Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Von einem natürlichen Produkt in seine Biosynthesegenclusters: Eine Demonstration Mit Polyketomycin aus doi: 10.3791/54952 Published: January 13, 2017

Summary

Hier präsentieren wir ein detailliertes Protokoll von (A) die Identifizierung eines Naturprodukt mit antibiotische Aktivität, (B) die Reinigung der Verbindung, (C) das erste Modell seiner Biosynthese, (D) Genomsequenzierung / -mining und die ( E) die Überprüfung der Biosynthesegenclusters.

Abstract

Streptomyces - Stämme sind für ihre Fähigkeit bekannt , eine Menge von verschiedenen Verbindungen mit verschiedenen biologischen Aktivitäten herzustellen. Kultivierung unter verschiedenen Bedingungen führt oft zur Herstellung neuer Verbindungen. Daher Produktionskulturen der Stämme werden mit Ethylacetat extrahiert, und die Rohextrakte durch HPLC analysiert. Weiterhin werden die Extrakte für die Bioaktivität von verschiedenen Assays getestet. Für die Strukturaufklärung der Verbindung von Interesse wird durch eine Kombination verschiedener Chromatographie-Verfahren gereinigt.

Die Sequenzierung des Genoms gekoppelt mit Genomanalyse ermöglicht die Identifizierung von einem natürlichen Produkt Biosynthesegenclusters verschiedene Computerprogramme verwendete. Um zu bestätigen, dass das richtige Gen-Cluster identifiziert wurde, Gen-Inaktivierung Experimente durchgeführt werden müssen. Die resultierenden Mutanten sind für die Produktion der jeweiligen Naturprodukt analysiert. Sobald die richtige Gencluster inaktiviert wurde, dieStamm ausfallen sollte, die Verbindung herzustellen.

Der Workflow wird für die antibakterielle Verbindung polyketomycin von Streptomyces diastatochromogenes Tü6028 produziert gezeigt. Vor rund zehn Jahren, als der Genomsequenzierung noch sehr teuer war, das Klonen und die Identifizierung eines Gens Cluster war ein sehr zeitaufwändiger Prozess. Schnelle Genomsequenzierung mit Genomanalyse kombiniert beschleunigt die Studie der Cluster Identifizierung und neue Wege eröffnet, um die Biosynthese erforschen und neue natürliche Produkte durch genetische Methoden zu erzeugen. Das Protokoll in diesem Dokument beschrieben sind, können aus einem Streptomyces - Stamm oder einem anderen Mikroorganismus abgeleitet jede andere Verbindung zugeordnet werden.

Introduction

Natürliche Produkte aus Pflanzen und Mikroorganismen haben immer eine wichtige Quelle für die klinische Entwicklung von Arzneimitteln und Forschung. Das erste Antibiotikum Penicillin wurde 1928 von einem Pilz von Alexander Fleming 1 entdeckt. Heutzutage sind viele natürliche Produkte in der klinischen Behandlung eingesetzt.

Eine Gattung bekannt für ihre Fähigkeit , verschiedene Arten von sekundären Metaboliten mit verschiedenen biologischen Aktivitäten herzustellen , ist Streptomyces. Streptomyces sind grampositive Bakterien und gehören zu der Klasse von Actinobacteria und der Ordnung Actinomycetales. Fast zwei Drittel der klinisch verwendeten Antibiotika sind aus Actinomycetales abgeleitet, vor allem aus Streptomyces, wie Amphotericin 2, Daptomycin 3 oder Tetracyclin 4. Zwei Nobelpreise wurden auf dem Gebiet der Streptomyces Antibiotikaforschung ausgezeichnet. Der erste ging an Selman Waksman für die Entdeckung von Streptomycin, wobei die erste einetibiotic wirksam gegen Tuberkulose. 5 Im Jahr 2015 als Teil des Nobelpreis für Physiologie und Medizin, die Entdeckung von Avermectin von S. avermitilis wurde ebenfalls ausgezeichnet. Avermectin wird zur Behandlung von parasitären Erkrankungen 6,7 verwendet.

Der traditionelle Ansatz für die Entdeckung von Naturprodukten in Mikroorganismen wie Streptomyces umfaßt im allgemeinen Kultivierung des Stammes unter verschiedenen Wachstumsbedingungen, sowie die Extraktion und Analyse von Sekundärmetaboliten. Bioaktivität Assays (beispielsweise Tests für antibakterielle und Anti - Krebs - Aktivität) werden durchgeführt , um die Aktivität der Verbindung zu erfassen. Schließlich wird die Verbindung von Interesse isoliert, und die chemische Struktur aufgeklärt wird.

Die Strukturen von Naturprodukten sind oft aus einzelnen Einheiten zusammengesetzt, die komplexe Moleküle bilden. Es gibt ein paar, aber begrenzt, großen Biosynthesewege zu führenden Blockbildungks, die für die Biosynthese von Naturprodukten verwendet werden. Die wichtigsten Biosynthesewege sind die Polyketid-Bahnen, Bahnen, die zu Terpenoide und Alkaloide, Wege Aminosäuren verwendet und Wege zu Zuckergruppen führen. Jeder Weg wird durch einen Satz von spezifischen Enzymen 8 gekennzeichnet. Auf der Basis der Struktur der Verbindung können diese biosynthetischen Enzyme vorhergesagt werden.

Heute kann die detaillierte Strukturanalyse einer Verbindung in Kombination mit der nächsten Generation Sequenzierung und bioinformatischen Analyse helfen den verantwortlichen Biosynthesegenclusters zu identifizieren. Die Cluster-Informationen eröffnet neue Wege für die weitere Naturstoffforschung auf. Dazu gehören die heterologe Expression die Ausbeute des Naturprodukt, gezielte Verbindung Modifikation durch Gen-Deletion oder Veränderung und kombinatorische Biosynthese mit Genen von anderen Bahnen zu erhöhen.

Polyketomycin wurde unabhängig von der Kulturbrühe isoliertzwei Stämme, Streptomyces sp. MK277-AF1 9 und Streptomyces diastatochromogenes Tü6028 10. Die Struktur wurde durch NMR und Röntgenstrukturanalyse aufgeklärt. Polyketomycin besteht aus einem tetracyclischen decaketid und einem dimethyl Salicylsäure, verbunden durch die beiden Desoxyzucker Einheiten β-D-amicetose und α-L-axenose. Es zeigt zytotoxische und antibiotische Aktivität, auch gegen Gram-positive multidrug-resistente Stämme wie MRSA 11.

Eine genomische Cosmid - Bibliothek von S. diastatochromogenes Tü6028 erzeugt wurde und vor vielen Jahren untersucht. Mit Hilfe spezifischer Gensonden die polyketomycin Gencluster mit einer Größe von 52,2 kb, enthält 41 Gene wurden 12 nach mehreren Monaten intensiver Arbeit identifiziert. Vor kurzem wurde ein Entwurf Genomsequenz von S. diastatochromogenes erhalten die schnelle Identifizierung des polyketomycin Gencluster führt. In dieser Übersicht hilft ein Verfahren zu identifizieren ein natürliches Produkt und verdeutlichen seine Biosynthesegenclusters beschrieben werden, als Beispiel polyketomycin.

Hier erläutern wir die einzelnen Schritte , die von einem natürlichen Produkt seiner Biosynthesegenclusters für polyketomycin hergestellt gezeigt führen durch Streptomyces diastatochromogenes Tü6028. Das Protokoll umfasst die Identifizierung und Reinigung eines Naturprodukt mit antibiotischen Eigenschaften. Weitere strukturelle Analyse und den Vergleich mit den Ergebnissen aus Genom-Mining führen zur Identifizierung des Biosynthesegenclusters. Dieses Verfahren kann aus einem Streptomyces - Stamm oder einem anderen Mikroorganismus abgeleitet jede andere Verbindung angewendet werden.

Protocol

1. Bezeichnung eines Naturprodukts mit Antibiotika Property

  1. Pflegen eines Mikroorganismus unter verschiedenen Bedingungen (zB Zeit, Temperatur, pH - Wert, Medien) im Anschluss an die "OSMAC (ein Stamm-viele - Verbindungen) Ansatz" 13. Wählen Sie ein Medium, in dem die Herstellung einer Verbindung beobachtet wird.
  2. Pflegen Streptomyces diastatochromogenes Tü6028 unter den folgenden Bedingungen
    1. Wachsen Streptomyces diastatochromogenes Tü6026 Stamm auf MS - Platten (Sojamehl 20 g, D-Mannit 20 g, MgCl 2 10 mM, Agar 1,5%, Leitungswasser 1 l). Impfen eine kleine Schleife der Sporen dieses Stammes in 20 ml Flüssigkeit TSB-Medium (tryptische Sojabrühe 30 g, Leitungswasser 1 l, pH 7,2; Vorkultur-Medium) in einem Erlenmeyerkolben mit einer Spirale. Schütteln Sie den Kolben auf einem Rotationsschüttler (28 ° C, 180 Umdrehungen pro Minute, 2 Tage).
    2. Impfen Hauptkultur in 100 ml HA-Medium (Glucose 4 g, Hefeextrakt 4 g, MalzExtrakt 10 g, Leitungswasser 1 l, pH 7,2) mit 2 ml der Vorkultur. Kultur der Stamm bei 28 ° C für 6 Tage auf einem Rotationsschüttler bei 180 Upm.
  3. Herstellung des Rohextrakts
    1. Ernte die Zellen durch Zentrifugation (10 min, 3.000 x g).
    2. Für die nächsten Schritte behandeln organischen Lösungsmitteln unter einer Abzugshaube.
    3. Für Verbindung Extraktion aus dem Myzel, resuspendieren Zellen in einem zweifachen Volumen Aceton und schütteln in einem Rohr für 30 min, 180 UpM. Filtern der Flüssigkeit durch kommerzielle Filterpapier und dampfe Aceton am Rotationsverdampfer bei 40 ° C und 550 bar. Man löst den Extrakt in 20 ml Wasser: Ethylacetat (1: 1) und schütteln Sie sie in einem Trenntrichter für 30 Minuten bei 180 Umdrehungen pro Minute.
    4. Für Verbindung Extraktion aus dem Kulturmedium, stellen Sie die Kulturbrühe auf pH 4,0 durch Zugabe von 1 M HCl. In 100 ml Ethylacetat und schütteln Sie sie in einem Scheidetrichter 30 min, 180 Umdrehungen pro Minute.
    5. Sammeln Sie Ethylacetatphase und verdunsten durch Fäulnis ary Verdampfung bei 40 ° C und 240 bar.
  4. Analyse des Rohextrakts durch HPLC
    1. Man löst die Extrakte in 1 ml MeOH, filtern sie durch einen 0,45 & mgr; m Porengröße Filter und führen Hochleistungs-Flüssigkeits - Chromatographie (HPLC) 14.
    2. Im Falle von polyketomycin statten das HPLC - System mit einer C18 - Vorsäule (4,6 x 20 mm 2) und einer C18 - Säule (4,6 x 100 mm 2). Verwenden eines linearen Gradienten von Acetonitril + 0,5% Essigsäure im Bereich von 20% bis 95% in H 2 O + 0,5% Essigsäure (Fließgeschwindigkeit: 0,5 ml min -1).
      HINWEIS: Polyketomycin eine Retentionszeit von 25,9 min hat (siehe Abbildung 1A). Das UV / vis - Spektrum weist Maxima bei 242 nm, 282 nm, 446 nm und Minima bei 262 nm und 359 nm (siehe 1B). Im negativen Modus eine Masse von 863,2 [MH] - nachweisbar ist (siehe Abbildung 1C).

"Src =" / files / ftp_upload / 54952 / 54952fig1.jpg "/>
Abbildung 1: LC / MS - Analyse von Polyketomycin. (A) HPLC - Chromatogramm (λ = 430 nm) des Rohextraktes nach der Kultivierung von Streptomyces diastatochromogenes Tü6028 für 6 Tage. Polyketomycin hat eine Retentionszeit von 25,9 min (B) UV / Vis - Spektren von Polyketomycin. (C) Die Massenspektren von Polyketomycin im negativen Modus. Hauptgipfel mit m / z 863,2 [MH] -. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

  1. Bezeichnung des antibiotische Aktivität Hemmhof - Test unter Verwendung von
    1. Impfen Teststämme wie Gram-positive Bakterien Bacillus subtilis (in LB - Medium LB 20 g, Leitungswasser 1 l, pH 7,4) und andere Stämme Streptomyces (in TSB - Medium; tryptische Sojabrühe 30 g, Leitungswasser 1 L, pH 7.2), Gram-negativen Bakterien Escherichia coli (in LB - Medium) und Pilzstämmen (in Medien wie YPD Medium; Hefeextrakt 10 g, Pepton 20 g Glucose 20 g Leitungswasser 1 l, pH 7,4). Nehmen Sie 100 ul der Teststamm Vorkultur und verteile sie auf entsprechende Agarplatten.
    2. Man löst den Rohextrakt oder gereinigte Verbindung in 500 & mgr; l Methanol (alternativ Wasser oder DMSO) und Pipette 20-50 & mgr; l auf sterile Papierscheiben. Trockene Papierscheiben für 30 min unter der Werkbank und legte sie auf die Platten mit Testkulturen. Bereiten Sie eine Negativkontrolle (Lösungsmittel) und eine positive Kontrolle (Antibiotikum, zB Apramycin [1 mg]).
    3. Inkubieren Sie die Platten unter angemessenen Bedingungen, bis die Teststämme sichtbar geworden sind und Hemmzone bestimmen, wenn offensichtlich. Inkubieren E. coli und Bacillus sp. bei 37 ° C für 16 h, Streptomyces sp. bei 28 ° C für 2-4 Tage, Pilzstamm (in erster Linie abhängig von genauen Teststamm) eint 30 ° C für 2 Tage).

2. Large Scale Extraktion, Reinigung und Strukturaufklärung der Verbindung

  1. Pflegen S. diastatochromogenes in 5 L HA - Medium (Glucose 4 g, Hefeextrakt 4 g, Malzextrakt 10 g Leitungswasser 1 l, pH 7,2). Beimpfen von 2 ml der Vorkultur in 30 x 500 ml-Erlenmeyerkolben, enthaltend 150 ml HA Medium. Inkubiere die Belastung bei 28 ° C für 6 Tage auf einem Rotationsschüttler bei 180 Upm.
  2. Ernten Sie die Zellen durch Zentrifugation (10 min, 15.000 xg, RT) und Extrakt Verbindungen unter Verwendung von Ethylacetat (siehe Abschnitt 1.3).

Figur 2
Abbildung 2: Workflow für Strukturaufklärung. Das Verfahren umfasst (1) Kultivierung des Stammes, (2) Extraktion, (3) Reinigung mittels Festphasenextraktion (SPE), Dünnschichtchromatographie (TLC), präparative Hochleistungs-Flüssigchromatographie (HPLC), sizeexclusion chromatography (SEC) und (4) Strukturaufklärung durch Massenanalyse (MS), kernmagnetische Resonanz (NMR) und Röntgenmessungen. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

  1. Reinigung von Polyketomycin
    HINWEIS: Der Prozess der Reinigung und Strukturaufklärung ist in Abbildung 2 dargestellt.
    1. Fraktionieren Rohextrakt durch eine C18 - Festphasenextraktion (SPE) Säule mit einem 10% -stepwise MeOH - Gradienten im Bereich von 30% bis 100% MeOH in H 2 O, 100 ml für jede Bedingung.
    2. Reinige die Verbindung enthaltende Fraktion weiter durch präparative Dünnschichtchromatographie (TLC) unter Verwendung von 15 CH 2 Cl 2 / MeOH (7: 1) als Elutionssystem.
    3. Reinige die Verbindung durch präparative HPLC 16. Statten das HPLC-System mit einer C18-Vorsäule (5 & mgr; m, 9,4 x 20 mm) und eineHauptsäule (5 & mgr; m, 9,4 x 150 mm). Verwenden eines Gradienten von Acetonitril + 0,5% Essigsäure im Bereich von 20% bis 95% in H 2 O + 0,5% Essigsäure (Fließgeschwindigkeit: 2,0 ml / min).
    4. Lösemittel- und andere kleine Verunreinigungen zu entfernen, führen einen letzten Reinigungsschritt durch Grßenausschlußchromatographie unter Verwendung einer Säule in MeOH 17. Sammeln Sie die letzte reine Verbindung und verdunsten MeOH durch Rotationsverdampfung bei 40 ° C und 240 bar.
  2. Strukturaufklärung
    1. Man löst die reine Verbindung (mehr als 2 mg) in 600 bis 700 & mgr; l (abhängig von der Maschine) von DMSO - d 6, Rekord 1D - NMR (1 H, 13 C) und 2D - NMR (HSQC, HMBC, 1 H- 1 H COSY - Spektren) auf einem NMR - Spektrometer 18 auf . Express - chemischen Verschiebungen in δ - Werten (ppm) unter Verwendung von DMSO - d 6.
    2. Nehmen Sie ein hochauflösendes Massenspektrum (HRESI-MS) 19 von polyketomycin ein hochauflösendes mitMassenspektrometer.
    3. Erläutern die Struktur , die durch die Interpretation der Ergebnisse der NMR- und MS - Datenanalyse 10.

3. Einen Biosynthetisches Modell der neuen isolierten Verbindung

  1. Analysieren der Struktur der isolierten Verbindung und vorherzusagen, Enzyme, die in ihrer Biosynthese beteiligt sein könnten. Ordnen sie Polyketid (Typ I, II oder III), nicht-ribosomale Peptidsynthese, lantipeptide, Terpenoid oder Zucker Stoffwechselweg 8.
  2. Beispiel polyketomycin
    1. Subdivide die Struktur in der Hand einzelne Einheiten: tetracyclic Einheit, zwei Mono- und Dimethyl-Salicylsäure.
    2. Herauszufinden, wo die Reste könnten abgeleitet werden: Die tetracyclischen Rest kann aus einer Polyketidsynthase vom Typ II sowie die Dimethyl- Salicylsäure-Einheit abgeleitet werden kann durch eine iterative Polyketidsynthase Typ I. Die beiden Zuckereinheiten abgeleitet werden, die 6-Desoxyzucker sind könnte, werden SYNTHESIzed von Glucose eine TDP-Glucose-4,6-Dehydratase während der Biosynthese und befestigt wahrscheinlich durch zwei Glycosyltransferasen beteiligt (siehe Abbildung 3) 8.
    3. Vorherzusagen putative Genen im Cluster. Denken Sie an Enzymen, die bei der Synthese der einzelnen Einheiten beteiligt sind, die Einheiten bei der Verbindung sowie bei der Modifizierung und das Molekül zuzuschneiden. Das Gencluster von Polyketomycin höchstwahrscheinlich enthält Gene , die für eine Polyketid - Synthase Typ II (also mindestens ein ACP, KS α und KS β für Verlängerungseinheiten verbindet), ein iterativer Polyketidsynthase- Typ I (mindestens ACP, AT, KS), ein TDP-Glucose-4,6-Dehydratase (notwendig für Schritt: Glucose → Desoxyglucose) und zwei Glycosyltransferasen (Anbringen von zwei Zucker Monomeren dem Aglykon) 8.

Figur 3
Figur 3: Struktur der Polyketomycin Divided in Einzelbausteine. Polyketomycin besteht aus einem tetracyclischen decaketid (PKS vom Typ II) und einer dimethyl Salicylsäure (iterative PKS vom Typ I), verbunden durch die beiden Desoxyzucker Einheiten β-D-amicetose und α-L-axenose (NDP-Glucose-4,6- Dehydratase und zwei Glycosyltransferase erforderlich). Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

4. Genome Sequencing / Bergbau

  1. Next Generation Sequencing
    1. Sequenz , die die genomische DNA durch Sequenzierung der nächsten Generation Technologien wie Illumina, 454 Pyrosequenzierung oder SOLiD 20. Richten Sie einzelne liest zu einer Referenzsequenz oder montieren de novo.
      HINWEIS: Das Genom von S. diastatochromogenes Tü6028 am Zentrum für Biotechnologie (CeBiTec) an der Universität Bielefeld wurde sequenziert. Alle liest wurden zu einem Entwurf Genom zusammengesetztvon 7,9 Mb.
  2. Genome Mining
    1. Suche nach offenen Leserahmen (ORFs) durch die Verwendung von beispielsweise NCBI Prokaryotic Genomannotation Pipeline 21,22, RAST (schnelle Annotation mit Subsystem - Technologie) 23,24,25, Prokka (Rapid prokaryotischen Genomannotation) 26 oder GenDB 27. Diese Programme schlagen auch ihre Funktionen. Die Analyse des S. diastatochromogenes Tü6028 Entwurf Genoms zur Identifizierung von mehr als 7.000 ORFs führte Sequenz.
    2. Führen Sie bestimmte BLAST (Basic Local Alignment Search Tool) Analyse weitere Informationen wie Ausrichtungen mit anderen ähnlichen Genen und katalytischen Domänen 28,29,30 zu erhalten.
    3. Zur Identifizierung des sekundären Metaboliten-Gencluster laufen Programme wie antiSMASH 31,32,33, NaPDoS 34 und NRPSpredictor 35,36. Im Entwurf Genom von Streptomyces diastatochromogenes antiSMASH 31,32,33 Identiziert 22 Gencluster.
    4. Analysieren die putative Gencluster für ihre enzymatischen Weg (s) (Polyketidsynthase (Typ I, II oder III), nicht-ribosomale Peptidsynthetase, lanthipeptide, Terpenoid, Zuckerstoffwechsel, ...). Suchen Sie nach Cluster (n), die Gene, die bei der Synthese der Verbindung beteiligt sein könnten (siehe Abschnitt 3). In S. diastatochromogenes annotierten Cluster 2 enthält Typ Polyketidsynthase II - Gene, drei Polyketidsynthase Typ - I - Gene, ein TDP-Glucose-4,6-Dehydratase Gen und zwei Glycosyltransferase - Gene (siehe Abbildung 4).
    5. Konzentrieren sich auf einzelne Gene innerhalb des Clusters. Für PKS vom Typ I und NRPS die Spezifität der Acyltransferasen und Adenylierungsdomänen und damit den Einbau von Einzelverlängerungseinheiten können vorhergesagt werden. Vergleichen Sie auch die Reihenfolge der eingebauten Erweiterungseinheit mit dem Molekül. antiSMASH 31,32,33 zeigt auch ähnliche Cluster von bereits bekannten Verbindungen, mit einem Link zu MIBiG Datenbank 37. Vergleichen Sie die Struktur der Verbindung mit diesen anderen Verbindungen und prüfen, ob Ähnlichkeiten.

Abbildung 4
Abbildung 4: antiSMASH Ausgabe von Polyketomycin Biosynthesegenclusters und Übersicht von anderen Clustern in S. diastatochromogenes Tü6028. (A) Übersicht über die vorhergesagte Biosynthesegencluster in das Genom von S. diastatochromogenes Tü6028; (B) Cluster 2 Polyketomycin Biosynthesegenclusters mit gezielten Gene. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

5. Prüfung des Biosynthesegenclusters

  1. Suchen Sie nach einem Gen mit der Hand und wichtig (essentielle) Funktionen für die Biosynthese der Verbindung. Zur Überprüfung der polyketomycin Gencluster das Gen pokPI, kodiert für die Ketosynthase- α von der PKS vom Typ II, wurde durch eine aus dem Rahmen -deletion (siehe 5B) ausgewählt und inaktiviert. Alternativ unterbrechen das Gen durch ein internes Fragment Klonen (siehe 5C).

Abbildung 5
Abbildung 5: Überprüfung eines Gen - Cluster von Einzel Crossover. (A) natives Gen führt zur Übersetzung eines funktionellen Proteins; (B) Klonierung des Gens mit interner Deletion in einem Suizidvektor führt zu einem einzigen Crossover was zu einer Rahmenverschiebung in dem Zielgen und anschließende Translation von nicht-funktionellen Proteins; (C) Klonierung eines internen Fragments des Gens in einem Suizidvektor führt zu einer Verkürzung des Gens und anschließende Translation eines nicht-funktionellen Proteins. oriT: Ursprung von transfer; Antibiotikum R: Antibiotika - Resistenz. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

  1. Klonierung des Single-Crossover - Konstrukt
    1. Amplify ein Fragment pokPI durch PCR 38 mit Primern pokPI_for und pokPI_rev enthält.
    2. Clone PCR - Produkts in Suizidvektor pKC1132 39 (Apramycin R [50 mg / mL]). Der Suizid - Vektor nicht in der Lage in dem Streptomyces - Stamm zu replizieren und somit in das Zielgen durch homologe Rekombination zu integrieren Apramycin-Widerstand bereitzustellen. Übertragen des Vektors in E. coli Klonen Wirt durch Hitzeschock Transformation 40.
    3. Isolieren Sie den Vektor durch alkalische Lyse 41.
    4. Digest die Vektor-DNA mit einem einzigen Messerrestriktionsenzym, das innerhalb des Fragments schneidet. Die pokPI gene wurde verdaut mit Enzym KpnI
    5. Behandle verdauten Vektor DNA mit großer DNA-Polymerase I (Klenow) -Fragment, das 5 weist '→ 3'-Polymerase-Aktivität und 3' → 5'-Exonuklease-Aktivität. Abstumpfung der klebrigen Enden und anschließende Religation führt zum Verlust von vier Basen. Prüfen , für den Verlust dieser Basen durch die Schritte der Transformation in E. coli XL1 Blue, einzelne Kolonien Kommissionieren, Isolieren ihrer Plasmid DNA, 41 und die Analyse weiter durch Restriktionsverdau und Sequenzierung.
  2. Die Konjugation des Single-Crossover - Konstrukt in Streptomyces
    1. Übertragen Sie den Suizidvektor der pokPI Gen (pKC1132_ pokPI del) mit einer Deletion in E. coli ET12567 pUZ8002 42 (Kanamycin R) durch Hitzeschock Transformation 40 enthält. Inkubieren Sie die Zellen in 100 ml LB - Medium (Kanamycin 50 ug mL -1, Apramycin 50 ug mL -1
    2. Mischen Sie 500 ul E. coli pUZ8002 pKC1132_ pokPI del mit 500 & mgr; l Streptomyces diastatochromogenes Kultur (alternativ Sporen verwenden). Verbreiten Sie die Mischung auf MS - Platten (Sojamehl 20 g, D-Mannit 20 g, MgCl 2 10 mM, Agar 1,5%, Wasser 1 L tippen). Inkubieren der Platten für 20 h bei 28 ° C.
    3. Overlay jede Platte mit Apramycin (1,25 mg) und Fosfomycin (5 mg) in 1 ml Wasser gelöst und trocknen lassen. Inkubieren der Platten für mehrere Tage bei 28 ° C bis Exkonjuganten sichtbar sind.
  3. Überprüfen Sie Single-Crossover - Mutanten
    1. Impfen einzelne Exconjuganten in 20 ml TSB - Medium (Apramycin 50 mg mL -1) und inkubieren bei 28 ° C für drei Tage und 180 Umdrehungen pro Minute.
    2. Isolieren Sie genomische DNA 43 und überprüfen Unterbrechung des pokPI - Gens durch PCR.
    3. Impfen einzelne Klone mit verifizierten Gen Unterbrechung und Streptomyces Wildtypstamm in 100 ml HA Medium und Inkubation sie für 6 Tage bei 28 ° C und 180 Umdrehungen pro Minute. Extrahieren Sie den Rohextrakt (siehe Abschnitt 1.3). Überprüfen Sie Verbindung Produktion von HPLC-MS-Analyse (siehe Abschnitt 1.4). Der entsprechende Peak im HPLC - Chromatogramm und die Masse der Verbindung nicht nachweisbar sein sollten nicht mehr (siehe Abbildung 6).

Figur 6
Abbildung 6: HPLC - Analyse von S. diastatochromogenes mit inaktivierten pokPI Gene. HPLC - Chromatogramm (λ = 430 nm) Rohextrakt von S. diastatochromogenes WT (oben) und mutierten Stamm mit unterbrochen pokPI -Gen (unten). Der Mutantenstamm produziert nicht mehr polyketomycin.Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Representative Results

In dieser Übersicht beschreiben wir die einzelnen Schritte von der Identifizierung eines Antibiotikums zu seinem Biosynthesegenclusters führt. Vor vielen Jahren wir eine Cosmid - Bibliothek geklont, um sie in Phagen verpackt transduzierten Wirtszellen E. coli, und hatte tausende von Kolonien zu screenen , um die Klone zu identifizieren , mit überlappenden Regionen polyketomycin Cluster. Sequenzierung der Cosmide wurde auch ein schwieriger und teurer Prozess 12.

Um weitere Studien zur Belastung zu führen sequenziert wir das gesamte Genom von Streptomyces diastatochromogenes Tü6028. Mit dem Entwurf des Genomsequenz leicht identifiziert wir das Gencluster von polyketomycin und anderen Clustern kodieren, viel versprechende Verbindungen. 7 vergleicht die "alte" Methode der Biosynthese - Cluster durch Klonierung einer Cosmid - Bibliothek und elaborative Screening identifiziert unddie "neue" Verfahren durch Sequenzierung ganzer Genome mit anschließender Genom-Mining auf einer rauhen Zeitskala. Die neuen Sequenzierungstechnologien und neue Genom-Mining-Programme beschleunigen den gesamten Prozess.

7
Abbildung 7: Vergleich der "alten" und "neuen" Verfahren zur Herstellung eines Biosynthesegenclusters zuordnen. Die "alte" Verfahren umfasst Klonierung einer Cosmid-Bibliothek mit der Auswahl von positiven Klonen und Sequenzieren des entsprechenden Cosmids (n) (oben); Die "neue" Verfahren umfasst gesamte Genomsequenzierung und -mining alle sekundären Metaboliten Genclustern auf dem Genom des Stammes (unten) gelegen zu identifizieren. Dauer der einzelnen Schritte werden auf einer groben Zeitskala gezeigt. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Discussion

In diesem Labor wurde eine genomische Cosmid - Bibliothek von Streptomyces diastatochromogenes erzeugt und abgeschirmt vor vielen Jahren, was zur Identifizierung des polyketomycin Gencluster durch ein extrem zeitaufwändiger Prozess. Charakterisierung einzelner Gene möglich waren Zielgen Deletionen unter Verwendung und Analyse der resultierenden Mutanten 12. Vor kurzem wurde ein Entwurf Genomsequenz von S. diastatochromogenes erhalten die schnelle Identifizierung des polyketomycin Biosynthesegenclusters ermöglicht. Wir könnten die Biosynthesegene leicht erkennen, obwohl der Entwurf Genomsequenz noch viele contigs enthält. Das beschriebene Verfahren kann innerhalb von Monaten erreicht werden. Jedoch umfaßt das Verfahren viele Schritte. Einzelne Schritte können mehrmals fehlschlagen, das Fortschreiten zu den nachfolgenden Schritten zu verhindern:

Die Gattung Streptomyces ist bekannt für seine Fähigkeit bioaktiven Verbindungen herzustellen. Während sie tragen oft mehr als 20 BIOSynthetic Gencluster, in der Regel nur eine oder zwei Verbindungen, die unter Laborbedingungen hergestellt werden. Die Anwendung des OSMAC Ansatz (Kultivierung eines Stamms unter verschiedenen Bedingungen) stillen Gencluster aufwachen kann manchmal nicht genug sein. Genetische Manipulation von regulatorischen Genen, wie beispielsweise die pleiotrope Regulatorgene ADPA 44 und BLDA 45,46, ist auch eine wirksame Methode , um die Produktion von anderen Sekundärmetaboliten zu aktivieren.

Für die Aufklärung der Struktur der Verbindung, beispielsweise durch NMR - Analyse, in der Regel mehr als 2 mg gereinigte Verbindung notwendig ist . Daher Fermentation von mehr als 10 L-Kultur ist oft erforderlich. Ohne einen Fermenter, die Sauerstoff, pH und Temperaturbedingungen in der Lage zu halten, kann es in einem kleinen Labor schwierig sein, diese Menge an Kultur und anschließende Extraktion zu handhaben. Während der Reinigung kann die Verbindung aufgrund von Oxidation, Strahlung oder Temperatur verändert.Auch sind die mehreren Reinigungsschritten, desto höher ist die Wahrscheinlichkeit der Verschlechterung verwendet.

Wenn die Struktur des Naturstoffs zu untersuchen und die Cluster im Genom, manchmal ist es nicht so einfach, die entsprechenden Cluster zu identifizieren. Erstens, wenn es nur einen Entwurf Genomsequenz ein Teil des Clusters möglicherweise fehlt ist. Zweitens sind nicht alle Gene, die für die Biosynthese erforderlich sind, sind in dem Cluster. Drittens wird manchmal ein Cluster in zwei Teile voneinander von vielen Kilobasen getrennt gespalten. Viertens kann es schwierig sein, zu entscheiden, welches das entsprechende Gen-Cluster ist. Bei großen PKS vom Typ I oder NRPS-Systemen, wo es möglich ist, die Anzahl der Verlängerungseinheiten basierend auf der Anzahl von Modulen oder sogar identifizieren die einzelnen Verlängerungseinheiten durch Analyse der Auswahl Domänen zu berechnen, stellt sich leicht auf. Jedoch im Fall der iterativ arbeitEnzymen die Vorhersage der synthetisierten Verbindungen oft nicht möglich ist, insbesondere wenn die Strain mehr als 40 Gencluster. Fünftens ist die Natur sehr komplex und voller noch unbekannte Verbindungen. Oft ist die Biosynthese ist eine Mischung von verschiedenen Wegen. Wenn die neue Verbindung noch nicht identifiziert worden ist, oder nicht in eine andere Verbindung im Zusammenhang, kann es schwierig sein, den Cluster zu identifizieren, eine Biosynthese Modell vorzuschlagen, und um es zu beweisen.

Sobald der Cluster identifiziert wird, ist die einzige Crossover-Technik eine gute und schnelle Methode, um die Hypothese zu überprüfen. PCR, Klonierung in einen Suizidvektor, Konjugation, Auswahl von positiven Klonen und die Produktion Test sind die einzigen Schritte erforderlich. Ein Nachteil dieser Technik ist, dass die Integration des Vektors in das Chromosom nicht stabil ist durch weitere Rekombinationsereignisse. Deshalb, um einzelne Gene, präzise Gendeletionen weiter zu analysieren sind erforderlich. Auch kann es schwierig sein , Streptomyces - Stämmen auf der genetischen Ebene zu manipulieren.

Die beschriebene Vorgehensweise kann t zugeordnet werdeno andere Verbindung , die durch einen Streptomyces - Stamm oder einem anderen Mikroorganismus hergestellt. Das Wissen über ein Gencluster und seine synthetisierte Verbindung gibt uns weitere Möglichkeiten zu modifizieren bereits bestehenden Moleküle mit dem Ziel, sie für den Kampf gegen multiresistente Erreger zu verbessern.

Materials

Name Company Catalog Number Comments
agar Carl Roth GmbH + Co. KG, Karlsruhe, Germany 5210.4
agarose Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6352.4
D-mannitol  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4175.1
glucose  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6780.1
LB  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X964.3
malt extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X976.2
MgCl2 Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2189.1
Peptone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany
soy flour  W.Schoenemberger GmbH, Magstadt, Germany Hensec-Vollsoja
tryptic soy broth Carl Roth GmbH + Co. KG, Karlsruhe, Germany X938.3 Caso-Bouillon
yeast extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2363.2
Solvents
Acetic acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 3738.5
Acetone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 9372.2
Acetonitrile Avantor Performance Materials B.V., Deventer, The Netherlands JT-9012-03
Dichlorofrom  Fisher Scientific GmbH, Schwerte, Germany 1530754
DMSO (Dimethyl sulfoxide) Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4720.1
DMSO-d6 (Dimethyl sulfoxide-d6) 99.9 atom% D ARMAR Chemicals, Döttingen, Switzerland 15200.204
Ethyl acetate Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6784.4
Hydrochloric acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6331.4
Methanol Carl Roth GmbH + Co. KG, Karlsruhe, Germany 7342.1
Enzymes
restriction enzymes New England Biolabs GmbH, Frankfurt am Main, Germany
polymerase  New England Biolabs GmbH, Frankfurt am Main, Germany
DNA Polymerase I Large (Klenow) Fragment Promega GmbH, Mannheim, Germany
Antibiotics
apramycin AppliChem GmbH, Darmstadt, Germany  A7682.0005
fosfomycin Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany P5396-50G
kanamycin Carl Roth GmbH + Co. KG, Karlsruhe, Germany T832.2
Plasmid/Vectors
pKC1132 Bierman et al. 1992
Primer 
pokPI_for TGATGGTGCCGCTGGCCATGG Primer to amplify fragment containing pokPI gene
pokPI_rev AGCGTTCACTGTTCCGCCCGAC
Bacterial strains
Bacillus subtilis COHN ATCC6051 Gram-positive test strain 
Escherichia coli ET12567 pUZ8002  MacNeil et al. 1992 strain for conjugation
Escherichia coli XL1 Blue Agilient Technologies, Santa Clara, USA Gram-negative test strain + cloning host 
Streptomyces diastatochromogenes Tü6028 Paululat et al., 1999 Polyketomycin producer
Online services
antismash (Antibiotics and Secondary Metabolite Analysis Shell) http://antismash.secondarymetabolites.org/ Detection of secondary metabolite gene cluster
BLAST (Basic Local Alignment Search Tool) http://blast.ncbi.nlm.nih.gov/Blast.cgi finds regions of similarity between biological sequences
GenDB https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb Annotation of ORFs 
MiBIG (Minimum Information about a Biosynthetic Gene cluster) http://mibig.secondarymetabolites.org/ Database of biosyntetic gene clusters
NaPDoS http://napdos.ucsd.edu/ Detection of seconary metabolite gene cluster
NCBI Prokaryotic Genome Annotation Pipeline http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ Annotation of ORFs 
NRPSpredictor http://nrps.informatik.uni-tuebingen.de/ Detection of NRPS domains
Prokka (rapid prokaryotic genome annotation) http://www.vicbioinformatics.com/software.prokka.shtml Annotation of ORFs 
RAST (rapid annotation using subsystems technology) http://rast.nmpdr.org/ Annotation of ORFs 
Other programs
Chem Station Rev. A.09.03 Agilent Technologies, Waldbronn, Germany Handling program for HPLC 
Clone Manager Suite 7 Scientific and Educational Software, Cary, USA Designing Cloning Experiment 
Newbler v2.8 Roche Diagnostics Alignment of sequencing reads
Machines 
Centrifuge Avanti J-6000, Rotor JA-10 Beckman Coulter GmbH, Krefeld, Germany
HPLC/MS Agilent Technologies, Waldbronn, Germany
_Autosampler: G1313A Agilent Technologies, Waldbronn, Germany
_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 µm) Agilent Technologies, Waldbronn, Germany
_Column:Xbridge C18 (100 mm × 4.6 mm; Particle size: 3.5 μm) Agilent Technologies, Waldbronn, Germany
_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_Degasser: G1322A  Agilent Technologies, Waldbronn, Germany
_Quarternary pump: G1311A Agilent Technologies, Waldbronn, Germany
_Diode array detector (DAD )G1315B (λ = 254 nm and 400 nm) Agilent Technologies, Waldbronn, Germany
_Quadrupole mass detector (MSD) G1946D(2-3000 m/z) Agilent Technologies, Waldbronn, Germany
rotary evaporator
_heating bath Hei-VAP Value/G3 Heidolph Instruments GmbH & Co.KG, Schwabach, Germany
_vacuum pump system SC 920 G KNF Global Strategies AG, Sursee, Switzerland
Other material
Sephadex LH20 GE Healthcare, 
Chromafil PVDF-45/15MS (pore size 0.45 µm; filter Ø15 mm) MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany
SPE column Oasis HLB 20 35 cc (6g) Waters GmbH, Eschborn, Germany 
E. coli  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Bacillus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Streptomyces sp. Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g
for agar plates add 2% agar

DOWNLOAD MATERIALS LIST

References

  1. Fleming, A. On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae. Br J Exp Pathol. 10, (3), 226-236 (1929).
  2. Lemke, A., Kiderlen, A. F., Kayser, O. Amphotericin B. Appl. Microbiol. Biotechnol. 68, (2), 151-162 (2005).
  3. Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. Daptomycin. Nat. Rev. Drug Discov. 2, (12), 943-944 (2003).
  4. Zakeri, B., Wright, G. D. Chemical biology of tetracycline antibiotics. Biochem. cell Biol. 86, (2), 124-136 (2008).
  5. Schatz, A., Bugle, E., Waksman, S. A. Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria. Exp. Biol. Med. 55, (1), 66-69 (1944).
  6. Burg, R. W., et al. Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob. Agents Chemother. 15, (3), 361-367 (1979).
  7. Egerton, J. R., Ostlind, D. A., et al. Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component. Antimicrob. Agents Chemother. 15, (3), 372-378 (1979).
  8. Walsh, C. T., Fischbach, M. A. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132, (8), 2469-2493 (2010).
  9. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination. J. Antibiot. (Tokyo). 51, (1), 26-32 (1998).
  10. Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.Tü6028. J. Antibiot. (Tokyo). 52, (2), 96-101 (1999).
  11. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities. J. Antibiot. (Tokyo). 51, (1), 21-25 (1998).
  12. Daum, M., et al. Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin. Chembiochem. 10, (6), 1073-1083 (2009).
  13. Bode, H. B., Bethe, B., Höfs, R., Zeeck, A. Big effects from small changes: possible ways to explore nature's chemical diversity. Chembiochem. 3, (7), 619-627 (2002).
  14. Wolfender, J. -L. HPLC in Natural Product Analysis: The Detection Issue. Planta Med. 75, (07), 719-734 (2009).
  15. Stahl, E. Thin-layer chromatography. A laboratory handbook. 2nd edition (1967).
  16. Snyder, L. R., Kirkland, J. J., Glajch, J. L. Preparative HPLC Separation. Pract. HPLC Method Dev. 616-642 (2012).
  17. Granath, K. A., Kvist, B. E. Molecular weight distribution analysis by gel chromatography on sephadex. J. Chromatogr. A. 28, 69-81 (1967).
  18. Jackman, L. M., Sternhell, S. Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry. Int. Ser. Org. Chem. (1969).
  19. Xian, F., Hendrickson, C. L., Marshall, A. G. High resolution mass spectrometry. Anal. Chem. 84, (2), 708-719 (2012).
  20. Metzker, M. L. Sequencing technologies - the next generation. Nat. Rev. Genet. 11, (1), 31-46 (2010).
  21. Tatusova, T., et al. Prokaryotic Genome Annotation Pipeline. NCBI Handb. 2nd Ed. (2013).
  22. Angiuoli, S. V., et al. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation. OMICS. 12, (2), 137-141 (2008).
  23. Aziz, R. K., et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 9, 75 (2008).
  24. Overbeek, R., et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 42, 206-214 (2014).
  25. Brettin, T., et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 5, 8365 (2015).
  26. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 30, (14), 2068-2069 (2014).
  27. Meyer, F. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 31, (8), 2187-2195 (2003).
  28. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, (3), 403-410 (1990).
  29. Madden, T. The BLAST Sequence Analysis Tool. NCBI Handb. 2nd Ed. Chapter 16 (2003).
  30. Marchler-Bauer, A., et al. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, (Database issue) 222-226 (2014).
  31. Medema, M. H., et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, (Web Server issue) 339-346 (2011).
  32. Blin, K., et al. antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 41, (Web Server issue) 204-212 (2013).
  33. Weber, T., et al. antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, (W1) 237-243 (2015).
  34. Ziemert, N., et al. The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity. PLoS One. 7, (3), 34064 (2012).
  35. Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res. 33, (18), 5799-5808 (2005).
  36. Röttig, M., et al. NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39, (Web Server issue) 362-367 (2011).
  37. Medema, M. H., et al. Minimum Information about a Biosynthetic Gene cluster. Nat. Chem. Biol. 11, (9), 625-631 (2015).
  38. Mullis, K., et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51, Pt 1 263-273 (1986).
  39. Bierman, M., et al. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 116, (1), 43-49 (1992).
  40. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli.using the heat shock method. J. Vis. Exp. (6), e253 (2007).
  41. Bimboim, H. C., Doly, J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, (6), 1513-1523 (1979).
  42. MacNeil, D. J., et al. Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector. Gene. 111, (1), 61-68 (1992).
  43. Pospiech, A., Neumann, B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet. 11, (6), 217-218 (1995).
  44. Makitrynskyy, R., et al. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin. Open Biol. 3, (10), 130121 (2013).
  45. Kalan, L., et al. A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene. Chem. Biol. 20, (10), 1214-1224 (2013).
  46. Gessner, A., et al. Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains. ChemBioChem. 16, (15), 2244-2252 (2015).
Von einem natürlichen Produkt in seine Biosynthesegenclusters: Eine Demonstration Mit Polyketomycin aus<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).More

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter