Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Fra et naturligt produkt til sin biosyntesegen Cluster: En Demonstration Brug Polyketomycin fra doi: 10.3791/54952 Published: January 13, 2017

Summary

Her præsenterer vi en detaljeret protokol af (A) identifikation af et naturligt produkt med antibiotisk aktivitet, (B) rensning af forbindelsen, (C) den første model af sin biosyntese, (D) genomsekvensering / -mining og ( E) kontrol af biosyntetiske gen-klyngen.

Abstract

Streptomyces-stammer er kendt for deres evne til at producere en masse forskellige forbindelser med forskellige bioaktiviteter. Dyrkning under forskellige betingelser fører ofte til fremstilling af nye forbindelser. Derfor er produktionskulturer af stammerne ekstraheret med ethylacetat, og de rå ekstrakter analyseres ved HPLC. Endvidere er ekstrakterne testes for deres bioaktivitet ved forskellige assays. For Strukturopklaring forbindelsen af ​​interesse oprenses ved en kombination af forskellige kromatografiske metoder.

Genomsekvensering kombineret med genom minedrift tillader identifikation af et naturligt produkt biosyntetisk gen clusteret under anvendelse af forskellige computerprogrammer. For at bekræfte, at den korrekte genklyngen er blevet identificeret, geninaktivering eksperimenter skal udføres. De resulterende mutanter analyseres for produktion af den bestemte naturprodukt. Når den korrekte genklyngen er blevet inaktiveret, denstamme bør ikke producere forbindelsen.

Arbejdsgangen er vist for antibakterielle forbindelse polyketomycin produceret af Streptomyces diastatochromogenes Tü6028. Omkring ti år siden, da genomsekvensering stadig var meget dyrt, kloning og identifikation af en genklynge var en meget tidskrævende proces. Hurtig genom sekventering kombineret med genom minedrift accelererer retssagen mod identifikation klynge og åbner op for nye måder at udforske biosyntese og til at generere nye naturlige produkter ved genetiske metoder. Den i dette dokument protokol kan henføres til nogen anden forbindelse afledt af en Streptomyces-stamme eller en anden mikroorganisme.

Introduction

Naturprodukter fra planter og mikroorganismer har altid været en vigtig kilde til klinisk lægemiddeludvikling og forskning. Den første antibiotikum Penicillin blev opdaget i 1928 fra en svamp af Alexander Fleming 1. I dag er mange mere naturlige produkter, der anvendes i klinisk behandling.

En slægt kendt for sin evne til at producere forskellige typer af sekundære metabolitter med forskellige bioaktiviteter er Streptomyces. Streptomyces er Gram-positive bakterier og tilhører klassen af aktinobakterier og ordren Actinomycetales. Næsten to tredjedele af de klinisk anvendte antibiotika er afledt af Actinomycetales, hovedsagelig fra Streptomyces, som amphotericin 2, daptomycin 3 eller tetracyclin 4. To Nobelpriser er tildelt inden for Streptomyces antibiotisk forskning. Den første gik til Selman Waksman for opdagelsen af ​​streptomycin, den første entibiotic effektiv mod tuberkulose. 5 I 2015 som en del af Nobelprisen i fysiologi og medicin, opdagelsen af avermectin fra S. avermitilis blev tildelt så godt. Avermectin anvendes til behandling af parasitiske sygdomme 6,7.

Den traditionelle tilgang til opdagelsen af naturlige produkter i mikroorganismer, såsom Streptomyces generelt indebærer dyrkning af stammen under forskellige vækstbetingelser, samt ekstraktion og analyse af sekundære metabolitter. Bioaktivitetsanalyser (f.eks assays for antibakteriel og anticanceraktivitet) udføres for at detektere aktivitet af forbindelsen. Endelig er forbindelsen af ​​interesse isoleres og den kemiske struktur belyses.

Strukturerne af naturlige produkter er ofte sammensat af enkelte dele, som er ved at danne komplekse molekyler. Der er et par, men begrænsede, større biosynteseveje fører til opbygning af blokks, der anvendes til biosyntese af naturlige produkter. De store biosyntetiske veje er polyketid veje, stier, der fører til terpenoider og alkaloider, stier ved hjælp aminosyrer og veje, der fører til sukkergrupper. Hver vej er kendetegnet ved en række specifikke enzymer 8. Baseret på strukturen af ​​forbindelsen, kan disse biosyntetiske enzymer forudsiges.

I dag kan den detaljerede strukturelle analyse af en forbindelse i kombination med næste generation sekventering og bioinformatisk analyse hjælpe med at identificere den ansvarlige biosyntetiske genklyngen. Oplysningerne klynge åbner nye veje for yderligere naturprodukt forskning. Dette omfatter heterolog ekspression at forøge udbyttet af det naturlige produkt, målrettet forbindelse modifikation af gendeletion eller ændring og kombinatorisk biosyntese med gener fra andre veje.

Polyketomycin blev isoleret uafhængigt fra dyrkningsvæsken afto stammer, Streptomyces sp. MK277-AF1 9 og Streptomyces diastatochromogenes Tü6028 10. Strukturen blev belyst ved NMR og røntgen-analyse. Polyketomycin er sammensat af en tetracyklisk decaketid og et dimethyl salicylsyre, forbundet af de to deoxysugar dele p-D-amicetose og α-L-axenose. Det viser cytotoksiske og antibiotisk aktivitet, selv mod grampositive multiresistente stammer, såsom MRSA 11.

Et genomisk cosmid bibliotek af S. diastatochromogenes Tü6028 blev genereret og screenet for mange år siden. Brug specifikt gen sonder polyketomycin gen klynge med en størrelse på 52,2 kb, der indeholder 41 gener, blev identificeret efter flere måneders intenst arbejde 12. For nylig blev et udkast genomsekvens af S. diastatochromogenes opnået fører til hurtig identifikation af den polyketomycin biosyntetiske genklyngen. I denne oversigt, en fremgangsmåde med til at identificere et naturprodukt og belyse dets biosyntetiske genklynge vil blive beskrevet ved hjælp polyketomycin som eksempel.

Her forklarer vi de enkelte trin, der fører fra et naturligt produkt til sin biosyntetiske genklynge vist for polyketomycin produceret af Streptomyces diastatochromogenes Tü6028. Protokollen omfatter identificering og oprensning af et naturligt produkt med antibiotiske egenskaber. Yderligere strukturel analyse og sammenligning med resultater fra genom minedrift føre til identifikation af den biosyntetiske gen-klyngen. Denne procedure kan anvendes på enhver anden forbindelse afledt af en Streptomyces-stamme eller en anden mikroorganisme.

Protocol

1. Identifikation af et naturligt produkt med antibiotika Property

  1. Dyrk en mikroorganisme under forskellige betingelser (f.eks tid, temperatur, pH, medier) efter "OSMAC (en stamme-mange forbindelser) metode" 13. Vælg et medium, hvori produktionen af ​​en forbindelse der observeres.
  2. Dyrk Streptomyces diastatochromogenes Tü6028 under følgende betingelser
    1. Grow Streptomyces diastatochromogenes Tü6026 belastning af MS-plader (sojamel 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1,5%, ledningsvand 1 I). Inokulere en lille løkke sporer af denne stamme i 20 ml flydende TSB medium (tryptisk bouillon 30 g, postevand 1 L, pH 7,2; forkultur-medium) i en Erlenmeyer-kolbe med en spiral. Ryst kolben på et roterende rysteapparat (28 ° C, 180 opm, 2 dage).
    2. Inokulering vigtigste kultur i 100 ml HA-medium (glucose 4 g, gærekstrakt 4 g, maltekstrakt 10 g, postevand 1 L, pH 7,2) med 2 ml af forkultur. Kultur stammen ved 28 ° C i 6 dage på en rotationsryster ved 180 rpm.
  3. Fremstilling af rå ekstrakt
    1. Harvest celler ved centrifugering (10 min, 3.000 xg).
    2. For næste skridt håndterer organiske opløsningsmidler under en emhætte.
    3. For forbindelse ekstraktion fra myceliet, resuspender cellerne i et dobbelt volumen acetone og omrystes i et rør i 30 min, 180 rpm. Filtreres væsken gennem kommercielle filterpapir og inddampes acetone ved rotationsfordamper ved 40 ° C og 550 bar. Opløs ekstrakten i 20 ml vand: ethylacetat (1: 1) og omrystes i en skilletragt i 30 min ved 180 rpm.
    4. For forbindelse ekstraktion fra dyrkningsmediet, justere dyrkningsbouillonen til pH 4,0 ved tilsætning af 1 M HCI. Tilsæt 100 ml ethylacetat og ryst den i en skilletragt i 30 min, 180 rpm.
    5. Indsamle Ethylacetatfasen og inddampes af råd Ary fordampning ved 40 ° C og 240 bar.
  4. Analyse af det rå ekstrakt ved HPLC
    1. Opløs ekstrakterne i 1 ml MeOH, filtrerer dem gennem et 0,45 um porestørrelse og køre højtydende væskekromatografi (HPLC) 14.
    2. I tilfælde af polyketomycin, udstyre HPLC-system med en C18 præsøjle (4,6 x 20 mm 2) og en C18-søjle (4,6 x 100 mm 2). Brug en lineær gradient af acetonitril + 0,5% eddikesyre i området fra 20% til 95% i H2O + 0,5% eddikesyre (strømningshastighed: 0,5 ml min-1).
      BEMÆRK: Polyketomycin har en retentionstid på 25,9 min (se figur 1A). UV / vis spektrum har maksima ved 242 nm, 282 nm, 446 nm og minima ved 262 nm og 359 nm (se figur 1B). I den negative modus en masse på 863,2 [MH] - er påviseligt (se figur 1C).

"Src =" / files / ftp_upload / 54.952 / 54952fig1.jpg "/>
Figur 1: LC / MS analyse af Polyketomycin. (A) HPLC-kromatogram (λ = 430 nm) af den rå ekstrakt efter dyrkning af Streptomyces diastatochromogenes Tü6028 i 6 dage. Polyketomycin har en retentionstid på 25,9 min (B) UV / VIS-spektre af Polyketomycin. (C) Masse spektre af Polyketomycin benægtende modus. Hovedtop med m / z 863,2 [MH] -. Klik her for at se en større version af dette tal.

  1. Identifikation af den antibiotiske aktivitet under anvendelse disk diffusion assay
    1. Podning teststammer som grampositive bakterier Bacillus subtilis (i LB-medium, LB 20 g, ledningsvand 1 L, pH 7,4) og andre Streptomyces stammer (i TSB medium; tryptisk bouillon 30 g, ledningsvand 1 L, pH 7.2), Gramnegative bakterier Escherichia coli (i LB-medium) og fungale stammer (i medier som YPD medium; gærekstrakt 10 g, pepton 20 g, glucose 20 g, ledningsvand 1 L, pH 7,4). Tag 100 uL af test stammen forkultur og sprede dem på respektive agarplader.
    2. Opløs det rå ekstrakt eller oprensede forbindelse i 500 pi methanol (alternativt vand eller DMSO) og pipette 20-50 pi onto sterile papirskiver. Tørre papir skiver til 30 minutter under arbejdsbordet og sætte dem på pladerne med test kulturer. Der fremstilles en negativ kontrol (opløsningsmiddel) og en positiv kontrol (antibiotika, f.eks apramycin [1 mg]).
    3. Pladerne inkuberes under passende betingelser, indtil test stammer synligt vokset og bestemme hæmning zone, hvis synlige. Inkuber E. coli og Bacillus sp. ved 37 ° C i 16 timer, Streptomyces sp. ved 28 ° C i 2-4 dage, svampestamme (hovedsagelig afhængig af eksakte test stamme) ent 30 ° C i 2 dage).

2. Large Scale Ekstraktion, oprensning og struktur Belysning af den forbindelse

  1. Dyrk S. diastatochromogenes i 5 L HA-medium (glucose 4 g, gærekstrakt 4 g, maltekstrakt 10 g, ledningsvand 1 L, pH 7,2). Pode 2 ml af forkultur i 30 x 500 ml Erlenmeyer-kolber indeholdende 150 ml HA-medium. Inkuber stammen ved 28 ° C i 6 dage på en roterende ryster ved 180 rpm.
  2. Harvest celler ved centrifugering (10 min, 15.000 xg, RT) og ekstraheres forbindelser under anvendelse af ethylacetat (se afsnit 1.3).

Figur 2
Figur 2: Workflow for Structure Udredning. Fremgangsmåden omfatter (1) dyrkning af stammen, (2) ekstraktion, (3) oprensning ved fastfaseekstraktion (SPE), tyndtlagskromatografi (TLC), præparativ højtydende væskekromatografi (HPLC), size(SEC) og (4) Strukturopklaring i masse analyse (MS), kernemagnetisk resonans (NMR) og X-ray målinger. Klik her for at se en større version af dette tal.

  1. Oprensning af Polyketomycin
    BEMÆRK: Processen med rensning og struktur udredning er vist i figur 2.
    1. Fraktionere rå ekstrakt af en C18 fastfaseekstraktion (SPE) søjle ved anvendelse af en 10% -stepwise MeOH gradient fra 30% til 100% MeOH i H2O, 100 ml for hver tilstand.
    2. Forbindelsen renses fraktion yderligere ved præparativ tyndtlagskromatografi (TLC) 15 under anvendelse af CH2C 2 / MeOH (7: 1) som elueringssystem.
    3. Forbindelsen renses ved præparativ HPLC 16. Udstyre HPLC-systemet med en C18 præsøjle (5 um; 9,4 x 20 mm) og envigtigste søjle (5 um; 9,4 x 150 mm). Brug en gradient af acetonitril + 0,5% eddikesyre i området fra 20% til 95% i H2O + 0,5% eddikesyre (strømningshastighed: 2,0 ml / min).
    4. At fjerne opløsningsmidler og andre små urenheder, udføre en sidste oprensningstrin ved gelpermeationskromatografi ved anvendelse af en søjle i MeOH 17. Saml den endelige rene forbindelse og inddampes MeOH ved rotationsinddampning ved 40 ° C og 240 bar.
  2. Strukturopklaring
    1. Opløs den rene forbindelse (mere end 2 mg) i 600-700 pi (afhængig af maskinen) af DMSO-d6, record 1D NMR (1H, 13C) og 2D NMR (HSQC, HMBC, 1H 1H COSY) spektre på et NMR-spektrometer 18. Udtrykke kemiske skift i o-værdier (ppm) ved anvendelse DMSO-d6.
    2. Optage en høj opløsning massespektrum (HRESI-MS) 19 polyketomycin anvendelse af en høj opløsningmassespektrometer.
    3. Tydeliggøre strukturen ved fortolkningen af resultaterne af NMR- og MS dataanalyse 10.

3. Foreslå Biosyntetisk Model af den nye Isoleret Compound

  1. Analyser strukturen af ​​den isolerede forbindelse og forudsige enzymer, som kan være involveret i dens biosyntese. Tildele dem til polyketid (type I, II eller III), ikke-ribosomale peptidsyntese, lantipeptide, terpenoid, eller sukker stofskifte vej 8.
  2. Eksempel polyketomycin
    1. Underinddel strukturen i indlysende enkelt dele: tetracykliske del, to monosaccharider og dimethyl salicylsyre.
    2. Finde ud, hvor delene kan indhentes: Den tetracykliske gruppe kan være afledt af en polyketidsyntase type II og dimethyl salicylsyre delen kan være afledt af en iterativ polyketidsyntase type I. De to sukkerdele, som er 6-deoxysugars kunne man synthesiZed fra glucose involverer en TDP-glucose-4,6-dehydratase under biosyntese og fastgjort sandsynligvis ved to glycosyltransferaser (se figur 3) 8.
    3. Forudsige formodede gener i klyngen. Tænk på enzymer, som er involveret i syntesen af ​​de enkelte dele, i at koble enhederne, samt i at modificere og skræddersy molekylet. Den biosyntetiske genklynge af Polyketomycin indeholder sandsynligvis gener, der koder en polyketidsyntase type II (derfor minimum en AVS, KS α und KS β til tilslutning extender enheder), en iterativ polyketidsyntase type I (mindst ACP, AT, KS), en TDP-glucose-4,6-dehydratase (nødvendig for trin: glukose → deoxyglucose) og to glycosyltransferaser (knyttet to sukkerfabrikker monomerer til aglyconen) 8.

Figur 3
Figur 3: Opbygning af Polyketomycin divIded i Single Building Blocks. Polyketomycin er sammensat af en tetracyklisk decaketid (PKS type II) og en dimethyl salicylsyre (iterativ PKS type I), forbundet af de to deoxysugar dele β-D-amicetose og α-L-axenose (NDP-glucose-4,6- dehydratase og to glycosyltransferase påkrævet). Klik her for at se en større version af dette tal.

4. Genome Sequencing / Mining

  1. Næste generation sekventering
    1. Sekventere genomisk DNA ved næste generations sekventering teknologier som Illumina, 454 pyrosekventering eller faste 20. Juster enkelt læser til en referencesekvens eller samler de novo.
      BEMÆRK: genomet af S. diastatochromogenes Tü6028 blev sekventeret ved Center for Bioteknologi (CeBiTec) ved University of Bielefeld. Alle læser blev samlet til et udkast genompå 7,9 Mb.
  2. genom mining
    1. Søgning efter åbne læserammer (ORF'er) af brugen af f.eks NCBI Prokaryotisk genom-annotation Pipeline 21,22, RAST (hurtig annotation hjælp delsystemsteknologi) 23,24,25, Prokka (hurtig prokaryot genom annotation) 26 eller GenDB 27. Disse programmer også foreslå deres funktioner. Analysen af S. diastatochromogenes Tü6028 udkast genom sekvens førte til identifikation af mere end 7.000 ORF'er.
    2. Kør specifikke BLAST (Basic Local Alignment Search Tool) analyse for at få yderligere oplysninger som alignments med andre tilsvarende gener og katalytiske domæner 28,29,30.
    3. Til identifikation af de sekundære metabolit gen klynge køre programmer som antiSMASH 31,32,33, NaPDoS 34 og NRPSpredictor 35,36. I udkastet genomet af Streptomyces diastatochromogenes antiSMASH 31,32,33 identicerede 22 gen-klynger.
    4. Analyser de formodede genklynger for deres enzymatiske pathway (s) (polyketidsyntase (type I, II eller III), ikke-ribosomale peptid syntetase, lanthipeptide, terpenoid, sukker metabolisme ...). Søgning efter klynge (r) indeholdende gener, der kan være involveret i syntesen af ​​forbindelsen (se afsnit 3). I S. diastatochromogenes kommenteret cluster 2 indeholder polyketidsyntase type II-gener, tre polyketidsyntase type I-gener, et TDP-glucose-4,6-dehydratase-genet og to glycosyltransferase-gener (se figur 4).
    5. Fokus på enkelte gener i klyngen. For PKS type I og nationale reformprogrammer specificitet acyltransferaser og adenylering domæner, og dermed indarbejdelse af enkelt extender enheder, kan forudsiges. Også sammenligne rækkefølgen af ​​indbygget extender enhed med molekylet. antiSMASH 31,32,33 viser også lignende klynger af allerede kendte forbindelser, med et link til MIBiG database 37. Sammenlign strukturen af ​​forbindelsen med disse andre forbindelser og kontroller for ligheder.

Figur 4
Figur 4: antiSMASH Output af Polyketomycin biosyntesegen Cluster og oversigt over andre klynger i S. diastatochromogenes Tü6028. (A) Oversigt over forventede biosyntetiske gen klynger i genomet af S. diastatochromogenes Tü6028; (B) Cluster 2 Polyketomycin biosyntetiske genklynge med målrettede gener. Klik her for at se en større version af dette tal.

5. Kontrol af biosyntesegen Cluster

  1. Søge efter et gen med indlysende og vigtige (essentielle) funktioner for biosyntese af forbindelsen. Til verifikation af polyketomycin-genklyngen genet pokPI, der koder for ketosynthase α fra PKS type II, blev udvalgt og inaktiveret ved en ud af rammen -deletion (se figur 5B). Alternativt afbryde genet ved kloning et internt fragment (se figur 5C).

Figur 5
Figur 5: Kontrol af en Gene Cluster af Single Crossover. (A) Native gen fører til oversættelsen af et funktionelt protein; (B) Kloning af genet med intern deletion i en selvmord vektor resulterer i en enkelt crossover resulterer i en læserammeforskydning i målgenet og efterfølgende translation af ikke-funktionelt protein; (C) Kloning af et indre fragment af genet i en selvmord vektor fører til en trunkering af genet og efterfølgende translation af et ikke-funktionelt protein. oriT: oprindelse transfer; antibiotisk R: antibiotikaresistens. Klik her for at se en større version af dette tal.

  1. Kloning af single-crossover-konstruktion
    1. Amplificere et fragment indeholdende pokPI ved PCR 38 med primere pokPI_for og pokPI_rev.
    2. Klon PCR-produkt i selvmordsvektor pKC1132 39 (apramycin R [50 mg / ml]). Den selvmord vektor er ikke i stand til at replikere i Streptomyces-stammen og har således at integrere i det målrettede gen ved homolog rekombination for at tilvejebringe apramycin-resistens. Overfør vektoren i E. coli kloningsvært ved varmeshock transformation 40.
    3. Isoler vektoren ved basisk lysis 41.
    4. Fordøje vektor-DNA'et med et enkelt cutter restriktionsenzym, der skærer i fragmentet. Den pokPI gene blev fordøjet med enzym Kpnl
    5. Behandle spaltet vektor-DNA med stor DNA-polymerase I (Klenow) fragment, som har 5 '→ 3'-polymeraseaktivitet og 3'→ 5' exonuklease-aktivitet. Blunting af de klæbrige ender og efterfølgende religering fører til tab af fire baser. Check for tabet af disse baser ved omdannelsen skridt ind E. coli XL1 blå, plukke enkelte kolonier, isolere deres plasmid-DNA, 41 og analysere yderligere ved restriktion fordøjelse og sekventering.
  2. Konjugation af single-crossover-konstruktion i Streptomyces
    1. Overfør selvmord vektor indeholdende pokPI genet (pKC1132_ pokPI del) med sletning ind i E. coli ET12567 pUZ8002 42 (kanamycin R) af varme shock transformation 40. Inkubér cellerne i 100 ml LB-medium (kanamycin 50 ug ml-1, apramycin 50 ug ml-1
    2. Bland 500 uL E. coli pUZ8002 pKC1132_ pokPI del med 500 pi Streptomyces diastatochromogenes kultur (alternativt bruge sporer). Spred blandingen på MS-plader (sojamel 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1,5%, ledningsvand 1 I). Pladerne inkuberes i 20 timer ved 28 ° C.
    3. Overlay hver plade med apramycin (1,25 mg) og fosfomycin (5 mg) opløst i 1 ml vand og lad dem tørre. Pladerne inkuberes i flere dage ved 28 ° C, indtil exconjugants er synlige.
  3. Check single-crossover mutanter
    1. Pode enkelt exconjugants i 20 ml TSB medium (apramycin 50 mg ml-1) og inkubere dem ved 28 ° C i tre dage og 180 rpm.
    2. Isoler genomisk DNA 43 og kontrollere afbrydelsen af pokPI genet ved PCR.
    3. Inokulere enkelte kloner med verificeret gen afbrydelse og Streptomyces vildtype-stamme i 100 ml HA-medium og inkuberes dem i 6 dage ved 28 ° C og 180 rpm. Uddrag den rå ekstrakt (se afsnit 1.3). Tjek sammensatte produktion af HPLC-MS-analyse (se afsnit 1.4). Den tilsvarende top i HPLC-kromatogram og massen af forbindelsen skulle ikke kunne måles mere (se figur 6).

Figur 6
Figur 6: HPLC-analyse af S. diastatochromogenes med inaktiveret pokPI Gene. HPLC-kromatogram (λ = 430 nm) rå ekstrakt af S. diastatochromogenes WT (øverst) og mutantstamme med afbrudt pokPI -Gen (nedenfor). Mutantstammen ikke producerer polyketomycin længere.Klik her for at se en større version af dette tal.

Representative Results

I denne oversigt beskriver vi de enkelte trin fra identifikation af et antibiotikum fører frem til dets biosyntetisk gen-klyngen. For mange år siden vi klonet et cosmidbibliotek, emballeret dem i fager, transduceres E. coli værtsceller, og måtte screene tusindvis af kolonier for at identificere de kloner, der har overlappende regioner af polyketomycin klynge. Sekventering af cosmider var også en vanskelig og dyr proces 12.

For at gennemføre yderligere undersøgelser på stammen sekventeret vi hele genomet af Streptomyces diastatochromogenes Tü6028. Med udkastet genomsekvens vi let identificeres den biosyntetiske genklynge af polyketomycin og andre klynger koder lovende forbindelser. Figur 7 sammenligner den "gamle" metoden til identificering af biosyntetiske klynge ved kloning af et cosmid bibliotek og uddybende screening, ogden "nye" metode ved hele genomet sekventering med efterfølgende genom minedrift på et groft tidsskala. De nye sekventering teknologier og nye genom minedrift programmer fremskynde hele processen.

Figur 7
Figur 7: Sammenligning af den "gamle" og "Ny" Method for Tildeling af en biosyntesegen Cluster. Den "gamle" fremgangsmåde omfatter kloning af et cosmid bibliotek med udvælgelse af positive kloner og sekventering af det respektive cosmid (r) (ovenfor); Den "nye" metode omfatter hele genomet sekventering og -mining at identificere alle sekundær metabolit genklynger placeret på genomet af stammen (nedenfor). Varighed af enkelte trin er vist på et groft tidsskala. Klik her for at se en større version af dette tal.

Discussion

I denne opgave et genomisk cosmid bibliotek af Streptomyces diastatochromogenes blev genereret og screenet for mange år siden, hvilket resulterer i identifikationen af polyketomycin genklyngen via en yderst tidskrævende proces. Karakterisering af enkelte gener var mulig under anvendelse af målgenet deletioner og analyse af de resulterende mutanter 12. For nylig blev et udkast genomsekvens af S. diastatochromogenes opnået muliggør hurtig identifikation af den polyketomycin biosyntetiske genklyngen. Vi kunne nemt registrere de biosyntetiske gener, selv om udkastet genom sekvens indeholder stadig mange contigs. Den beskrevne proces kan opnås inden for måneder. Men proceduren omfatter, mange trin. Enkelte trin kan mislykkes flere gange, forhindrer progression til efterfølgende trin:

Slægten Streptomyces er kendt for sin evne til at producere bioaktive stoffer. Mens de bærer ofte mere end 20 biosynthetic gen klynger, som regel kun en eller to forbindelser er fremstillet under laboratorieforhold. Anvendelsen af ​​OSMAC tilgang (dyrkning af en stamme under forskellige betingelser) til at vågne op tavse gen klynger kan nogle gange ikke være nok. Genetisk manipulation af regulatoriske gener, såsom de pleiotrope regulator gener ADPA 44 og bldA 45,46, er også en effektiv metode til at aktivere produktionen af andre sekundære metabolitter.

Til belysning af forbindelsens struktur, fx ved NMR-analyse, som regel mere end 2 mg oprenset forbindelse er nødvendig. Derfor er fermentering af mere end 10 L kultur ofte påkrævet. Uden en fermenter der er i stand til at opretholde ilt, pH og temperaturforhold, kan det være en udfordring i en lille laboratorium til at håndtere denne mængde af kultur og efterfølgende udvinding. Under oprensning kan forbindelsen blive ændret på grund af oxidation, stråling eller temperatur.Også, bruges flere oprensningstrin, jo større er chancen for nedbrydning.

Ved analyse af strukturen af ​​det naturlige produkt, og klyngerne i genomet, nogle gange er det ikke så let at identificere den passende klynge. For det første, hvis der kun er et udkast genomsekvens en del af klyngen kan mangle. For det andet er det ikke alle gener, der er nødvendige for biosyntesen er i klyngen. For det tredje, undertiden en klynge er delt i to dele er adskilt fra hinanden af ​​mange kilobaser. For det fjerde kan det være vanskeligt at afgøre, hvilken en er det passende gen klyngen. I tilfælde af store PKS type I eller NRPS systemer, hvor det er muligt at beregne antallet af extender enheder baseret på antallet af moduler, eller endda identificere de enkelte extender enheder ved at analysere Valg domæner, viser det sig op let. Men i tilfælde af iterativt arbejder enzymer, forudsigelse af de syntetiserede forbindelser er ofte ikke muligt, især hvis strai har mere end 40 genklynger. For det femte, naturen er meget kompleks og fuld af endnu ukendte forbindelser. Ofte biosyntesen er en blanding af forskellige veje. Hvis den nye sammensatte ikke er identificeret endnu, eller ikke relateret til en anden forbindelse, kan det være vanskeligt at identificere klyngen, til at foreslå en biosyntese model og for at bevise det.

Når bundtet er afgrænset, er enkelt crossover teknik er en god og hurtig metode til at kontrollere hypotesen. PCR, kloning i en selvmord vektor, konjugering, udvælgelse af positive kloner, og produktion assay er de eneste nødvendige trin. En ulempe ved denne teknik er, at integrationen af ​​vektoren i kromosomet er ikke stabilt på grund af yderligere rekombinationsbegivenheder. Derfor, for at analysere enkelte gener, er præcise gendeletioner påkrævet. Det kan også være svært at manipulere Streptomyces pres på det genetiske niveau.

Den beskrevne procedure kan tildeles to enhver anden forbindelse fremstillet af en Streptomyces-stamme eller en anden mikroorganisme. Den viden om en biosyntetisk gen klynge og dens syntetiseret forbindelse giver os yderligere muligheder for at ændre allerede eksisterende molekyler med det formål at forbedre dem til bekæmpelse af multiresistente patogener.

Materials

Name Company Catalog Number Comments
agar Carl Roth GmbH + Co. KG, Karlsruhe, Germany 5210.4
agarose Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6352.4
D-mannitol  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4175.1
glucose  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6780.1
LB  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X964.3
malt extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X976.2
MgCl2 Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2189.1
Peptone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany
soy flour  W.Schoenemberger GmbH, Magstadt, Germany Hensec-Vollsoja
tryptic soy broth Carl Roth GmbH + Co. KG, Karlsruhe, Germany X938.3 Caso-Bouillon
yeast extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2363.2
Solvents
Acetic acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 3738.5
Acetone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 9372.2
Acetonitrile Avantor Performance Materials B.V., Deventer, The Netherlands JT-9012-03
Dichlorofrom  Fisher Scientific GmbH, Schwerte, Germany 1530754
DMSO (Dimethyl sulfoxide) Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4720.1
DMSO-d6 (Dimethyl sulfoxide-d6) 99.9 atom% D ARMAR Chemicals, Döttingen, Switzerland 15200.204
Ethyl acetate Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6784.4
Hydrochloric acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6331.4
Methanol Carl Roth GmbH + Co. KG, Karlsruhe, Germany 7342.1
Enzymes
restriction enzymes New England Biolabs GmbH, Frankfurt am Main, Germany
polymerase  New England Biolabs GmbH, Frankfurt am Main, Germany
DNA Polymerase I Large (Klenow) Fragment Promega GmbH, Mannheim, Germany
Antibiotics
apramycin AppliChem GmbH, Darmstadt, Germany  A7682.0005
fosfomycin Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany P5396-50G
kanamycin Carl Roth GmbH + Co. KG, Karlsruhe, Germany T832.2
Plasmid/Vectors
pKC1132 Bierman et al. 1992
Primer 
pokPI_for TGATGGTGCCGCTGGCCATGG Primer to amplify fragment containing pokPI gene
pokPI_rev AGCGTTCACTGTTCCGCCCGAC
Bacterial strains
Bacillus subtilis COHN ATCC6051 Gram-positive test strain 
Escherichia coli ET12567 pUZ8002  MacNeil et al. 1992 strain for conjugation
Escherichia coli XL1 Blue Agilient Technologies, Santa Clara, USA Gram-negative test strain + cloning host 
Streptomyces diastatochromogenes Tü6028 Paululat et al., 1999 Polyketomycin producer
Online services
antismash (Antibiotics and Secondary Metabolite Analysis Shell) http://antismash.secondarymetabolites.org/ Detection of secondary metabolite gene cluster
BLAST (Basic Local Alignment Search Tool) http://blast.ncbi.nlm.nih.gov/Blast.cgi finds regions of similarity between biological sequences
GenDB https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb Annotation of ORFs 
MiBIG (Minimum Information about a Biosynthetic Gene cluster) http://mibig.secondarymetabolites.org/ Database of biosyntetic gene clusters
NaPDoS http://napdos.ucsd.edu/ Detection of seconary metabolite gene cluster
NCBI Prokaryotic Genome Annotation Pipeline http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ Annotation of ORFs 
NRPSpredictor http://nrps.informatik.uni-tuebingen.de/ Detection of NRPS domains
Prokka (rapid prokaryotic genome annotation) http://www.vicbioinformatics.com/software.prokka.shtml Annotation of ORFs 
RAST (rapid annotation using subsystems technology) http://rast.nmpdr.org/ Annotation of ORFs 
Other programs
Chem Station Rev. A.09.03 Agilent Technologies, Waldbronn, Germany Handling program for HPLC 
Clone Manager Suite 7 Scientific and Educational Software, Cary, USA Designing Cloning Experiment 
Newbler v2.8 Roche Diagnostics Alignment of sequencing reads
Machines 
Centrifuge Avanti J-6000, Rotor JA-10 Beckman Coulter GmbH, Krefeld, Germany
HPLC/MS Agilent Technologies, Waldbronn, Germany
_Autosampler: G1313A Agilent Technologies, Waldbronn, Germany
_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 µm) Agilent Technologies, Waldbronn, Germany
_Column:Xbridge C18 (100 mm × 4.6 mm; Particle size: 3.5 μm) Agilent Technologies, Waldbronn, Germany
_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_Degasser: G1322A  Agilent Technologies, Waldbronn, Germany
_Quarternary pump: G1311A Agilent Technologies, Waldbronn, Germany
_Diode array detector (DAD )G1315B (λ = 254 nm and 400 nm) Agilent Technologies, Waldbronn, Germany
_Quadrupole mass detector (MSD) G1946D(2-3000 m/z) Agilent Technologies, Waldbronn, Germany
rotary evaporator
_heating bath Hei-VAP Value/G3 Heidolph Instruments GmbH & Co.KG, Schwabach, Germany
_vacuum pump system SC 920 G KNF Global Strategies AG, Sursee, Switzerland
Other material
Sephadex LH20 GE Healthcare, 
Chromafil PVDF-45/15MS (pore size 0.45 µm; filter Ø15 mm) MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany
SPE column Oasis HLB 20 35 cc (6g) Waters GmbH, Eschborn, Germany 
E. coli  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Bacillus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Streptomyces sp. Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g
for agar plates add 2% agar

DOWNLOAD MATERIALS LIST

References

  1. Fleming, A. On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae. Br J Exp Pathol. 10, (3), 226-236 (1929).
  2. Lemke, A., Kiderlen, A. F., Kayser, O. Amphotericin B. Appl. Microbiol. Biotechnol. 68, (2), 151-162 (2005).
  3. Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. Daptomycin. Nat. Rev. Drug Discov. 2, (12), 943-944 (2003).
  4. Zakeri, B., Wright, G. D. Chemical biology of tetracycline antibiotics. Biochem. cell Biol. 86, (2), 124-136 (2008).
  5. Schatz, A., Bugle, E., Waksman, S. A. Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria. Exp. Biol. Med. 55, (1), 66-69 (1944).
  6. Burg, R. W., et al. Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob. Agents Chemother. 15, (3), 361-367 (1979).
  7. Egerton, J. R., Ostlind, D. A., et al. Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component. Antimicrob. Agents Chemother. 15, (3), 372-378 (1979).
  8. Walsh, C. T., Fischbach, M. A. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132, (8), 2469-2493 (2010).
  9. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination. J. Antibiot. (Tokyo). 51, (1), 26-32 (1998).
  10. Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.Tü6028. J. Antibiot. (Tokyo). 52, (2), 96-101 (1999).
  11. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities. J. Antibiot. (Tokyo). 51, (1), 21-25 (1998).
  12. Daum, M., et al. Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin. Chembiochem. 10, (6), 1073-1083 (2009).
  13. Bode, H. B., Bethe, B., Höfs, R., Zeeck, A. Big effects from small changes: possible ways to explore nature's chemical diversity. Chembiochem. 3, (7), 619-627 (2002).
  14. Wolfender, J. -L. HPLC in Natural Product Analysis: The Detection Issue. Planta Med. 75, (07), 719-734 (2009).
  15. Stahl, E. Thin-layer chromatography. A laboratory handbook. 2nd edition (1967).
  16. Snyder, L. R., Kirkland, J. J., Glajch, J. L. Preparative HPLC Separation. Pract. HPLC Method Dev. 616-642 (2012).
  17. Granath, K. A., Kvist, B. E. Molecular weight distribution analysis by gel chromatography on sephadex. J. Chromatogr. A. 28, 69-81 (1967).
  18. Jackman, L. M., Sternhell, S. Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry. Int. Ser. Org. Chem. (1969).
  19. Xian, F., Hendrickson, C. L., Marshall, A. G. High resolution mass spectrometry. Anal. Chem. 84, (2), 708-719 (2012).
  20. Metzker, M. L. Sequencing technologies - the next generation. Nat. Rev. Genet. 11, (1), 31-46 (2010).
  21. Tatusova, T., et al. Prokaryotic Genome Annotation Pipeline. NCBI Handb. 2nd Ed. (2013).
  22. Angiuoli, S. V., et al. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation. OMICS. 12, (2), 137-141 (2008).
  23. Aziz, R. K., et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 9, 75 (2008).
  24. Overbeek, R., et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 42, 206-214 (2014).
  25. Brettin, T., et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 5, 8365 (2015).
  26. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 30, (14), 2068-2069 (2014).
  27. Meyer, F. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 31, (8), 2187-2195 (2003).
  28. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, (3), 403-410 (1990).
  29. Madden, T. The BLAST Sequence Analysis Tool. NCBI Handb. 2nd Ed. Chapter 16 (2003).
  30. Marchler-Bauer, A., et al. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, (Database issue) 222-226 (2014).
  31. Medema, M. H., et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, (Web Server issue) 339-346 (2011).
  32. Blin, K., et al. antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 41, (Web Server issue) 204-212 (2013).
  33. Weber, T., et al. antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, (W1) 237-243 (2015).
  34. Ziemert, N., et al. The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity. PLoS One. 7, (3), 34064 (2012).
  35. Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res. 33, (18), 5799-5808 (2005).
  36. Röttig, M., et al. NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39, (Web Server issue) 362-367 (2011).
  37. Medema, M. H., et al. Minimum Information about a Biosynthetic Gene cluster. Nat. Chem. Biol. 11, (9), 625-631 (2015).
  38. Mullis, K., et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51, Pt 1 263-273 (1986).
  39. Bierman, M., et al. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 116, (1), 43-49 (1992).
  40. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli.using the heat shock method. J. Vis. Exp. (6), e253 (2007).
  41. Bimboim, H. C., Doly, J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, (6), 1513-1523 (1979).
  42. MacNeil, D. J., et al. Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector. Gene. 111, (1), 61-68 (1992).
  43. Pospiech, A., Neumann, B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet. 11, (6), 217-218 (1995).
  44. Makitrynskyy, R., et al. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin. Open Biol. 3, (10), 130121 (2013).
  45. Kalan, L., et al. A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene. Chem. Biol. 20, (10), 1214-1224 (2013).
  46. Gessner, A., et al. Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains. ChemBioChem. 16, (15), 2244-2252 (2015).
Fra et naturligt produkt til sin biosyntesegen Cluster: En Demonstration Brug Polyketomycin fra<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).More

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter