Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Från en naturlig produkt till dess biosyntes Gene Cluster: En demonstration Använda Polyketomycin från doi: 10.3791/54952 Published: January 13, 2017

Summary

Här presenterar vi ett detaljerat protokoll av (A) identifieringen av en naturlig produkt med antibiotisk aktivitet, (B) rening av föreningen, (C) den första modellen av dess biosyntes, (D) genom sekvensering / -mining och ( E) kontroll av den biosyntetiska genklustret.

Abstract

Streptomyces-stammar är kända för sin förmåga att producera en mängd olika föreningar med olika bioaktiviteter. Odling under olika förhållanden leder ofta till produktion av nya föreningar. Därför är produktions kulturer av stammarna extraherades med etylacetat och de råa extrakten analyserades med HPLC. Vidare är extrakten testas för deras bioaktivitet genom olika analyser. För struktur belysning föreningen av intresse renas genom en kombination av olika kromatografiska metoder.

Genome sekvense i kombination med genombrytning möjliggör identifiering av en naturlig produkt biosyntetiska genkluster med olika dataprogram. För att bekräfta att den korrekta genklustret har identifierats, geninaktivering experiment måste utföras. De resulterande mutanterna analyseras med avseende på produktion av den specifika naturliga produkten. När korrekt genklustret har inaktiverats, denstammen skulle misslyckas att framställa föreningen.

Arbetsflödet visas för den antibakteriella föreningen polyketomycin produceras av Streptomyces diastatochromogenes Tü6028. Cirka tio år sedan, när genomsekvense var fortfarande mycket dyra, kloningen och identifieringen av ett genkluster var en mycket tidskrävande process. Snabb genomsekvense kombination med genombrytning accelererar rättegången mot kluster identifiering och öppnar upp nya sätt att utforska biosyntes och att generera nya naturliga produkter av genetiska metoder. Protokollet som beskrivs i detta dokument kan tilldelas någon annan förening som härrör från en Streptomyces-stam eller en annan mikroorganism.

Introduction

Naturliga produkter från växter och mikroorganismer har alltid varit en viktig källa för klinisk läkemedelsutveckling och forskning. Den första antibiotikum Penicillin upptäcktes 1928 från en svamp av Alexander Fleming ett. Numera är många fler naturliga produkter som används i klinisk behandling.

Ett släkte känd för sin förmåga att producera olika typer av sekundära metaboliter med olika bioaktiviteter är Streptomyces. Streptomyces är grampositiva bakterier och tillhör klassen av aktinobakterier och ordningen Actinomycetales. Nästan två tredjedelar av de kliniskt använda antibiotika härrör från Actinomycetales, främst från Streptomyces, som amfotericin 2, daptomycin tre eller tetracyklin 4. Två Nobelpris har delats ut inom Streptomyces antibiotikaforskning. Den första gick till Selman Waksman för upptäckten av streptomycin, den första entibiotic effektiva mot tuberkulos. 5 År 2015, som en del av Nobelpriset i fysiologi och medicin, upptäckten av avermektin från S. avermitilis fick också. Avermektin används för behandling av parasitsjukdomar 6,7.

Den traditionella metoden för upptäckten av naturliga produkter i mikroorganismer såsom Streptomyces involverar generellt odling av stammen under olika tillväxtbetingelser, samt extraktion och analys av sekundära metaboliter. Bioaktivitetsanalyser (t.ex. analyser för antibakteriell och anticanceraktivitet) utförs för att detektera aktiviteten hos föreningen. Slutligen är föreningen av intresse isoleras och den kemiska strukturen belyses.

Strukturerna av naturprodukter ofta består av enskilda delar som bildar komplexa molekyler. Det finns några, men begränsade, stora biosyntetiska vägar som leder till att bygga blockks, som används för biosyntesen av naturliga produkter. De stora biosyntetiska vägar är polyketid vägar, vägar som leder till terpenoider och alkaloider, vägar med hjälp av aminosyror, och vägar som leder till sockerdelar. Varje väg kännetecknas av en uppsättning av specifika enzymer 8. Baserat på strukturen av föreningen, kan dessa biosyntetiska enzymer förutsägas.

Numera kan en detaljerad strukturell analys av en förening i kombination med nästa generations sekvensering och bioinformatisk analys bidra till att identifiera den ansvariga biosyntetiska genklustret. Kluster informationen öppnar nya vägar för vidare forskning naturprodukt. Detta inkluderar heterologt uttryck för att öka utbytet av den naturliga produkten, målinriktad förening modifiering av gendeletion eller förändring och kombi biosyntesen med gener från andra vägar.

Polyketomycin isolerades oberoende från odlingsbuljong avtvå stammar, Streptomyces sp. MK277-AF1 9 och Streptomyces diastatochromogenes Tü6028 10. Strukturen belysas med NMR och röntgenanalys. Polyketomycin är sammansatt av en tetracyklisk decaketid och en dimetyl salicylsyra, förenade genom de två deoxysugar molekyldelar p-D-amicetose och α-L-axenose. Den visar cytotoxiska och antibiotisk aktivitet, även mot grampositiva multiresistenta stammar såsom MRSA 11.

Ett genomiskt kosmidbibliotek från S. diastatochromogenes Tü6028 genererades och screenades för många år sedan. Använda specifik gen sonder polyketomycin genen kluster med en storlek på 52,2 kb, innehållande 41 gener identifierades efter flera månader av intensivt arbete 12. Nyligen var ett utkast till genomsekvens av S. diastatochromogenes erhållna leder till snabb identifiering av polyketomycin biosyntetiska genklustret. I denna översikt, en metod att hjälpa till att idenderrätta en naturlig produkt och belysa dess biosyntetiska genklustret kommer att beskrivas, med hjälp av polyketomycin som ett exempel.

Här förklarar vi de enskilda åtgärder som leder från en naturlig produkt till dess biosyntetiska genkluster visas för polyketomycin produceras av Streptomyces diastatochromogenes Tü6028. Protokollet innefattar identifiering och rening av en naturlig produkt med antibiotiska egenskaper. Ytterligare strukturanalys och jämförelse med resultat från genombrytning leder till identifieringen av den biosyntetiska genklustret. Detta förfarande kan tillämpas på någon annan förening härledd från en Streptomyces-stam eller någon annan mikroorganism.

Protocol

1. Identifiering av en naturlig produkt med antibiotika Property

  1. Odla en mikroorganism under olika förhållanden (t.ex. tid, temperatur, pH, media) genom att följa "OSMAC (en stam-många föreningar) approach" 13. Välja ett medium, i vilket framställningen av en förening kan observeras.
  2. Odla Streptomyces diastatochromogenes Tü6028 under följande förutsättningar
    1. Växa Streptomyces diastatochromogenes Tü6026 påfrestning på MS-plattor (sojamjöl 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1,5%, kranvatten 1 L). Ympa en liten ögla av sporer av denna stam i 20 ml flytande TSB-medium (tryptisk sojabuljong 30 g, kranvatten 1 L, pH 7,2; förodling medium) i en Erlenmeyerkolv med en spiral. Skaka kolven på en roterande skakapparat (28 ° C, 180 rpm, 2 dagar).
    2. Inokulera huvudkultur i 100 ml HA-medium (glukos 4 g, jästextrakt 4 g, maltextrahera 10 g, kranvatten 1 L, pH 7,2) med 2 ml av förkulturen. Kultur töjningen vid 28 ° C under 6 dagar på en roterande skakanordning vid 180 rpm.
  3. Framställning av råextraktet
    1. Harvest cellerna genom centrifugering (10 min, 3000 XG).
    2. För nästa steg hantera organiska lösningsmedel under ett dragskåp.
    3. För förening extraktion från myceliet, återsuspendera cellerna i en tvåfaldig volym av aceton och skaka i ett rör för 30 min, 180 rpm. Filtrera vätskan genom kommersiell filterpapper och indunsta aceton genom rotationsindunstare vid 40 ° C och 550 bar. Lös upp extraktet i 20 ml vatten: etylacetat (1: 1) och skaka den i en separationstratt under 30 minuter vid 180 rpm.
    4. För förening extraktion från odlingsmediet, justera odlingsbuljongen till pH 4,0 genom tillsats av 1 M HCl. Tillsätt 100 ml etylacetat och skaka den i en separationstratt under 30 minuter, 180 rpm.
    5. Samla etylacetatfasen och indunsta av röta ary indunstning vid 40 ° C och 240 bar.
  4. Analys av råextraktet genom HPLC
    1. Upplösa extrakt i 1 ml MeOH, filtrera dem genom ett 0,45 ^ m porstorlek filter och köra högpresterande vätskekromatografi (HPLC) 14.
    2. I fallet med polyketomycin, utrusta i HPLC-systemet med en C18 förkolonn (4,6 x 20 mm 2) och en C18-kolonn (4,6 x 100 mm 2). Använda en linjär gradient av acetonitril + 0,5% ättiksyra som sträcker sig från 20% till 95% i H2O + 0,5% ättiksyra (flödeshastighet: 0,5 ml min -1).
      OBS: Polyketomycin har en retentionstid av 25,9 min (se figur 1A). UV / synligt spektrum har maxima vid 242 nm, 282 nm, 446 nm och minima vid 262 nm och 359 nm (se figur 1B). I den negativa modus en massa av 863,2 [MH] - kan detekteras (se figur 1C).

"Src =" / filer / ftp_upload / 54952 / 54952fig1.jpg "/>
Figur 1: LC / MS-analys av Polyketomycin. (A) HPLC-kromatogram (λ = 430 nm) av det råa extraktet efter odling av Streptomyces diastatochromogenes Tü6028 i 6 dagar. Polyketomycin har en retentionstid av 25,9 min (B) UV / synligt spektra för Polyketomycin. (C) Mass-spektra för Polyketomycin nekande modus. Huvudtopp med m / z 863,2 [MH] -. Klicka här för att se en större version av denna siffra.

  1. Identifiering av den antibiotiska aktiviteten med hjälp av skiv diffusion analys
    1. Inokulera teststammar såsom grampositiva bakterier Bacillus subtilis (i LB-medium, LB 20 g, kranvatten 1 L, pH 7,4) och andra Streptomyces-stammar (i TSB-medium; tryptisk sojabuljong 30 g, kranvatten 1 L, pH 70,2), gramnegativa bakterier Escherichia coli (i LB-medium) och svampstammar (i media såsom YPD-medium; jästextrakt 10 g, pepton 20 g, glukos 20 g, kranvatten 1 L, pH 7,4). Ta 100 mikroliter av teststammen förodling och sprida dem på respektive agarplattor.
    2. Lös råextraktet eller renade föreningen i 500 mikroliter av metanol (alternativt vatten eller DMSO) och pipett 20-50 mikroliter på sterila pappersskivor. Torra pappersskivor för 30 minuter under arbetsbänken och sätta dem på plattorna med testkulturerna. Bered en negativ kontroll (lösningsmedel) och en positiv kontroll (antibiotikum, t ex apramycin [1 mg]).
    3. Inkubera plattorna under tillfredsställande förhållanden tills teststammarna är synligt odlas och bestämma hämningszonen, om uppenbar. Inkubera E. coli och Bacillus sp. vid 37 ° C under 16 h, Streptomyces sp. vid 28 ° C under 2-4 dagar, svampstam (huvudsakligen beroende av exakta teststam) ent 30 ° C under 2 dagar).

2. Storskalig Utvinning, rening och struktur Klarläggande av föreningen

  1. Odla S. diastatochromogenes i 5 L HA-medium (glukos 4 g, jästextrakt 4 g, maltextrakt 10 g, kranvatten 1 L, pH 7,2). Ympa 2 ml av förkulturen i 30 x 500 ml Erlenmeyerkolvar innehållande 150 ml HA medium. Inkubera töjningen vid 28 ° C under 6 dagar på en roterande skakanordning vid 180 rpm.
  2. Harvest cellerna genom centrifugering (10 min, 15.000 xg, RT) och extrahera föreningar med användning av etylacetat (se avsnitt 1.3).

figur 2
Figur 2: Workflow för struktur Förtydligande. Förfarandet innefattar (1) odling av stammen, (2) extraktion, (3) rening genom fastfas-extraktion (SPE), tunnskiktskromatografi (TLC), preparativ HPLC (HPLC), storlek(SEC) och (4) struktur belysning genom massanalys (MS), kärnmagnetisk resonans (NMR) och röntgenmätningar. Klicka här för att se en större version av denna siffra.

  1. Rening av Polyketomycin
    OBS: Processen att rening och strukturen belysning visas i figur 2.
    1. Fraktionera råextrakt genom en kolonn C18 fastfasextraktion (SPE) med användning av en 10% -stepwise MeOH-gradient som sträcker sig från 30% till 100% MeOH i H2O, 100 ml för varje tillstånd.
    2. Rena föreningen innehållande fraktionen ytterligare genom preparativ tunnskiktskromatografi (TLC) 15 med användning av CH 2 Cl 2 / MeOH (7: 1) som elueringssystem.
    3. Rena föreningen genom preparativ HPLC 16. Utrusta i HPLC-systemet med en C18 förkolonn (5 pm; 9,4 x 20 mm) och enHuvud kolonn (5 pm; 9,4 x 150 mm). Använda en gradient av acetonitril + 0,5% ättiksyra som sträcker sig från 20% till 95% i H2O + 0,5% ättiksyra (flödeshastighet: 2,0 ml / min).
    4. För att ta bort lösningsmedel och andra små föroreningar, utför ett sista reningssteg genom storleksexklusionskromatografi med användning av en kolonn i MeOH 17. Samla in den slutliga rena föreningen och indunsta MeOH genom rotationsindunstning vid 40 ° C och 240 bar.
  2. struktur klargörande
    1. Lös den rena föreningen (mer än 2 mg) i 600-700 mikroliter (beroende på maskinen) i DMSO 6, rekord 1D NMR (1H, 13 C) och 2D NMR (HSQC, HMBC, en H- 1H COSY) spektra på en NMR-spektrometer 18. Uttrycka kemiska förskjutningar i ö-värden (ppm) med användning av DMSO-d6.
    2. Spela in en högupplöst masspektrum (HRESI-MS) 19 av polyketomycin med användning av en högupplösandemasspektrometer.
    3. Klarlägga strukturen genom tolkning av resultaten av NMR- och MS-analys av data 10.

3. Att föreslå Biosyntetiska modell av den nya isolerade föreningen

  1. Analysera strukturen av den isolerade föreningen och förutsäga enzymer, som kan vara inblandade i dess biosyntes. Tilldela dem till polyketid (typ I, II eller III), icke-ribosomal peptidsyntes, lantipeptide, terpenoid eller socker metabolism vägen 8.
  2. exempel polyketomycin
    1. Dela strukturen i uppenbara enkel delar: tetra del, två monosackarider och dimetyl-salicylsyra.
    2. Ta reda på, där grupperna kan härledas från: tetra delen kan härledas från en polyketid syntas typ II och dimetyl-salicylsyra delen kan härledas genom en iterativ polyketid syntas typ I. De två sockergrupper, som är 6-deoxysugars , skulle kunna synthesiZed från glukos innebär en TDP-glukos-4,6-dehydratas under biosyntesen och fäst troligen av två glykosyltransferaser (se figur 3) 8.
    3. Förutsäga förmodade gener i klustret. Tänk på enzymer som är involverade i syntesen av de enskilda delarna, i anslutning enheter, liksom i att modifiera och skräddarsy molekylen. Den biosyntetiska genen kluster av Polyketomycin innehåller sannolikt gener som kodar för en polyketid syntas typ II (därför minst en ACP, KS α und KS β för anslutning extender enheter), en iterativ polyketid syntas typ I (åtminstone ACP, AT, KS), en TDP-glukos-4,6-dehydratas (nödvändigt för steg: glukos → deoxiglukos) och två glykosyltransferaser (förenade två socker monomerer till aglykonen) 8.

Figur 3
Figur 3: Uppbyggnad av Polyketomycin Divided i Single Building Blocks. Polyketomycin är sammansatt av en tetracyklisk decaketid (PKS typ II) och en dimetyl salicylsyra (iterativ PKS typ I), förenade genom de två deoxysugar molekyldelar β-D-amicetose och α-L-axenose (NDP-glukos-4,6- dehydratas och två glykosyltransferas krävs). Klicka här för att se en större version av denna siffra.

4. Genome Sequencing / Mining

  1. Nästa generations sekvense
    1. Sekvensera iskt DNA av nästa generations sekvenseringsteknologier som Illumina, 454 Pyrosequencing eller fast 20. Rikta enda läser till en referenssekvens eller montera de novo.
      OBS! Genomet hos S. diastatochromogenes Tü6028 sekvenserades vid Centrum för bioteknik (CeBiTec) vid University of Bielefeld. Alla läser samlades till ett utkast genompå 7,9 Mb.
  2. genomet mining
    1. Sök efter öppna läsramar (ORF) med användning av till exempel NCBI Prokaryot Genome Notering Pipeline 21,22, RAST (snabb anteckning med hjälp av delsystemet teknik) 23,24,25, Prokka (snabb prokaryot genom annotation) 26 eller GenDB 27. Dessa program föreslår också deras funktioner. Analysen av S. diastatochromogenes Tü6028 utkast genomet sekvens ledde till identifieringen av mer än 7000 ORF.
    2. Kör specifika BLAST (Basic Local Alignment Search Tool) analys för att få mer information som inriktningar med andra liknande gener och katalytiska domänerna 28,29,30.
    3. För identifiering av de sekundära metabolit genkluster köra program som antiSMASH 31,32,33, NaPDoS 34 och NRPSpredictor 35,36. I utkastet till genomet hos Streptomyces diastatochromogenes antiSMASH 31,32,33 identierad 22 genkluster.
    4. Analysera de förmodade genkluster för deras enzymatiska vägen (s) (polyketid syntas (typ I, II eller III), icke-ribosomal peptid syntetas, lanthipeptide, terpenoida, socker metabolism ...). Sökning efter modul (er) som innehåller gener som kan vara involverade i syntesen av föreningen (se avsnitt 3). I S. diastatochromogenes kommenterad kluster 2 innehåller polyketid syntas typ II-gener, tre polyketid syntas typ I-gener, en TDP-glukos-4,6-dehydratas genen och två glykosyltransferasaktiviteter gener (se Figur 4).
    5. Fokus på enskilda gener i klustret. För PKS typ I och NRPS specificiteten hos acyltransferaser och adenylering domäner, och sålunda inkorporering av enstaka extender enheter, kan förutsägas. jämför också ordningen på den inbyggda extender enhet med molekylen. antiSMASH 31,32,33 visar också liknande kluster av redan kända föreningar, med en länk till MIBiG databas 37. Jämföra strukturen av föreningen med dessa andra föreningar och kontrollera efter likheter.

figur 4
Figur 4: antiSMASH Produktionen Polyketomycin Biosyntetisk genklustret och översikt av andra kluster i S. diastatochromogenes Tü6028. (A) Översikt över förväntade biosyntetiska genkluster i genomet hos S. diastatochromogenes Tü6028; (B) Cluster 2 Polyketomycin biosyntetiska genkluster med riktade gener. Klicka här för att se en större version av denna siffra.

5. Kontroll av den biosyntetiska Gene Cluster

  1. Sök efter en gen med uppenbara och viktiga (väsentliga) funktioner för biosyntes av föreningen. För kontroll av polyketomycin genklustret genen pokPI, som kodar för ketosynthase α från PKS typ II, valdes och inaktiveras genom en av ram -deletion (se figur 5B). Alternativt avbryter genen genom kloning ett internt fragment (se figur 5C).

figur 5
Figur 5: Kontroll av en Gene Cluster av Single Crossover. (A) Native gen leder till översättningen av ett funktionellt protein; (B) Kloning av genen med inre deletion i en självmordsvektor leder till en enda överkorsnings vilket resulterar i en ram förskjutning i den målinriktade genen och efterföljande translation av icke-funktionellt protein; (C) Kloning av ett inre fragment av genen in i en självmordsvektor leder till en trunkering av genen och efterföljande translation av ett icke-funktionellt protein. oriT: ursprung tverför; antibiotika R: antibiotikaresistens. Klicka här för att se en större version av denna siffra.

  1. Kloning av single-crossover-konstruktionen
    1. Amplifiera ett fragment innehållande pokPI genom PCR 38 med primers pokPI_for och pokPI_rev.
    2. Klonen PCR-produkten in i självmordsvektorn pKC1132 39 (apramycin R [50 mg / ml]). Självmordsvektorn inte kan replikeras i Streptomyces-stammen och har att integrera i den målinriktade genen genom homolog rekombination för att tillhandahålla apramycin-resistens således. Överför vektorn i E. coli kloning värd genom värmechock omvandling 40.
    3. Isolera vektorn genom alkalisk lys 41.
    4. Smälta vektor-DNA med en enda skärrestriktionsenzym som skär inom fragmentet. Den pokPI gene digererades med enzym Kpn I.
    5. Behandla uppsluten vektor-DNA med stort DNA-polymeras I (Klenow) fragment, som har 5 '→ 3' polymerasaktivitet och 3 '→ 5' exonukleas-aktivitet. Avtrubbning av de klibbiga ändarna och efterföljande återligering leder till förlust av fyra baser. Kontrollera om förlusten av dessa baser vid steg transformation i E. coli XL1 Blue, plocka enstaka kolonier, isolera plasmid-DNA, 41 och analysera ytterligare genom restriktionsklyvning och sekvensering.
  2. Konjugering av enkel crossover konstruktion i Streptomyces
    1. Överför självmord vektor innehållande pokPI genen (pKC1132_ pokPI del) med deletion i E. coli ET12567 pUZ8002 42 (kanamycin R) genom värmechock omvandling 40. Inkubera cellerna i 100 ml LB-medium (kanamycin 50 mikrogram ml -1, apramycin 50 mikrogram ml -1
    2. Blanda 500 mikroliter E. coli pUZ8002 pKC1132_ pokPI del med 500 mikroliter Streptomyces diastatochromogenes kultur (alternativt använda sporer). Bred ut blandningen på MS-plattor (sojamjöl 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1,5%, kranvatten 1 L). Inkubera plattorna under 20 h vid 28 ° C.
    3. Overlay varje platta med apramycin (1,25 mg) och fosfomycin (5 mg) upplöst i 1 ml vatten och låt dem torka. Inkubera plattorna under flera dagar vid 28 ° C tills exconjugants är synliga.
  3. Kontrollera single-crossover-mutanter
    1. Inokulera enstaka exconjugants i 20 ml TSB-medium (apramycin 50 mg ml -1) och inkubera dem vid 28 ° C under tre dagar och 180 rpm.
    2. Isolera genomiskt DNA 43 och kontrollera avbrott i pokPI genen genom PCR.
    3. Inokulera enstaka kloner med verifierad gen avbrott och Streptomyces vildtyp stam i 100 ml HA medium och inkubera dem under 6 dagar vid 28 ° C och 180 rpm. Utdrag råextraktet (se avsnitt 1.3). Kontrollera förening produktion av HPLC-MS-analys (se avsnitt 1.4). Den motsvarande toppen i HPLC-kromatogram och massan av föreningen skall inte kunna detekteras längre (se figur 6).

figur 6
Figur 6: HPLC-analys av S. diastatochromogenes med Inaktiv pokPI Gene. HPLC-kromatogram (λ = 430 nm) av råextrakt av S. diastatochromogenes WT (överst) och mutantstam med avbruten pokPI -gen (nedan). Den mutanta stammen producerar inte polyketomycin längre.Klicka här för att se en större version av denna siffra.

Representative Results

I denna översikt beskriver vi de enskilda steg från identifiering av ett antibiotikum som leder till dess biosyntetiska genkluster. Många år sedan klonade vi ett kosmidbibliotek, förpackas dem in i fager, transducerade E. coli värdceller, och var tvungen att screena tusentals kolonier för att identifiera de kloner som har överlappande regioner av polyketomycin kluster. Sekvensering av kosmiderna var också en svår och dyr process 12.

För att genomföra ytterligare studier på stammen sekvens vi hela genomet hos Streptomyces diastatochromogenes Tü6028. Med förslaget genomsekvensen vi lätt identifieras den biosyntetiska genen kluster av polyketomycin och andra kluster som kodar lovande föreningar. Figur 7 jämför den "gamla" metod för att identifiera den biosyntetiska klustret genom kloning av ett kosmidbibliotek och elaborative screening, ochden "nya" metod hela genomet sekvensering med efterföljande genombrytning på en grov tidsskala. De nya sekvenseringsteknologier och nya genom gruv program påskynda hela processen.

figur 7
Figur 7: Jämförelse av den "gamla" och "nya" Method of Tilldela ett biosyntetiskt Gene Cluster. Den "gamla" förfarande innefattar kloning av en kosmid bibliotek med selektion av positiva kloner och sekvensering av respektive kosmid (er) (ovan); Den "nya" metoden innefattar hela genom sekvensering och -mining att identifiera alla sekundära metaboliten genkluster belägna på genomet av stammen (nedan). Varaktighet av enstaka steg visas på en grov tidsskala. Klicka här för att se en större version av denna siffra.

Materials

Name Company Catalog Number Comments
agar Carl Roth GmbH + Co. KG, Karlsruhe, Germany 5210.4
agarose Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6352.4
D-mannitol  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4175.1
glucose  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6780.1
LB  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X964.3
malt extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X976.2
MgCl2 Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2189.1
Peptone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany
soy flour  W.Schoenemberger GmbH, Magstadt, Germany Hensec-Vollsoja
tryptic soy broth Carl Roth GmbH + Co. KG, Karlsruhe, Germany X938.3 Caso-Bouillon
yeast extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2363.2
Solvents
Acetic acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 3738.5
Acetone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 9372.2
Acetonitrile Avantor Performance Materials B.V., Deventer, The Netherlands JT-9012-03
Dichlorofrom  Fisher Scientific GmbH, Schwerte, Germany 1530754
DMSO (Dimethyl sulfoxide) Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4720.1
DMSO-d6 (Dimethyl sulfoxide-d6) 99.9 atom% D ARMAR Chemicals, Döttingen, Switzerland 15200.204
Ethyl acetate Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6784.4
Hydrochloric acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6331.4
Methanol Carl Roth GmbH + Co. KG, Karlsruhe, Germany 7342.1
Enzymes
restriction enzymes New England Biolabs GmbH, Frankfurt am Main, Germany
polymerase  New England Biolabs GmbH, Frankfurt am Main, Germany
DNA Polymerase I Large (Klenow) Fragment Promega GmbH, Mannheim, Germany
Antibiotics
apramycin AppliChem GmbH, Darmstadt, Germany  A7682.0005
fosfomycin Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany P5396-50G
kanamycin Carl Roth GmbH + Co. KG, Karlsruhe, Germany T832.2
Plasmid/Vectors
pKC1132 Bierman et al. 1992
Primer 
pokPI_for TGATGGTGCCGCTGGCCATGG Primer to amplify fragment containing pokPI gene
pokPI_rev AGCGTTCACTGTTCCGCCCGAC
Bacterial strains
Bacillus subtilis COHN ATCC6051 Gram-positive test strain 
Escherichia coli ET12567 pUZ8002  MacNeil et al. 1992 strain for conjugation
Escherichia coli XL1 Blue Agilient Technologies, Santa Clara, USA Gram-negative test strain + cloning host 
Streptomyces diastatochromogenes Tü6028 Paululat et al., 1999 Polyketomycin producer
Online services
antismash (Antibiotics and Secondary Metabolite Analysis Shell) http://antismash.secondarymetabolites.org/ Detection of secondary metabolite gene cluster
BLAST (Basic Local Alignment Search Tool) http://blast.ncbi.nlm.nih.gov/Blast.cgi finds regions of similarity between biological sequences
GenDB https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb Annotation of ORFs 
MiBIG (Minimum Information about a Biosynthetic Gene cluster) http://mibig.secondarymetabolites.org/ Database of biosyntetic gene clusters
NaPDoS http://napdos.ucsd.edu/ Detection of seconary metabolite gene cluster
NCBI Prokaryotic Genome Annotation Pipeline http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ Annotation of ORFs 
NRPSpredictor http://nrps.informatik.uni-tuebingen.de/ Detection of NRPS domains
Prokka (rapid prokaryotic genome annotation) http://www.vicbioinformatics.com/software.prokka.shtml Annotation of ORFs 
RAST (rapid annotation using subsystems technology) http://rast.nmpdr.org/ Annotation of ORFs 
Other programs
Chem Station Rev. A.09.03 Agilent Technologies, Waldbronn, Germany Handling program for HPLC 
Clone Manager Suite 7 Scientific and Educational Software, Cary, USA Designing Cloning Experiment 
Newbler v2.8 Roche Diagnostics Alignment of sequencing reads
Machines 
Centrifuge Avanti J-6000, Rotor JA-10 Beckman Coulter GmbH, Krefeld, Germany
HPLC/MS Agilent Technologies, Waldbronn, Germany
_Autosampler: G1313A Agilent Technologies, Waldbronn, Germany
_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 µm) Agilent Technologies, Waldbronn, Germany
_Column:Xbridge C18 (100 mm × 4.6 mm; Particle size: 3.5 μm) Agilent Technologies, Waldbronn, Germany
_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_Degasser: G1322A  Agilent Technologies, Waldbronn, Germany
_Quarternary pump: G1311A Agilent Technologies, Waldbronn, Germany
_Diode array detector (DAD )G1315B (λ = 254 nm and 400 nm) Agilent Technologies, Waldbronn, Germany
_Quadrupole mass detector (MSD) G1946D(2-3000 m/z) Agilent Technologies, Waldbronn, Germany
rotary evaporator
_heating bath Hei-VAP Value/G3 Heidolph Instruments GmbH & Co.KG, Schwabach, Germany
_vacuum pump system SC 920 G KNF Global Strategies AG, Sursee, Switzerland
Other material
Sephadex LH20 GE Healthcare, 
Chromafil PVDF-45/15MS (pore size 0.45 µm; filter Ø15 mm) MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany
SPE column Oasis HLB 20 35 cc (6g) Waters GmbH, Eschborn, Germany 
E. coli  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Bacillus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Streptomyces sp. Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g
for agar plates add 2% agar

DOWNLOAD MATERIALS LIST

References

  1. Fleming, A. On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae. Br J Exp Pathol. 10, (3), 226-236 (1929).
  2. Lemke, A., Kiderlen, A. F., Kayser, O. Amphotericin B. Appl. Microbiol. Biotechnol. 68, (2), 151-162 (2005).
  3. Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. Daptomycin. Nat. Rev. Drug Discov. 2, (12), 943-944 (2003).
  4. Zakeri, B., Wright, G. D. Chemical biology of tetracycline antibiotics. Biochem. cell Biol. 86, (2), 124-136 (2008).
  5. Schatz, A., Bugle, E., Waksman, S. A. Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria. Exp. Biol. Med. 55, (1), 66-69 (1944).
  6. Burg, R. W., et al. Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob. Agents Chemother. 15, (3), 361-367 (1979).
  7. Egerton, J. R., Ostlind, D. A., et al. Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component. Antimicrob. Agents Chemother. 15, (3), 372-378 (1979).
  8. Walsh, C. T., Fischbach, M. A. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132, (8), 2469-2493 (2010).
  9. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination. J. Antibiot. (Tokyo). 51, (1), 26-32 (1998).
  10. Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.Tü6028. J. Antibiot. (Tokyo). 52, (2), 96-101 (1999).
  11. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities. J. Antibiot. (Tokyo). 51, (1), 21-25 (1998).
  12. Daum, M., et al. Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin. Chembiochem. 10, (6), 1073-1083 (2009).
  13. Bode, H. B., Bethe, B., Höfs, R., Zeeck, A. Big effects from small changes: possible ways to explore nature's chemical diversity. Chembiochem. 3, (7), 619-627 (2002).
  14. Wolfender, J. -L. HPLC in Natural Product Analysis: The Detection Issue. Planta Med. 75, (07), 719-734 (2009).
  15. Stahl, E. Thin-layer chromatography. A laboratory handbook. 2nd edition (1967).
  16. Snyder, L. R., Kirkland, J. J., Glajch, J. L. Preparative HPLC Separation. Pract. HPLC Method Dev. 616-642 (2012).
  17. Granath, K. A., Kvist, B. E. Molecular weight distribution analysis by gel chromatography on sephadex. J. Chromatogr. A. 28, 69-81 (1967).
  18. Jackman, L. M., Sternhell, S. Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry. Int. Ser. Org. Chem. (1969).
  19. Xian, F., Hendrickson, C. L., Marshall, A. G. High resolution mass spectrometry. Anal. Chem. 84, (2), 708-719 (2012).
  20. Metzker, M. L. Sequencing technologies - the next generation. Nat. Rev. Genet. 11, (1), 31-46 (2010).
  21. Tatusova, T., et al. Prokaryotic Genome Annotation Pipeline. NCBI Handb. 2nd Ed. (2013).
  22. Angiuoli, S. V., et al. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation. OMICS. 12, (2), 137-141 (2008).
  23. Aziz, R. K., et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 9, 75 (2008).
  24. Overbeek, R., et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 42, 206-214 (2014).
  25. Brettin, T., et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 5, 8365 (2015).
  26. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 30, (14), 2068-2069 (2014).
  27. Meyer, F. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 31, (8), 2187-2195 (2003).
  28. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, (3), 403-410 (1990).
  29. Madden, T. The BLAST Sequence Analysis Tool. NCBI Handb. 2nd Ed. Chapter 16 (2003).
  30. Marchler-Bauer, A., et al. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, (Database issue) 222-226 (2014).
  31. Medema, M. H., et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, (Web Server issue) 339-346 (2011).
  32. Blin, K., et al. antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 41, (Web Server issue) 204-212 (2013).
  33. Weber, T., et al. antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, (W1) 237-243 (2015).
  34. Ziemert, N., et al. The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity. PLoS One. 7, (3), 34064 (2012).
  35. Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res. 33, (18), 5799-5808 (2005).
  36. Röttig, M., et al. NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39, (Web Server issue) 362-367 (2011).
  37. Medema, M. H., et al. Minimum Information about a Biosynthetic Gene cluster. Nat. Chem. Biol. 11, (9), 625-631 (2015).
  38. Mullis, K., et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51, Pt 1 263-273 (1986).
  39. Bierman, M., et al. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 116, (1), 43-49 (1992).
  40. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli.using the heat shock method. J. Vis. Exp. (6), e253 (2007).
  41. Bimboim, H. C., Doly, J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, (6), 1513-1523 (1979).
  42. MacNeil, D. J., et al. Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector. Gene. 111, (1), 61-68 (1992).
  43. Pospiech, A., Neumann, B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet. 11, (6), 217-218 (1995).
  44. Makitrynskyy, R., et al. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin. Open Biol. 3, (10), 130121 (2013).
  45. Kalan, L., et al. A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene. Chem. Biol. 20, (10), 1214-1224 (2013).
  46. Gessner, A., et al. Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains. ChemBioChem. 16, (15), 2244-2252 (2015).
Från en naturlig produkt till dess biosyntes Gene Cluster: En demonstration Använda Polyketomycin från<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).More

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter