerner ved etterisoleringstrinn av protokollen ved bruk av et hemocytometer på grunn av vulstene som er tilstede i prøven. Således, hvis eksakte antall kjerner er nødvendig for en nedstrøms anvendelse, vil det være nødvendig å estimere atomkjerner utbytte basert på en alternativ metode, for eksempel DNA-innhold. Eksakte beregninger av atomkjerner avkastning er ikke nødvendig analyse av genuttrykk for hvis RNA kan være vellykket isolert og kvantifisert. Det anbefales å bruke en fluorescens-basert metode for å kvantifisere RNA yield, som vi har funnet ut at spektrofotometrisk bestemmelse av RNA konsentrasjoni disse lave konsentrasjons prøvene er svært variabel.

Det er to viktige aspekter av protokollen som vil påvirke dens suksess: valg av magnetiske kuler og antistoff. Magnetiske kuler som er koplet til GFP eller protein G er kommersielt tilgjengelige fra flere forskjellige kilder. Imidlertid er det sterkt anbefalt å bruke protein G magnetiske kuler som er tilgjengelige fra Invitrogen for prosedyren som er beskrevet i denne protokollen for to viktige grunner. Først, er størrelsen på de perler Invitrogen på 2,8 mikrometer litt mindre enn den gjennomsnittlige størrelsen på kjernene i de celletypene som vi har undersøkt, som er omtrent 5 mikrometer (figur 2D). Magnetiske perler som er mindre (f.eks 50 nm, μMACS α-GFP, Miltenyi Biotech) ikke binder seg raskt til batch-wash stil magneter, og kolonnene følger for disse perlene kan tette med larve vevsekstrakter. Større magnetiske kuler (f.eks 10 mikrometer, PureProteome protein G magnetisk beads, Millipore) ikke bindes godt til kjernene i våre foreløpige tester, og disse oppviser også sterk autofluorescens i de samme kanaler som både DAPI og GFP, noe som gjør det vanskelig å identifisere kjerner i perle-bundet prøven ved standard mikroskopi-teknikker. I tillegg til valg av magnetiske kuler, er det viktig å bruke en GFP-antistoff som fungerer godt for immunoutfelling, men som ikke har høy ikke-spesifikk bakgrunn. Til hjelp i reproduserbarheten av denne protokollen, har vi brukt et monoklonalt mus antistoff mot GFP. Polyklonale kanin antistoffer mot GFP ble også vellykket trialed i våre foreløpige undersøkelser, men disse hadde en tendens til å ha høyere uspesifikke bakgrunn. Andre monoklonale antistoffer ble også testet (f.eks Developmental Studies hvbridom Bank), med varierende grad av suksess. Således er antistoffer valg en viktig faktor i den vellykkede isolering av merkede kjerner.

Selv i denne protokollen beskriver vi metoder til Detrøyskatt gentranskript-nivåer i isolerte kjerner, er det forventet at den metode som er beskrevet i trinn 2.1 til 2.11 vil også være egnet for isolering av kjerner som kan anvendes for etterfølgende kromatin immunoutfellingsanalyse. Hvis vevet blir løst i 1% formaldehyd før homogenisering (trinn 2.3), kan deretter dissekert vev bli samlet i løpet av flere dager og tilstrekkelig materiale, isolert for å utføre kromatin immunoutfellingsanalyse. På grunnlag av tellinger som oppnås ved hjelp av hemocytometer, noe som gir bare grove anslag, som omtalt ovenfor, vanligvis erholdt 1,3 x 10 4 og 2,7 x 10 4 glial cellekjerner fra øyet imaginal platen, og optisk lobe på 100 larver (tabell 2). Således, ved å bruke vår tilnærming, bør det være mulig å oppnå tilstrekkelig materiale til å utføre kromatin immunoutfellingsanalyse, avhengig av den mengde av den målrettede celletype, og epitopen av interesse.

Et nyttig genetisk anvendelse av denne tekque, er at den kan brukes til å positivt merke atomkjerner i spesifikke celletyper i embryoer eller larver som er homozygot for en recessiv dødelig mutant allel. For å oppnå dette, må to separate flue stocks bli generert hvor mutant allel av interesse er rekombinert med en spesifikk Gal4 driver, eller med UAS-EGFP :: MSP-300 KASH transgenet på den tredje kromosom. Hvis fluer bærer mutant allel og Gal4 driver er krysset til fluer bærer den muterte alleler og UAS-EGFP :: Msp-300 KASH transgenet, bare avkom som har både kopier av det muterte allelet vil bli merket med GFP i vevet der den Gal4 driver uttrykkes. Dermed kan celle-spesifikke effekter av recessive dødelige alleler bli undersøkt i de embryonale eller larvestadiet, før den fasen av dødelighet. Denne genetiske teknikken har tidligere blitt brukt til å positivt merke celler i embryonale muskel som var homozygot for mutasjoner i SAGA subenheten, sgf11 en </ Sup>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Vi takker Janice Fischer for å gi UAS-EGFP :: Msp-300 KASH plasmid. Den mAB24B10 antistoff ble innhentet fra Developmental Studies hvbridom Bank utviklet i regi av NICHD og vedlikeholdes av University of Iowa, Institutt for biologi. Repo-Gal4 lager (BL7415) ble hentet fra Bloomington Stock Center ved Indiana University. Støtte fra American Cancer Society Institutional Forskning Grant (IRG # 58-006-53) til Purdue University Center for Cancer Research er takknemlig erkjent. Jingqun Ma er støttet av en landbruksforskning ved Purdue assistant i Food and Agriculture fra Purdue University.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
Affinity basert Isolering av Tagged Nuclei fra<em&gt; Drosophila</em&gt; Vev for Gene Expression Analysis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter