Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

ממוצר טבעי כדי המצרר שלו biosynthetic ג'ין: הפגנה שימוש Polyketomycin מ doi: 10.3791/54952 Published: January 13, 2017

Summary

כאן אנו מציגים פרוטוקול מפורט של (א) זיהוי של מוצר טבעי עם פעילות אנטיביוטית, (B) הטיהור של המתחם, (ג) את הדגם הראשון של ביוסינתזה שלה, (ד) הגנום רצף / -mining ואת ( E) אימות של אשכול גני biosynthetic.

Abstract

זני Streptomyces ידועים היכולת שלהם לייצר הרבה תרכובות שונות עם bioactivities השונה. טיפוח בתנאים שונים לעתים קרובות מוביל לייצור תרכובות חדשות. לכן, תרבויות הייצור של זנים המחולצים עם אתיל אצטט ואת תמציות גולמי מנותחים על ידי HPLC. יתר על כן, תמציות נבדקי הפעילות הביולוגית שלהם על ידי מבחנים שונים. לקבלת הבהרת מבנה במתחם העניין מטוהר על ידי שילוב של שיטות כרומטוגרפיה שונות.

הגנום רצף בשילוב עם כריית הגנום מאפשר זיהוי של אשכול גני biosynthetic מוצר טבעי באמצעות תוכנות מחשב שונות. כדי לאשר כי באשכול הגנים הנכון זוהה, ניסויי איון גן צריכות להתבצע. המוטציות כתוצאה מנותחות לייצור המוצר הטבעי בפרט. לאחר באשכול הגן התקין כבר מומת, אתזן ייכשל כדי לייצר את המתחם.

זרימת העבודה מוצגת עבור polyketomycin מתחם אנטיבקטריאלי המיוצר על ידי Streptomyces diastatochromogenes Tü6028. לפני כעשר שנים, כאשר רצף הגנום היה עדיין מאוד יקר, השיבוט וזיהוי אשכול גנים היה זמן רב בתהליך מאוד. רצף הגנום מהיר בשילוב עם כריית הגנום מאיץ את משפטו של זיהוי אשכול ופותח דרכים חדשות לחקור ביוסינתזה לייצר מוצרים טבעיים רומן מאת בשיטות גנטיות. הפרוטוקול המתואר במאמר זה ניתן להקצות כל תרכובת אחרת שמקורו בזן Streptomyces או מיקרואורגניזם אחר.

Introduction

מוצרים טבעיים מצמחים ומיקרואורגניזמים תמיד היו מקור חשוב לפיתוח קליני של תרופה ומחקר. הפניצילין האנטיביוטי הראשון התגלה בשנת 1928 מפטרייה ידי אלכסנדר פלמינג 1. כיום, רבי מוצרים טבעיים יותר משמשים בטיפול קליני.

סוג אחת ידוע ביכולתה לייצר סוגים שונים של מטבוליטים משניים עם bioactivities השונה הוא Streptomyces. Streptomyces הם גראם חיוביים חיידקים שייכים למעמד של Actinobacteria וצו Actinomycetales. כמעט שני שלישים של אנטיביוטיקה בשימוש קליני נגזרות Actinomycetales, בעיקר Streptomyces, כמו amphotericin 2, daptomycin 3 או 4 טטרציקלין. שני פרסי נובל הוענקו בתחום המחקר אנטיביוטי Streptomyces. הראשון הלך זלמן אברהם וקסמן על גילוי סטרפטומיצין, היווצרותו הראשונהtibiotic יעיל נגד שחפת. 5 בשנת 2015, כחלק פרס נובל לפיזיולוגיה ורפואה, גילוי avermectin מ avermitilis ס הוענק גם כן. Avermectin משמש לטיפול במחלות טפיליות 6,7.

הגישה המסורתית על הגילוי של מוצרים טבעיים מיקרואורגניזמים כגון Streptomyces בדרך כלל כרוך טיפוח של הזן בתנאי גידול שונה, כמו גם מיצוי וניתוח של מטבוליטים משניים. מבחני פעילות ביולוגיים (מבחנים למשל לפעילות אנטיבקטריאלי נגד סרטן) מבוצעים על מנת לזהות את הפעילות של המתחם. לבסוף, במתחם של עניין מבודד ואת המבנה הכימי הוא הובהר.

המבנים של מוצרים טבעיים מורכבים לרוב moieties היחיד אשר יוצרים מולקולות מורכבות. יש כמה, אבל מוגבלים, שבילי biosynthetic גדולים מובילים לבניית גושKS, אשר משמש ביוסינתזה של חומרי טבע. מסלולי biosynthetic העיקריים הם נתיבי polyketide, שבילים מובילים אל terpenoids ו אלקלואידים, מסלולים באמצעות חומצות אמינו, ושבילים מובילים moieties סוכר. מסלול כל מאופיין על ידי קבוצה של אנזימים ספציפיים 8. בהתבסס על המבנה של המתחם, אנזימים biosynthetic אלה ניתן לחזות.

כיום, ניתוח המבנים המפורט של תרכובת בשילוב עם רצף הדור הבא וניתוח bioinformatic יכול לעזור לזהות באשכול גני biosynthetic האחראי. מידע האשכול פותח דרכים חדשות למחקר מוצר טבעי נוסף. זה כולל ביטוי Heterologous כדי להגדיל את התשואה של המוצר הטבעי, שינוי במתחם ממוקד על ידי מחיקת הגן או שינוי וביוסינטזה קומבינטורית עם גנים של מסלולים אחרים.

Polyketomycin היה מבודד באופן עצמאי מן מרק התרבותשני זנים, sp Streptomyces. MK277-AF1 9 ו Streptomyces diastatochromogenes Tü6028 10. המבנה הוברר על ידי ניתוח NMR ו- X-ray. Polyketomycin מורכב decaketid tetracyclic וכן חומצה סליצילית דימתיל, מקושרים על ידי שני moieties deoxysugar β-D-amicetose ו α-L-axenose. הוא מציג ציטוטוקסיות פעילות אנטיביוטית, אפילו כנגד זנים עמידים multidrug גראם חיוביים כגון MRSA 11.

ספריית cosmid הגנומי של Tü6028 diastatochromogenes ס נוצרה והוקרנה לפני שנים רבות. באמצעות גן ספציפי בדיקות באשכול גני polyketomycin עם גודל של 52.2 kb, המכיל 41 גנים, זוהה לאחר מספר חודשים של עבודה אינטנסיבית 12. לאחרונה, רצף הגנום טיוטת diastatochromogenes ס הושג מוביל לזיהוי המהיר של אשכול גני biosynthetic polyketomycin. בסקירה זו, שיטה עוזרת iDENתצדיק מוצר טבעי להבהיר באשכול גני biosynthetic שלה יתואר, באמצעות polyketomycin כדוגמא.

נסביר את הצעדים יחידים אשר להוביל ממוצר טבעי באשכול גני biosynthetic שבו, המופיע על polyketomycin המיוצר על ידי Streptomyces diastatochromogenes Tü6028. הפרוטוקול כולל זיהוי וטיהור מוצר טבעי עם תכונות אנטיביוטיות. ניתוח והשוואה מבניים נוספים עם תוצאות החל להוביל כרייה הגנום לזיהוי באשכול גני biosynthetic. הליך זה יכול להיות מיושם על כל מתחם אחר שמקורו בזן Streptomyces או כל מיקרואורגניזם אחר.

Protocol

זיהוי 1. של מוצר טבעי עם אנטיביוטי נכס

  1. טפח את מיקרואורגניזם בתנאים שונים (למשל זמן, טמפרטורה, pH, מדיה) בעקבות "OSMAC (אחד תרכובות זן-רבות) הגישה" 13. בחר בינוני אחד שבו הייצור של תרכובת הוא ציין.
  2. טפחו Streptomyces diastatochromogenes Tü6028 בתנאים הבאים
    1. לגדול זן Tü6026 diastatochromogenes Streptomyces על צלחות MS (קמח סויה 20 גר ', D-מניטול 20 גרם, MgCl 2 10 מ"מ, אגר 1.5%, ברז מים 1 ליטר). לחסן לולאה קטנה של נבגים של זן זה לתוך 20 בינוני TSB נוזל מ"ל (ז 30 מרק סויה tryptic, ברז מים 1 ליטר, pH 7.2; בינוני preculture) בתוך הבקבוק Erlenmeyer עם ספירלה. לנער את הבקבוק על שייקר רוטרי (28 ° C, 180 סל"ד, 2 ימים).
    2. לחסן תרבות עיקרית 100 בינוני המ"ל HA (גרם גלוקוז 4, תמצית שמרים 4 גרם, מאלטלחלץ 10 גרם, ברז מים 1 ליטר, pH 7.2) עם 2 מ"ל של preculture. תרבות הזן ב 28 מעלות צלזיוס במשך 6 ימים על שייקר רוטרי ב 180 סל"ד.
  3. הכנת התמצית הגולמית
    1. קציר תאים על ידי צנטריפוגה (10 דקות, 3000 XG).
    2. לקבלת השלבים הבאים להתמודד עם ממיסים אורגניים תחת במנדף.
    3. להפקת מתחם מן התפטיר, תאי resuspend בנפח כפול של אצטון ולנער בתוך שפופרת למשך 30 דקות, 180 סל"ד. סנן את הנוזל דרך נייר סינון מסחרי להתאדות אצטון ידי מאייד רוטרי ב 40 ° C ו 550 בר. ממיסים את תמצית ב 20 מ"ל מים: אתיל אצטט (1: 1) ולנער אותו משפך מפריד למשך 30 דקות ב 180 סל"ד.
    4. להפקת מתחם ממדיום התרבות, להתאים את מרק תרבות 4.0 pH על ידי תוספת של 1 M HCl. הוספת 100 אתיל אצטט מ"ל ולנער אותו משפך מפריד למשך 30 דקות, 180 סל"ד.
    5. אסוף שלב אתיל אצטט להתאדות על ידי ריקבון אידוי האר"י ב 40 ° C ו 240 בר.
  4. ניתוח של התמצית הגולמית ידי HPLC
    1. ממיסים את תמציות ב 1 מ"ל MeOH, לסנן אותם דרך פילטר בגודל 0.45 מיקרומטר הנקבוביות ולהפעיל כרומטוגרפיה נוזלית בעל ביצועים גבוהים (HPLC) 14.
    2. במקרה של polyketomycin, לצייד את המערכת HPLC עם precolumn C18 (4.6 x 20 מ"מ 2) ו טור C18 (4.6 x 100 מ"מ 2). השתמש שיפוע ליניארית של אצטוניטריל + 0.5% חומצה אצטית הנעים בין 20% ל -95% ב H 2 O + 0.5% חומצה אצטית (קצב הזרימה: 0.5 מ"ל דקות -1).
      הערה: Polyketomycin יש זמן שמירה של 25.9 דק '(ראה איור 1 א). את UV / VIS הספקטרום יש מקסימום ב 242 ננומטר, 282 ננומטר, 446 ננומטר ומינימום ב 262 ננומטר ו 359 ננומטר (ראה איור 1B). בשנת המודוס שלילית מסה של 863.2 [MH] - ניתן לזהות (ראה תרשים 1C).

"Src =" / files / ftp_upload / 54,952 / 54952fig1.jpg "/>
איור 1: LC / MS ניתוח של Polyketomycin. (א) chromatogram HPLC (λ = 430 ננומטר) של התמצית הגולמית לאחר הטיפוח של diastatochromogenes Tü6028 Streptomyces במשך 6 ימים. יש Polyketomycin זמן השמירה של 25.9 דק '(B) UV / VIS ספקטרום של Polyketomycin. (C) Mass ספקטרום של Polyketomycin ב המודוס השלילי. שיא ראשי עם m / z 863.2 [MH] -. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

  1. זיהוי של הפעילות האנטיביוטיה באמצעות assay דיפוזיה הדיסק
    1. לחסן זנים מבחן כמו subtilis Bacillus חיידקים גראם חיוביים (במדיום LB; LB 20 גרם, ברז מים 1 ליטר, pH 7.4) ו זנים Streptomyces אחרים (במדיום TSB; מרק סויה tryptic 30 גרם, ברז מים 1 ליטר, pH 7.2), חיידקים גראם שליליים Escherichia coli (במדיום LB) ו זני הפטריות (ב מדיה כגון בינוני YPD; תמצית שמרים 10 גרם, 20 גרם peptone, גלוקוז 20 גרם, ברז מים 1 ליטר, pH 7.4). קח 100 μL של preculture מבחן הזן ולהפיץ אותם על צלחות אגרו בהתאמה.
    2. ממס את התמצית הגולמית או תרכובת מטוהרת 500 μL של מתנול (לחלופין מים או DMSO) ו פיפטה 20-50 μL על גבי דיסקי נייר סטרילי. דיסקי נייר יבשים למשך 30 דקות מתחת לספסל העבודה ולשים אותם לצלחות עם תרבויות מבחן. כן בקרה שלילית (ממס) ו כביקורת חיובית (אנטיביוטיקה, למשל apramycin [1 מ"ג]).
    3. דגירת הצלחות בתנאים נאותים עד זני המבחן גדלים בעליל ולקבוע אזור עיכוב, אם לכאורה. דגירה E. coli ו sp Bacillus. ב 37 מעלות צלזיוס למשך 16 שעות, sp Streptomyces. ב 28 מעלות צלזיוס במשך 2-4 ימים, זן פטרייתי (בעיקר תלוי זן מבחן מדויק) אt 30 מעלות צלזיוס למשך 2 ימים).

2. הפקה בקנה מידה גדולה, טיהור ומבנה המבהיר במגרש

  1. טפחו diastatochromogenes ס ב 5 L בינוני HA (גרם גלוקוז 4, גרם שמרים תמצית 4, גרם מאלט לחלץ 10, מי ברז 1 L, pH 7.2). לחסן 2 מ"ל של preculture ב 30 x 500 צלוחיות מ"ל Erlenmeyer המכיל 150 בינוני מ"ל HA. דגירת הזן ב 28 מעלות צלזיוס במשך 6 ימים על שייקר רוטרי ב 180 סל"ד.
  2. קציר תאים על ידי צנטריפוגה (10 דקות, 15,000 XG, RT) ותרכובות לחלץ באמצעות אתיל אצטט (ראה סעיף 1.3).

איור 2
איור 2: Workflow עבור מבנה הבהרות. התהליך מורכב (1) טיפוח של זן, (2) מיצוי, (3) טיהור ידי מיצוי שלב מוצק (SPE), כרומטוגרפיה בשכבה דקה (TLC), כרומטוגרפיה נוזלית בעל ביצועים גבוהים preparative (HPLC), גודלכרומטוגרפיה הדרה (SEC) ו- (4) הבהרת מבנה על ידי ניתוח מסה (MS), תהודה מגנטית גרעינית (NMR) ומדידות רנטגן. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

  1. טיהור Polyketomycin
    הערה: תהליך הבהרת טיהור ומבנה מוצג באיור 2.
    1. Fractionate לחלץ גולמי על ידי מיצוי שלב מוצק C18 (SPE) עמודה באמצעות 10% שיפוע MeOH -stepwise הנעים בין 30% ל -100% MeOH ב H 2 O, 100 מ"ל עבור כל תנאי.
    2. לטהר את השבר המכילים תרכובת עוד יותר על ידי כרומטוגרפיה בשכבה דקה preparative (TLC) 15 CH באמצעות 2 Cl 2 / MeOH (7: 1) כמערכת elution.
    3. לטהר את המתחם על ידי preparative HPLC 16. לצייד את המערכת HPLC עם precolumn C18 (5 מיקרומטר; 9.4 x 20 מ"מ)טור מרכזי (5 מיקרומטר; 9.4 x 150 מ"מ). השתמש שיפוע של אצטוניטריל + 0.5% חומצה אצטית הנעים בין 20% ל -95% ב H 2 O + 0.5% חומצה אצטית (קצב זרימה: 2.0 mL / min).
    4. כדי להסיר ממסי זיהומים קטנים אחרים, לביצוע שלב טיהור אחרון על ידי כרומטוגרפיה הדרה גודל באמצעות טור ב MeOH 17. אסוף במתחם הטהור הסופי להתאדות MeOH ידי אידוי סיבובי ב 40 ° C ו 240 בר.
  2. הבהרת מבנה
    1. ממיסים את תרכובת טהורה (יותר מ -2 מ"ג) ב 600-700 μL (תלוי במכונה) של DMSO- ד 6, שיא 1D תמ"ג (1 H, 13 C) ו 2D NMR (HSQC, HMBC, 1 H- 1 H ספקטרום COSY) על ספקטרומטר תמ"ג 18. אין מהיר משמרות כימיות בערכי δ (ppm) באמצעות DMSO- ד 6.
    2. קלט ספקטרום המוני ברזולוציה גבוהה (HRESI-MS) 19 של polyketomycin באמצעות ברזולוציה גבוההספקטרומטר מסה.
    3. להבהיר את המבנה על ידי הפרשנות של התוצאות של ניתוח נתוני תמ"ג ו- MS 10.

3. הצע biosynthetic דגם של המתחם החדש מבודד

  1. לנתח את המבנה של המתחם מבודד ולחזות אנזימים, העשויים להיות מעורבים ביוסינתזה שלה. להקצות אותם polyketide (סוג I, II או III), סינתזה פפטיד הלא ריבוזומלי, lantipeptide, terpenoid, או מטבוליזם הסוכר מסלול 8.
  2. דוגמא polyketomycin
    1. לחלק את המבנה לתוך moieties אחת ברורה: מחצית tetracyclic, שני מונוסכרידים ואת חומצה סליצילית דימתיל.
    2. גלה, שבו moieties עלול להיגזר: מחצית tetracyclic עלול להיגזר סוג synthase polyketide השנייה ואת מחצית חומצה סליצילית דימתיל עלול להיות שמפיק I. סוג synthase polyketide איטרטיבי שני moieties סוכר, שהן 6-deoxysugars , עלול להיות synthesiZed מן הגלוקוז המעורב TDP-גלוקוז-4,6-dehydratase במהלך ביוסינתזה ומצורף ככל הנראה על ידי שני glycosyltransferases (ראה איור 3) 8.
    3. לחזות גנים המשוערת באשכול. תחשוב על אנזימים אשר מעורבים בסינתזה של moieties האחת, בין היחידות, כמו גם שינוי והתאמת המולקולה. האשכול הגן biosynthetic של Polyketomycin קרוב לוודאי מכיל גנים המקודדים סוג synthase polyketide השנייה (ולכן המינימלית ACP, KS α und KS β לחיבור יחידות מאריך), סוג synthase polyketide איטרטיבי אני (לפחות ACP, AT, KS) חברה TDP-גלוקוז-4,6-dehydratase (הכרחי צעד: גלוקוז → deoxyglucose) ושני glycosyltransferases (הצמדת שני מונומרים סוכר aglycone) 8.

איור 3
איור 3: מבנה Divid Polyketomycinאד לתוך אבני בניין יחיד. Polyketomycin מורכב decaketid tetracyclic (סוג PKS II) וכן חומצה סליצילית דימתיל (אני סוג PKS איטרטיבי), המקושרים באמצעות שני moieties deoxysugar β-D-amicetose ו α-L-axenose (NDP-גלוקוז-4,6- dehydratase ושני glycosyltransferase חובה). אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

4. הגנום רצף / כרייה

  1. רצף הדור הבא
    1. רצף ה- DNA הגנומי ידי טכנולוגיות רצף הדור הבא כמו Illumina, 454 pyrosequencing או 20 מוצקים. יישר יחיד קורא לרצף התייחסות או להרכיב דה נובו.
      הערה: הגנום של ס diastatochromogenes Tü6028 היה רצף במרכז לביוטכנולוגיה (CeBiTec) באוניברסיטת בילפלד. כל קורא הורכבו על הגנום טיוטהשל 7.9 Mb.
  2. כריית הגנום
    1. חיפוש עבור מסגרות קריאה פתוחה (ORFs) בשל השימוש למשל צמח שדה פרוקריוטים הגנום ביאור צינור 21,22, RAST (ביאור מהיר בטכנולוגיית משנה) 23,24,25, Prokka (ביאור הגנום פרוקריוטים מהיר) 26 או GenDB 27. תוכניות אלה גם להציע תפקידיהם. הניתוח של ס diastatochromogenes רצף הגנום טיוטת Tü6028 הובילו לזיהוי של יותר מ -7,000 ORFs.
    2. הפעל תפציץ ספציפי (כלי חיפוש יישור בסיסי מקומי) ניתוח כדי לקבל מידע נוסף כמו מערכים עם גנים דומים אחרים ותחומי קטליטי 28,29,30.
    3. לזיהוי של תוכניות לרוץ באשכול גנים המטבוליט המשני כמו antiSMASH 31,32,33, NaPDoS 34 ו NRPSpredictor 35,36. בגנום הטיוטה זיהה antiSMASH 31,32,33 diastatochromogenes Streptomycesמצוין 22 אשכולות גנים.
    4. ניתוח אשכולות גנים המשוערת עבור מסלול האנזימטית שלהם (ים) (synthase polyketide (סוג I, II או III), synthetase פפטיד הלא ריבוזומלי, lanthipeptide, terpenoid, מטבוליזם הסוכר ...). חפש באשכול (ים) המכיל גנים העשויים להיות מעורבים בסינתזה של המתחם (ראה סעיף 3). בתוך ס diastatochromogenes מבואר אשכול 2 מכיל סוג synthase polyketide השנייה גנים, סוג synthase polyketide שלוש שאני גנים, TDP-גלוקוז-4,6-dehydratase גן ושני גני glycosyltransferase (ראה איור 4).
    5. דגש על גנים בודדים בתוך האשכול. כי אני סוג PKS ו NRPS הספציפית של acyltransferases ותחומי adenylation, ובכך השילוב של יחידות מאריך יחיד, ניתן לחזות. גם להשוות את סדר יחידת המאריך המשולב עם המולקולה. antiSMASH 31,32,33 גם מראה אשכולות דומים של תרכובות ידועות כבר, עם קישור למסד נתוני MIBiG 37. השווה את המבנה של המתחם עם תרכובות אחרות אלו ולבדוק על דמיון.

איור 4
איור 4: יציאת antiSMASH של Polyketomycin biosynthetic ג'ין אשכול סקירה של אשכולות אחרים ס diastatochromogenes Tü6028. (א) סקירה של אשכולות גנים biosynthetic חזה בגנום של ס diastatochromogenes Tü6028; (ב) אשכול 2 Polyketomycin באשכול גני biosynthetic עם גנים ממוקדים. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

5. אימות של אשכול biosynthetic ג'ין

  1. חפש גן עם פונקציות ברורות וחשובות (הכרחיות) עבור ביוסינתזה של המתחם. לצורך אימות של polyketoבאשכול גנים mycin הגן pokPI, קידוד עבור α ketosynthase מן סוג PKS השנייה, נבחרה מומת על ידי מחוץ למסגרת -deletion (ראה איור 5 ב). לחלופין, לקטוע את הגן על ידי שיבוט מקטע פנימי (ראה 5C איור).

איור 5
איור 5: אימות של אשכול גנים על ידי יחיד מוצלב. (א) גן Native מוביל את התרגום של חלבון פונקציונלי; (ב) שיבוט של הגן עם מחיקה פנימית לתוך וקטור התאבדות מוביל מוצלב יחיד שהובילו לשינוי מסגרת הגן הממוקד והתרגום הבא של חלבון שאינו פונקציונלי; (C) שיבוט של שבר פנימי של הגן לתוך וקטור התאבדות מוביל עיצור של הגן והתרגום הבא של חלבון שאינו פונקציונלי. אורית: מקורו של transfer; R אנטיביוטי: עמידות לאנטיביוטיקה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

  1. שיבוט של לבנות-מוצלב היחיד
    1. להגביר שבר המכיל pokPI ידי PCR עם פריימרים 38 pokPI_for ו pokPI_rev.
    2. המוצר Clone PCR לתוך וקטור התאבדות pKC1132 39 (apramycin R [50 מ"ג / מ"ל]). וקטור ההתאבדות אינו מסוגל לשכפל את מתח Streptomyces ובכך יש כדי להשתלב הגן הממוקד על ידי רקומבינציה הומולוגי לספק עמידות apramycin. מעביר את הווקטור לתוך חיידק שיבוט המארח על ידי טרנספורמציה הלם חום 40.
    3. לבודד את הווקטור ידי תמוגה אלקליין 41.
    4. לעכל את ה- DNA וקטור עם אנזים הגבלה חותך יחיד שחותך בתוך שבר. PokPI genדואר היה מתעכל עם I. אנזים Kpn
    5. פנקו DNA וקטור מתעכל עם DNA פולימרז גדול שאני שבר (Klenow), אשר יש 5 '→ 3' פעילות פולימראז ו 3 '→ 5' פעילות exonuclease. הקהיה של הקצוות הדביקים ו religation הבא מוביל לאובדן של ארבעה בסיסים. בדוק אובדן בסיסים אלה על ידי שינוי במדרגות לתוך E. coli XL1 כחול, לקטוף מושבות אחת, לבודד פלסמיד דנ"א שלהם, 41 וניתוח נוסף על ידי עיכול וסדר הגבלה.
  2. הצמיד של המוצלב-היחיד לבנות לתוך Streptomyces
    1. מעבירים את וקטור התאבדות המכיל את הגן pokPI (pKC1132_ pokPI דל) עם המחיקה לתוך E. coli ET12567 pUZ8002 42 (kanamycin R) על ידי שינוי הלם חום 40. דגירה התאים 100 מ"ל התקשורת LB (מיקרוגרם 50 kanamycin מ"ל -1, apramycin 50 מיקרוגרם מ"ל -1
    2. מערבבים 500 μL E. coli pUZ8002 pKC1132_ pokPI דל עם 500 diastatochromogenes תרבות μL Streptomyces (לחילופין להשתמש נבגים). מורחים את התערובת על צלחות MS (קמח סויה 20 גר ', D-מניטול 20 גרם, MgCl 2 10 מ"מ, אגר 1.5%, מי ברז 1 L). דגירת הצלחות עבור 20 שעות ב 28 מעלות צלזיוס.
    3. Overlay כל צלחת עם apramycin (1.25 מ"ג) ו פוספומיצין (5 מ"ג) מומס 1 מ"ל של מים ולתת להם להתייבש. דגירת הצלחות במשך כמה ימים על 28 מעלות צלזיוס עד exconjugants גלוי.
  3. בדקו מוטציות חד מוצלבות
    1. לחסן exconjugants יחיד 20 בינוני מ"ל TSB (apramycin 50 מ"ג מ"ל -1) דגירה אותם ב 28 מעלות צלזיוס למשך שלושה ימים 180 סל"ד.
    2. לבודד הדנ"א הגנומי 43 ולבדוק הפרעה של הגן pokPI ידי PCR.
    3. לחסן שיבוטים אחד עם הפרעת גן אומה ומתח wildtype Streptomyces ב 100 בינוני המ"ל HA דגירה אותם במשך 6 ימים ב 28 מעלות צלזיוס ו 180 סל"ד. חלץ את התמצית הגולמית (ראה סעיף 1.3). בדוק ייצור תרכובות ידי ניתוח HPLC-MS (ראה סעיף 1.4). השיא המקביל הכרומתוגרמה HPLC ואת המסה של המתחם לא צריך להתגלות יותר (ראה איור 6).

איור 6
איור 6: HPLC ניתוח של ס diastatochromogenes עם מומת pokPI ג'ין. HPLC chromatogram (λ = 430 ננומטר) של תמצית גולמי של ס diastatochromogenes WT (למעלה) זן מוטנטי עם קטע pokPI -Gen (להלן). בזן העכברים המוטנטים אינו מייצר polyketomycin יותר.אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Representative Results

בסקירה זו נתאר את הצעדים היחידים מהזדהות של אנטיביוטיקה המובילה באשכול גני biosynthetic שלה. לפני שנים רבות אנו משובטים ספריית cosmid, ארוזה אותם פאגים, transduced תאי מארחי E. coli, והיה צריך להקרין אלף מושבות לזהות שיבוטים שיש אזורים חופפים של אשכול polyketomycin. רצף של cosmids גם היה תהליך קשה ויקר 12.

על מנת לערוך מחקרים נוספים על זן אנו רצף הגנום כולו של Streptomyces diastatochromogenes Tü6028. עם רצף הגנום הטיוטה זיהינו בקלות באשכול גני biosynthetic של polyketomycin ואשכולות אחרים קידוד תרכובות מבטיחות. איור 7 משווה את השיטה "הישנה" של זיהוי אשכול biosynthetic ידי שיבוט של ספריה cosmid והקרנת elaborative, ושיטת ה "חדשה" על ידי רצף הגנום כולו עם כריית הגנום הבאה בסולם תקופה קשה. טכנולוגיות הרצף החדשות ותוכניות כרייה הגנום חדשות להאיץ את התהליך כולו.

איור 7
איור 7: השוואה בין "היהודי הישן" ו "חדש" שיטה של הקצאת biosynthetic ג'ין אשכול. השיטה "הישנה" כוללת שיבוט של ספריית cosmid עם מבחר של שיבוטים חיוביים רצף של cosmid בהתאמה (ים) (לעיל); השיטה "החדשה" כוללת רצף הגנום כולו -mining לזהות כל אשכולות גנים המטבוליט משנה הפרושות על הגנום של זן (להלן). משך צעדים יחידים מוצג על ציר זמן מחוספס. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Discussion

במעבדה זו ספריית cosmid הגנומי של diastatochromogenes Streptomyces נוצרה והוקרנה לפני שנים רבות, וכתוצאה מכך ההזדהות של אשכול גני polyketomycin באמצעות תהליך זמן רב מאוד. אפיון של גנים בודדים היו אפשרי באמצעות מחיקות גן ממוקדות וניתוח של מוטציות וכתוצאה מכך 12. לאחרונה, רצף הגנום טיוטת diastatochromogenes ס הושג המאפשר זיהוי מהיר של אשכול גנים biosynthetic polyketomycin. יכולנו לזהות את גני biosynthetic בקלות, למרות רצף הגנום הטיוטה מכיל עדיין contigs רב. התהליך המתואר יכול להיות מושג בתוך חודשים. עם זאת, ההליך מורכב שלבים רבים. צעדים יחידים עלולים להיכשל מספר פעמים, מניעת התקדמות בשלבים הבאים:

הסוג Streptomyces ידוע ביכולת שלו לייצר תרכובות ביו. בעוד שהם נושאים לעתים קרובות יותר מ -20 BIOSאשכולות גני ynthetic, בדרך כלל רק אחד או שתיים תרכובות מיוצרות בתנאי מעבדה. היישום של גישת OSMAC (טיפוח זן אחד בתנאים שונים) להתעורר אשכולות גנים שקטים לעתים לא יספיק. מניפולציה גנטית של גנים רגולטוריים, כמו הגנים הרגולטור pleiotropic adpA 44 ו bldA 45,46, הוא גם שיטה יעילה כדי להפעיל את הייצור של מטבוליטים משניים אחרים.

לקבלת ההבהרה של המבנה המתחם, למשל על ידי ניתוח NMR, בדרך כלל יותר מ -2 מ"ג של מתחם מטוהר הוא הכרחי. לכן, תסיסה של יותר מ -10 תרבות L נדרשה לעתים קרובות. ללא פרמנטור כי הוא מסוגל לשמור על חמצן, תנאי pH וטמפרטורה, זה יכול להיות מאתגר במעבדה קטנה לטפל סכום זה של תרבות החילוץ הבא. במהלך הטיהור, במתחם ניתן לשנות עקב חמצון, קרינה או טמפרטורה.כמו כן, השלבים לטיהור יותר משמשים, כך עולה הסיכוי של השפלה.

כאשר בוחנים את המבנה של המוצר הטבעי, ואת האשכולות בגנום, לפעמים זה לא כל כך קל לזהות את האשכול המתאים. ראשית, אם יש רק רצף הגנום טיוטת חלק של האשכול עלול להיות חסר. שנית, לא כל הגנים אשר נדרשים עבור ביוסינתזה נמצאים באשכול. שלישית, לעתים אשכול מחולק לשני חלקים המופרדים זה מזה על ידי kilobases רב. רביעית, זה עלול להיות קשה להחליט איזה מהם הוא מתאים באשכול הגנים. במקרה של לי סוג PKS גדול או מערכות NRPS, שבו אפשר לחשב את מספר יחידות המאריכות מבוסס על מספר מודולים, או אפילו לזהות את יחידות מאריך היחידות על ידי ניתוח של תחומי הבחירה, זה מייד מתפרסם בקלות. עם זאת, במקרה של איטרטיבית עובד אנזימי התחזית של התרכובות המסונתזות היא לעתים קרובות לא אפשרית, במיוחד אם straיש יותר מ -40 אשכולות גנים. חמישית, הטבע הוא מאוד מורכב ומלא של תרכובות ידועות עדיין. לעתים קרובות ביוסינתזה היא תערובת של מסלולים שונים. אם המתחם החדש הוא לא זיהה עדיין, או שאינו קשור למתחם אחר, זה עלול להיות קשה לזהות את האשכול, להציע מודל ביוסינתזה וכדי להוכיח את זה.

לאחר באשכול מזוהה, הטכניקה המוצלבת אחת היא שיטה טובה ומהירה כדי לאמת את ההשערה. PCR, שיבוט לתוך וקטור התאבדות, נטייה, בחירה של שיבוטים חיוביים, assay ייצור הם הצעדים הנדרשים בלבד. אחד החסרונות של שיטה זו הוא כי שילוב של וקטור לתוך הכרומוזום אינו יציב עקב אירועי רקומבינציה נוספת. לכן, כדי להמשיך לנתח גנים בודדים, מחיקות גן מדויקות נדרשות. וכן זה היה יכול להיות מסובך לתמרן זני Streptomyces במישור הגנטי.

ניתן להקצות ההליך המתואר to כל תרכובת אחרים המיוצרים על ידי זן Streptomyces או מיקרואורגניזם אחר. הידיעה על באשכול גני biosynthetic המתחם המסונתז שלה נותנת לנו הזדמנויות נוספות לשנות כבר למולקולות קיימות במטרה לשפר אותם במאבק נגד פתוגנים עמידים multidrug.

Materials

Name Company Catalog Number Comments
agar Carl Roth GmbH + Co. KG, Karlsruhe, Germany 5210.4
agarose Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6352.4
D-mannitol  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4175.1
glucose  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6780.1
LB  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X964.3
malt extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X976.2
MgCl2 Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2189.1
Peptone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany
soy flour  W.Schoenemberger GmbH, Magstadt, Germany Hensec-Vollsoja
tryptic soy broth Carl Roth GmbH + Co. KG, Karlsruhe, Germany X938.3 Caso-Bouillon
yeast extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2363.2
Solvents
Acetic acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 3738.5
Acetone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 9372.2
Acetonitrile Avantor Performance Materials B.V., Deventer, The Netherlands JT-9012-03
Dichlorofrom  Fisher Scientific GmbH, Schwerte, Germany 1530754
DMSO (Dimethyl sulfoxide) Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4720.1
DMSO-d6 (Dimethyl sulfoxide-d6) 99.9 atom% D ARMAR Chemicals, Döttingen, Switzerland 15200.204
Ethyl acetate Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6784.4
Hydrochloric acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6331.4
Methanol Carl Roth GmbH + Co. KG, Karlsruhe, Germany 7342.1
Enzymes
restriction enzymes New England Biolabs GmbH, Frankfurt am Main, Germany
polymerase  New England Biolabs GmbH, Frankfurt am Main, Germany
DNA Polymerase I Large (Klenow) Fragment Promega GmbH, Mannheim, Germany
Antibiotics
apramycin AppliChem GmbH, Darmstadt, Germany  A7682.0005
fosfomycin Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany P5396-50G
kanamycin Carl Roth GmbH + Co. KG, Karlsruhe, Germany T832.2
Plasmid/Vectors
pKC1132 Bierman et al. 1992
Primer 
pokPI_for TGATGGTGCCGCTGGCCATGG Primer to amplify fragment containing pokPI gene
pokPI_rev AGCGTTCACTGTTCCGCCCGAC
Bacterial strains
Bacillus subtilis COHN ATCC6051 Gram-positive test strain 
Escherichia coli ET12567 pUZ8002  MacNeil et al. 1992 strain for conjugation
Escherichia coli XL1 Blue Agilient Technologies, Santa Clara, USA Gram-negative test strain + cloning host 
Streptomyces diastatochromogenes Tü6028 Paululat et al., 1999 Polyketomycin producer
Online services
antismash (Antibiotics and Secondary Metabolite Analysis Shell) http://antismash.secondarymetabolites.org/ Detection of secondary metabolite gene cluster
BLAST (Basic Local Alignment Search Tool) http://blast.ncbi.nlm.nih.gov/Blast.cgi finds regions of similarity between biological sequences
GenDB https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb Annotation of ORFs 
MiBIG (Minimum Information about a Biosynthetic Gene cluster) http://mibig.secondarymetabolites.org/ Database of biosyntetic gene clusters
NaPDoS http://napdos.ucsd.edu/ Detection of seconary metabolite gene cluster
NCBI Prokaryotic Genome Annotation Pipeline http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ Annotation of ORFs 
NRPSpredictor http://nrps.informatik.uni-tuebingen.de/ Detection of NRPS domains
Prokka (rapid prokaryotic genome annotation) http://www.vicbioinformatics.com/software.prokka.shtml Annotation of ORFs 
RAST (rapid annotation using subsystems technology) http://rast.nmpdr.org/ Annotation of ORFs 
Other programs
Chem Station Rev. A.09.03 Agilent Technologies, Waldbronn, Germany Handling program for HPLC 
Clone Manager Suite 7 Scientific and Educational Software, Cary, USA Designing Cloning Experiment 
Newbler v2.8 Roche Diagnostics Alignment of sequencing reads
Machines 
Centrifuge Avanti J-6000, Rotor JA-10 Beckman Coulter GmbH, Krefeld, Germany
HPLC/MS Agilent Technologies, Waldbronn, Germany
_Autosampler: G1313A Agilent Technologies, Waldbronn, Germany
_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 µm) Agilent Technologies, Waldbronn, Germany
_Column:Xbridge C18 (100 mm × 4.6 mm; Particle size: 3.5 μm) Agilent Technologies, Waldbronn, Germany
_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_Degasser: G1322A  Agilent Technologies, Waldbronn, Germany
_Quarternary pump: G1311A Agilent Technologies, Waldbronn, Germany
_Diode array detector (DAD )G1315B (λ = 254 nm and 400 nm) Agilent Technologies, Waldbronn, Germany
_Quadrupole mass detector (MSD) G1946D(2-3000 m/z) Agilent Technologies, Waldbronn, Germany
rotary evaporator
_heating bath Hei-VAP Value/G3 Heidolph Instruments GmbH & Co.KG, Schwabach, Germany
_vacuum pump system SC 920 G KNF Global Strategies AG, Sursee, Switzerland
Other material
Sephadex LH20 GE Healthcare, 
Chromafil PVDF-45/15MS (pore size 0.45 µm; filter Ø15 mm) MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany
SPE column Oasis HLB 20 35 cc (6g) Waters GmbH, Eschborn, Germany 
E. coli  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Bacillus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Streptomyces sp. Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g
for agar plates add 2% agar

DOWNLOAD MATERIALS LIST

References

  1. Fleming, A. On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae. Br J Exp Pathol. 10, (3), 226-236 (1929).
  2. Lemke, A., Kiderlen, A. F., Kayser, O. Amphotericin B. Appl. Microbiol. Biotechnol. 68, (2), 151-162 (2005).
  3. Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. Daptomycin. Nat. Rev. Drug Discov. 2, (12), 943-944 (2003).
  4. Zakeri, B., Wright, G. D. Chemical biology of tetracycline antibiotics. Biochem. cell Biol. 86, (2), 124-136 (2008).
  5. Schatz, A., Bugle, E., Waksman, S. A. Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria. Exp. Biol. Med. 55, (1), 66-69 (1944).
  6. Burg, R. W., et al. Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob. Agents Chemother. 15, (3), 361-367 (1979).
  7. Egerton, J. R., Ostlind, D. A., et al. Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component. Antimicrob. Agents Chemother. 15, (3), 372-378 (1979).
  8. Walsh, C. T., Fischbach, M. A. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132, (8), 2469-2493 (2010).
  9. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination. J. Antibiot. (Tokyo). 51, (1), 26-32 (1998).
  10. Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.Tü6028. J. Antibiot. (Tokyo). 52, (2), 96-101 (1999).
  11. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities. J. Antibiot. (Tokyo). 51, (1), 21-25 (1998).
  12. Daum, M., et al. Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin. Chembiochem. 10, (6), 1073-1083 (2009).
  13. Bode, H. B., Bethe, B., Höfs, R., Zeeck, A. Big effects from small changes: possible ways to explore nature's chemical diversity. Chembiochem. 3, (7), 619-627 (2002).
  14. Wolfender, J. -L. HPLC in Natural Product Analysis: The Detection Issue. Planta Med. 75, (07), 719-734 (2009).
  15. Stahl, E. Thin-layer chromatography. A laboratory handbook. 2nd edition (1967).
  16. Snyder, L. R., Kirkland, J. J., Glajch, J. L. Preparative HPLC Separation. Pract. HPLC Method Dev. 616-642 (2012).
  17. Granath, K. A., Kvist, B. E. Molecular weight distribution analysis by gel chromatography on sephadex. J. Chromatogr. A. 28, 69-81 (1967).
  18. Jackman, L. M., Sternhell, S. Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry. Int. Ser. Org. Chem. (1969).
  19. Xian, F., Hendrickson, C. L., Marshall, A. G. High resolution mass spectrometry. Anal. Chem. 84, (2), 708-719 (2012).
  20. Metzker, M. L. Sequencing technologies - the next generation. Nat. Rev. Genet. 11, (1), 31-46 (2010).
  21. Tatusova, T., et al. Prokaryotic Genome Annotation Pipeline. NCBI Handb. 2nd Ed. (2013).
  22. Angiuoli, S. V., et al. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation. OMICS. 12, (2), 137-141 (2008).
  23. Aziz, R. K., et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 9, 75 (2008).
  24. Overbeek, R., et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 42, 206-214 (2014).
  25. Brettin, T., et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 5, 8365 (2015).
  26. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 30, (14), 2068-2069 (2014).
  27. Meyer, F. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 31, (8), 2187-2195 (2003).
  28. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, (3), 403-410 (1990).
  29. Madden, T. The BLAST Sequence Analysis Tool. NCBI Handb. 2nd Ed. Chapter 16 (2003).
  30. Marchler-Bauer, A., et al. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, (Database issue) 222-226 (2014).
  31. Medema, M. H., et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, (Web Server issue) 339-346 (2011).
  32. Blin, K., et al. antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 41, (Web Server issue) 204-212 (2013).
  33. Weber, T., et al. antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, (W1) 237-243 (2015).
  34. Ziemert, N., et al. The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity. PLoS One. 7, (3), 34064 (2012).
  35. Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res. 33, (18), 5799-5808 (2005).
  36. Röttig, M., et al. NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39, (Web Server issue) 362-367 (2011).
  37. Medema, M. H., et al. Minimum Information about a Biosynthetic Gene cluster. Nat. Chem. Biol. 11, (9), 625-631 (2015).
  38. Mullis, K., et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51, Pt 1 263-273 (1986).
  39. Bierman, M., et al. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 116, (1), 43-49 (1992).
  40. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli.using the heat shock method. J. Vis. Exp. (6), e253 (2007).
  41. Bimboim, H. C., Doly, J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, (6), 1513-1523 (1979).
  42. MacNeil, D. J., et al. Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector. Gene. 111, (1), 61-68 (1992).
  43. Pospiech, A., Neumann, B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet. 11, (6), 217-218 (1995).
  44. Makitrynskyy, R., et al. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin. Open Biol. 3, (10), 130121 (2013).
  45. Kalan, L., et al. A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene. Chem. Biol. 20, (10), 1214-1224 (2013).
  46. Gessner, A., et al. Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains. ChemBioChem. 16, (15), 2244-2252 (2015).
ממוצר טבעי כדי המצרר שלו biosynthetic ג&#39;ין: הפגנה שימוש Polyketomycin מ<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).More

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter