Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Fra et naturlig produkt til sin Biosyntetiske Gene Cluster: En demonstrasjon Bruke Polyketomycin fra doi: 10.3791/54952 Published: January 13, 2017

Summary

Her presenterer vi en detaljert protokoll av (A) identifisering av et naturlig produkt med antibiotisk aktivitet, (B) rensingen av forbindelsen, (C) den første modellen av dens biosyntese, (D) genomsekvensering / -mining og ( E) verifisering av den biosyntetiske gen-klynge.

Abstract

Streptomyces-stammer som er kjent for sin evne til å produsere en rekke forskjellige forbindelser med forskjellige bioaktivitet. Dyrking under forskjellige betingelser fører ofte til fremstilling av nye forbindelser. Derfor er produksjons kulturer av stammene ble ekstrahert med etylacetat og de urene ekstrakter analysert ved HPLC. Videre er ekstraktene testet for deres bioaktivitet ved forskjellige analyser. For klarlegging struktur forbindelsen av interesse renses ved en kombinasjon av forskjellige kromatografiske metoder.

Genomsekvensering kombinert med genomet gruvedrift tillater identifikasjon av et naturlig produkt biosyntetiske gen-klynge bruke forskjellige dataprogrammer. For å bekrefte at den korrekte clusteret har blitt identifisert, geninaktivering eksperimenter må utføres. De resulterende mutanter blir analysert for produksjon av det spesielle naturprodukt. Når riktig clusteret er blitt inaktivert, ibelastning skulle svikte for å fremstille forbindelsen.

Arbeidsflyten er vist for den antibakterielle sammensatte polyketomycin produsert av Streptomyces diastatochromogenes Tü6028. Rundt ti år siden, da genomsekvense var fortsatt veldig dyrt, kloning og identifisering av et gen klynge var en svært tidkrevende prosess. Fast genomsekvensering kombinert med genom gruvedrift akselererer rettssaken mot klyngen identifikasjon og åpner opp for nye måter å utforske biosyntese og å generere nye naturlige produkter av genetiske metoder. Protokollen som er beskrevet i denne artikkelen kan tilordnes en hvilken som helst annen forbindelse avledet fra en Streptomyces-stamme eller en annen mikroorganisme.

Introduction

Naturlige produkter fra planter og mikroorganismer har alltid vært en viktig kilde for klinisk narkotika utvikling og forskning. Den første antibiotika penicillin ble oppdaget i 1928 av en sopp av Alexander Fleming 1. I dag er mange mer naturlige produkter som brukes i klinisk behandling.

En slekten kjent for sin evne til å produsere ulike typer sekundære metabolitter med forskjellige bioaktivitet er Streptomyces. Streptomyces er Gram-positive bakterier og tilhører klassen av aktinobakterier og rekkefølgen Actinomycetales. Nesten to tredjedeler av klinisk brukt antibiotika er hentet fra Actinomycetales, hovedsakelig fra Streptomyces, som amfotericin 2, daptomycin 3 eller tetracyklin 4. To Nobelpriser er tildelt innen Streptomyces antibiotika forskning. Den første gikk til Selman Waksman for oppdagelsen av streptomycin, den første entibiotic effektiv mot tuberkulose. 5 I 2015, som en del av Nobelprisen i fysiologi og medisin, oppdagelsen av avermectin fra S. avermitilis ble tildelt som tillegg. Avermectin brukes for behandling av parasittsykdommer 6,7.

Den tradisjonelle tilnærming til oppdagelsen av naturlige produkter i mikroorganismer så som Streptomyces innebærer generelt dyrking av stammen under forskjellige vekstbetingelser, så vel som ekstraksjon og analyse av sekundære metabolitter. Bioaktiviteten assays (f.eks analyser for antibakteriell og anticancer aktivitet) er utført for å detektere aktiviteten til forbindelsen. Endelig er forbindelsen av interesse isoleres og den kjemiske strukturen er klarlagt.

Strukturene av naturlige produkter er ofte sammensatt av enkeltdelene som danner komplekse molekyler. Det er noen få, men begrenset, store biosyntetiske veier som fører til å bygge blokkenks, som brukes for biosyntesen av naturlige produkter. De store biosyntetiske reaksjonsveier er de polyketide veier, veier som fører til terpenoider og alkaloider, trasé ved hjelp av aminosyrer og veier som fører til sukkerdeler. Hver vei er preget av et sett av spesifikke enzymer 8. Basert på strukturen til forbindelsen, kan disse biosyntetiske enzymer forutsies.

I dag kan det detaljert strukturell analyse av en forbindelse i kombinasjon med neste generasjon sekvensering og analyse bioinformatiske bidra til å identifisere den ansvarlige biosyntetiske gen-klynge. Klyngen informasjon åpner opp nye måter for videre naturprodukt forskning. Dette omfatter heterolog ekspresjon for å øke utbyttet av det naturlige produkt, målrettet forbindelse modifikasjon av genet delesjon eller endringer og kombinatoriske biosyntesen med gener fra andre veier.

Polyketomycin ble isoleres uavhengig fra dyrkningsbuljongento stammer, Streptomyces sp. MK277-AF1 9 og Streptomyces diastatochromogenes Tü6028 10. Strukturen ble undersøkt ved NMR og røntgenanalyse. Polyketomycin er sammensatt av et tetracyklisk decaketid og en dimetyl-salicylsyre, forbundet med de to molekyldelene deoxysugar p-D-amicetose og α-L-axenose. Den viser cytotoksisk og antibiotisk aktivitet, også mot grampositive multiresistente stammer slik som MRSA 11.

Et genomisk bibliotek av kosmid S. diastatochromogenes Tü6028 ble dannet og undersøkt for mange år siden. Ved hjelp av spesifikke gener i polyketomycin genet cluster med en størrelse på 52,2 kb, som inneholder 41 gener ble identifisert etter flere måneder med intens jobbing 12. Nylig ble et utkast genomsekvens S. diastatochromogenes innhentet fører til rask identifisering av polyketomycin biosyntetiske genet klynge. I denne oversikten, en metode bidrar til Idensere et naturlig produkt og belyse dens biosyntetiske gen-klynge bli beskrevet, ved hjelp av polyketomycin som et eksempel.

Her forklarer vi de enkle trinn som fører fra et naturlig produkt av sin biosyntetiske genet klynge vist for polyketomycin produsert av Streptomyces diastatochromogenes Tü6028. Protokollen omfatter identifisering og rensing av et naturlig produkt med antibiotiske egenskaper. Ytterligere strukturell analyse og sammenligning med resultatene fra genomet gruvedrift føre til identifikasjon av de biosyntetiske gen-klynge. Denne fremgangsmåten kan anvendes på en hvilken som helst annen forbindelse avledet fra en Streptomyces-stamme eller en hvilken som helst annen mikroorganisme.

Protocol

1. Identifikasjon av et naturlig produkt med antibiotika Eiendom

  1. Dyrke en mikroorganisme under forskjellige forhold (for eksempel tid, temperatur, pH, medium) som følge av "OSMAC (en strekk mange forbindelser) approach" 13. Velge ett medium hvori produksjonen av en forbindelse er observert.
  2. Dyrke Streptomyces diastatochromogenes Tü6028 under følgende betingelser
    1. Grow Streptomyces diastatochromogenes Tü6026 belastning på MS plater (soyamel 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1,5%, vann fra springen en L). Vaksinere en liten løkke av sporer av denne stammen i 20 ml væske TSB medium (tryptisk soyabuljong 30 g, vann fra springen en L, pH 7,2, forkultur medium) i en Erlenmeyerkolbe med en spiral. Rist kolbe på en rotasjonsrister (28 ° C, 180 rpm, 2 dager).
    2. Inokulere hovedkultur i 100 ml HA-medium (glukose 4 g, gjærekstrakt 4 g, maltekstrakt 10 g vann fra springen en L, pH 7,2) med 2 ml av forkulturen. Kultur tøyning ved 28 ° C i 6 dager på en roterende rystemaskin ved 180 rpm.
  3. Fremstilling av råekstraktet
    1. Harvests cellene ved sentrifugering (10 min, 3000 xg).
    2. For neste trinn håndtere organiske løsemidler under en avtrekkshette.
    3. For forbindelse ekstraksjon fra mycel, resuspender cellene i et dobbelt volum av aceton og rist i et rør i 30 minutter, 180 rpm. Filtrere væsken gjennom kommersielle filterpapir og fordamp aceton ved rotasjonsfordamper ved 40 ° C og 550 bar. Oppløs ekstrakt i 20 ml vann: etylacetat (1: 1) og ryste den i en skilletrakt i 30 minutter ved 180 rpm.
    4. For forbindelse ekstraksjon fra kulturmediet, justeres kulturmediet til pH 4,0 ved tilsetning av 1 M HCl. Tilsett 100 ml etylacetat og ryste den i en skilletrakt i 30 minutter, 180 rpm.
    5. Samle etylacetat fase og fordampe ved råte ær fordampning ved 40 ° C og 240 bar.
  4. Analyse av den urene ekstrakt ved HPLC
    1. Oppløs ekstraktene i 1 ml MeOH, filtrere dem gjennom et 0,45 um porestørrelse filter og drives med høy ytelse væskekromatografi (HPLC) 14.
    2. I tilfelle av polyketomycin, utstyre HPLC-system med en C18 forkolonne (4,6 x 20 mm 2) og en C18-kolonne (4,6 x 100 mm 2). Bruke en lineær gradient av acetonitril + 0,5% eddiksyre i området fra 20% til 95% i H2O + 0,5% eddiksyre (strømningshastighet: 0,5 ml min-1).
      MERK: Polyketomycin har en retensjonstid på 25,9 min (se figur 1A). UV / VIS-spekteret har maksima ved 242 nm, 282 nm, 446 nm og minima ved 262 nm og 359 nm (se figur 1B). I den negative modus en masse på 863,2 [MH] - er påvisbar (se figur 1C).

"Src =" / files / ftp_upload / 54952 / 54952fig1.jpg "/>
Figur 1: LC / MS-analyse av Polyketomycin. (A) HPLC-kromatogram (λ = 430 nm) av det rå ekstrakt etter dyrking av Streptomyces diastatochromogenes Tü6028 i 6 dager. Polyketomycin har en retensjonstid på 25,9 min (B) UV / vis-spektra av Polyketomycin. (C) Massespektra av Polyketomycin i den negative modus. Hovedtopp med m / z 863,2 [MH] -. Klikk her for å se en større versjon av dette tallet.

  1. Identifisering av antibiotisk aktivitet ved hjelp av platen diffusjon assay
    1. Inokulere teststammer som gram-positive bakterier som Bacillus subtilis (i LB-medium; LB 20 g vann fra springen en L, pH 7,4) og andre Streptomyces-stammer (i TSB-medium; tryptisk soyavekstmedium 30 g vann fra springen en L, pH 70,2), Gram-negative bakterier Escherichia coli (i LB-medium) og fungale stammer (i medier som YPD-medium, gjærekstrakt 10 g pepton 20 g, glukose 20 g, vann fra springen en L, pH 7,4). Ta 100 mL av teststammen forkultur og spre dem på respektive agar plater.
    2. Oppløs den urene ekstrakt eller rensede forbindelse i 500 mL metanol (alternativt vann eller DMSO) og pipetter 20-50 pl på sterile papirskiver. Tørt papir plater for 30 min under arbeidsbenken og sette dem på plater med test kulturer. Forbered en negativ kontroll (væske) og en positiv kontroll (antibiotika, f.eks AMP [1 mg]).
    3. Inkuber platene i henhold tilstrekkelige betingelser til teststammer er synlig dyrket og bestemme hemming sone, hvis tydelig. Inkuber E. coli og Bacillus sp. ved 37 ° C i 16 timer, Streptomyces sp. ved 28 ° C i 2-4 dager, sopp- stamme (i hovedsak avhengig av nøyaktig test-stamme) ett 30 ° C i 2 dager).

2. Large Scale Utvinning, Rensing og strukturoppklaring av forbindelsen

  1. Dyrke S. diastatochromogenes i 5 L HA medium (glukose 4 g, gjærekstrakt 4 g, maltekstrakt 10 g, vann fra springen en L, pH 7,2). Inokulere 2 ml av en forkultur i 30 x 500 ml Erlenmeyerkolber inneholdende 150 ml HA-medium. Inkuber tøyning ved 28 ° C i 6 dager på en roterende rystemaskin ved 180 rpm.
  2. Høste cellene ved sentrifugering (10 min, 15 000 xg, RT) og ekstrakt forbindelser under anvendelse av etylacetat (se avsnitt 1.3).

Figur 2
Figur 2: Arbeidsflyt for strukturoppklaring. Fremgangsmåten omfatter (1) dyrking av en stamme, (2) ekstraksjon, (3) rensing ved fastfase-ekstraksjon (SPE), tynnsjiktskromatografi (TLC), preparativ væskekromatografi (HPLC), størrelseeksklusjonskromatografi (SEC) og (4) struktur klarlegging av masseanalyse (MS), kjernemagnetisk resonans (NMR) og X-strålemålinger. Klikk her for å se en større versjon av dette tallet.

  1. Rensing av Polyketomycin
    MERK: Prosessen med rensing og strukturoppklaring er vist i figur 2.
    1. Fraksjonere råekstraktet av en C18-fastfase-ekstraksjon (SPE) kolonne ved å bruke en 10% -stepwise MeOH gradient varierende fra 30% til 100% MeOH i H2O, 100 ml for hver tilstand.
    2. Rense den forbindelsesinneholdende fraksjon ytterligere ved preparativ tynnsjikt-kromatografi (TLC) 15 ved anvendelse av CH 2Cl 2 / MeOH (7: 1) som eluering system.
    3. Rens forbindelsen med preparativ HPLC 16. Utstyre HPLC-system med en C18 forkolonne (5 um, 9,4 x 20 mm) og enHoved kolonne (5 um, 9,4 x 150 mm). Bruke en gradient av acetonitril + 0,5% eddiksyre i området fra 20% til 95% i H2O + 0,5% eddiksyre (strømningshastighet: 2,0 mL / min).
    4. For å fjerne løsningsmidler og andre mindre urenheter, utfører et siste rensetrinn ved størrelse-utelukkelses-kromatografi ved anvendelse av en kolonne i MeOH 17. Samle den endelige rene forbindelsen og fordamp MeOH ved roterende fordampning ved 40 ° C og 240 bar.
  2. strukturoppklaring
    1. Oppløs den rene forbindelsen (mer enn 2 mg) i 600-700 ul (avhengig av maskinen) i DMSO-d6, plate 1D NMR (1H, 13C) og 2D-NMR (HSQC, HMBC, en H-1 H- KOSELIG) spektra på en NMR-spektrometer 18. Uttrykke kjemiske skift i o-verdier (ppm) ved bruk av DMSO-d6.
    2. Spill en høyoppløselig massespektrum (HRESI-MS) 19 av polyketomycin bruker en høy oppløsningmassespektrometer.
    3. Klargjøre konstruksjonen ved tolkningen av resultatene av NMR og MS-data-analyse 10.

3. Foreslå Biosyntetiske Modell av New Isolert Compound

  1. Analysere strukturen av det isolerte forbindelsen og forutsi enzymer, som kan være involvert i sin biosyntese. Tilordne dem til polyketide (type I, II eller III), ikke-ribosomale peptidsyntese, lantipeptide, terpenoid, eller sukkermetabolismen sti 8.
  2. eksempel polyketomycin
    1. Del opp strukturen i åpenbare enkeltdelene: tetracyclic enhet, to monosakkarider og dimetyl salisylsyre.
    2. Finne ut, hvor gruppene kan være avledet fra: tetrasykliske gruppe kan være avledet fra en polyketide syntase type II og dimetyl salisylsyre gruppe kan være avledet av en iterativ polyketide syntase type I. De to sukkerdeler, som er 6-deoxysugars kan bli synthesized fra glukose som involverer en TDP-glukose-4,6-dehydratase under biosyntese og festet sannsynligvis av to glycosyltransferases (se figur 3) 8.
    3. Forutsi mulige gener i klyngen. Tenke på enzymer som er involvert i syntesen av de enkelte deler, i å koble enhetene, samt ved modifisering og skreddersy molekylet. Den biosyntetiske genet klynge av Polyketomycin inneholder sannsynligvis gener som koder for et polyketide syntase type II (derfor minimum en ACP, KS α und KS β for å koble extender enheter), en iterativ polyketide syntase type I (minst ACP, AT, KS), en TDP-glukose-4,6-dehydratase (nødvendig for trinn: glukose → deoxyglucose) og to glycosyltransferases (feste to sukker monomerer til aglycone) 8.

Figur 3
Figur 3: Struktur av Polyketomycin Divided til én Building Blocks. Polyketomycin er sammensatt av et tetracyklisk decaketid (PKS type II) og en dimetyl-salisylsyre (iterativ PKS type I), forbundet med de to molekyldelene deoxysugar β-D-amicetose og α-L-axenose (NDP-glukose-4,6- dehydratase og to glykosyltransferase nødvendig). Klikk her for å se en større versjon av dette tallet.

4. Genome Sequencing / Mining

  1. Neste generasjons sekvense
    1. Sekvensere genomisk DNA av neste generasjons sekvensering teknologier som Illumina, 454 pyrosekvensering eller Solid 20. Juster enkelt leser til en referansesekvens eller montere de novo.
      MERK: genomet til S. diastatochromogenes Tü6028 ble sekvensert ved Center for Bioteknologi (CeBiTec) ved Universitetet i Bielefeld. Alle leser ble satt sammen til et utkast genompå 7,9 Mb.
  2. Genome gruvedrift
    1. Søk etter åpne leserammer (ORF) ved bruk av for eksempel NCBI prokaryote Genome Kommentar Pipeline 21,22, RAST (rask merknad ved hjelp av delsystem teknologi) 23,24,25, Prokka (rask prokaryote genom merknad) 26 eller GenDB 27. Disse programmene foreslår også sine funksjoner. Analysen av S. diastatochromogenes Tü6028 utkast genomsekvens førte til identifisering av mer enn 7000 ORF.
    2. Kjør bestemt BLAST (Basic Local Alignment Search Tool) analyse for å få mer informasjon som justeringer med andre lignende gener og katalytiske domener 28,29,30.
    3. For identifisering av de sekundære metabolitter genet klynge kjøre programmer som antiSMASH 31,32,33, NaPDoS 34 og NRPSpredictor 35,36. I utkastet genomet av Streptomyces diastatochromogenes antiSMASH 31,32,33 identifisertfisert 22 gensamlingene.
    4. Analysere de antatte gensamlingene for deres enzymatiske nedbrytningen (e) (polyketide syntase (type I, II eller III), ikke-ribosomale peptid syntetase, lanthipeptide, terpenoidsyntesesporet, sukker metabolisme ...). Søk for klyngen (er) inneholdende gener som kan være involvert i syntesen av forbindelsen (se punkt 3). I S. diastatochromogenes annotert klynge 2 inneholder polyketide syntase type II-gener, tre polyketide syntase type I-genene, et TDP-glukose-4,6-dehydratase genet og to glykosyltransferase-gener (se figur 4).
    5. Fokus på enkeltgener i klyngen. For PKS type I og NRPS spesifisiteten av acyltransferases og adenylation domener, og således innlemmelsen av enkelt extender enhetene, kan forutsies. Også sammenligne rekkefølgen på innlemmet extender enhet med molekylet. antiSMASH 31,32,33 viser også lignende klynger av allerede kjente forbindelser, med en link til MIBiG database 37. Sammenligner strukturen av forbindelsen med disse andre forbindelser og se etter likheter.

Figur 4
Figur 4: antiSMASH Utgang fra Polyketomycin Biosyntetiske Gene Cluster og oversikt over andre klynger i S. diastatochromogenes Tü6028. (A) Oversikt over spådd biosyntetiske genet klynger i genomet av S. diastatochromogenes Tü6028; (B) Cluster 2 Polyketomycin biosyntetiske genet klynge med målrettede gener. Klikk her for å se en større versjon av dette tallet.

5. Verifisering av Biosyntetiske Gene Cluster

  1. Søk etter et gen med åpenbare og viktige (essensielle) funksjoner for biosyntese av det sammensatte. For verifikasjon av polyketomycin-genklusteret genet pokPI, som koder for ketosynthase α fra PKS type II, ble utvalgt og inaktivert ved en ute av ramme -deletion (se figur 5B). Alternativt kan avbryte genet ved å klone et indre fragment (se figur 5C).

Figur 5
Figur 5: Verifisering av en Gene Cluster av enkelt Crossover. (A) Native gen som fører til translasjon av et funksjonelt protein; (B) Kloning av genet med indre delesjon inn i en selvmordsvektor som fører til en enkelt crossover som resulterer i en ramme forskyvning i den målrettede genet og påfølgende translasjon av ikke-funksjonelt protein; (C) Kloning av et indre fragment av genet inn i en selvmordsvektor fører til en trunkering av genet og påfølgende translasjon av et ikke-funksjonelt protein. orit: opprinnelsen til transfer; antibiotika R: antibiotikaresistens. Klikk her for å se en større versjon av dette tallet.

  1. Kloning av single-crossover konstruere
    1. Forsterke et fragment som inneholder pokPI ved PCR 38 med primere pokPI_for og pokPI_rev.
    2. Clone PCR produkt til selvmord vektor pKC1132 39 (AMP R [50 mg / ml]). Selvmordsvektor er ikke i stand til å replikere i Streptomyces-stammen og således har til å integrere i den målrettede genet ved homolog rekombinasjon for å tilveiebringe apramycin-motstand. Overfør vektoren inn i E. coli-kloningsverten ved varmesjokk transformasjon 40.
    3. Isoler vektoren ved alkalisk lysering 41.
    4. Fordøye vektor-DNA med et enkelt kutter restriksjonsenzym som kutter inne i fragmentet. Den pokPI gene ble spaltet med enzym Kpn I.
    5. Behandle spaltet vektor-DNA med DNA-polymerase I stort (Klenow) fragment, som har 5 '→ 3'-polymerase-aktivitet og 3'-→ 5'-eksonuklease-aktivitet. Blunting av de klebrige ender og påfølgende religering fører til tap av fire baser. Sjekk for tap av disse basene ved trinn transformasjon til E. coli XL1 blå, plukke enkeltkolonier, isolere deres plasmid DNA, 41 og analysere videre ved restriksjons fordøyelse og sekvensering.
  2. Konjugering av enkelt crossover konstruere inn i Streptomyces
    1. Overfør selvmord vektor som inneholder pokPI genet (pKC1132_ pokPI del) med slettingen inn i E. coli ET12567 pUZ8002 42 (kanamycin R) ved varmesjokk transformasjon 40. Cellene inkuberes i 100 ml LB-medium (kanamycin 50 ug ml -1, apramycin 50 ug ml -1
    2. Bland 500 mL E. coli pUZ8002 pKC1132_ pokPI del med 500 mL Streptomyces diastatochromogenes kultur (alternativt bruke sporer). Fordel blandingen på MS plater (soyamel 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1,5%, vann fra springen en L). Platene inkuberes i 20 timer ved 28 ° C.
    3. Overlegg hver plate med AMP (1,25 mg) og fosfomycin (5 mg) oppløst i 1 ml vann og la dem tørke. Inkuber platene i flere dager ved 28 ° C inntil exconjugants er synlige.
  3. Sjekk single-crossover mutanter
    1. Inokulere enkelt exconjugants i 20 ml TSB-medium (apramycin 50 mg ml-1) og inkubere dem ved 28 ° C i tre dager og 180 rpm.
    2. Isoler genomisk DNA 43 og sjekke avbrudd i pokPI genet ved PCR.
    3. Inokuler enkle kloner med kontrollert gen avbrytelse og Streptomyces vildtypestammen i 100 ml HA medium og inkuber dem i 6 dager ved 28 ° C og 180 rpm. Ekstraher det rå ekstrakt (se avsnitt 1.3). Sjekk sammensatte produksjon av HPLC-MS-analyse (se avsnitt 1.4). Den tilsvarende topp i HPLC-kromatogram og massen av forbindelsen bør ikke være påvisbart noe mer (se figur 6).

Figur 6
Figur 6: HPLC-analyse av S. diastatochromogenes med Inaktivert pokPI Gene. HPLC-kromatogram (λ = 430 nm) av rå ekstrakt av S. diastatochromogenes WT (øverst) og mutant-stamme med avbrutt pokPI -Gen (nedenfor). Mutantstammen produserer ikke polyketomycin lenger.Klikk her for å se en større versjon av dette tallet.

Representative Results

I denne oversikten vil vi beskrive de enkelte trinnene fra identifisering av antibiotika fører til sin biosyntetiske genet klynge. For mange år siden vi klonet et kosmid-bibliotek, pakket dem inn i fager, omformet E. coli-vertsceller, og måtte for å screene tusen kolonier for å identifisere de klonene som har overlappende regioner av polyketomycin klynge. Sekvensering av de kosmider var også en vanskelig og kostbar prosess 12.

For å gjennomføre videre studier på belastningen sekvensert vi hele genomet av Streptomyces diastatochromogenes Tü6028. Med utkastet genomsekvens vi lett identifiseres biosyntetiske genet klynge av polyketomycin og andre klynger som koder lovende forbindelser. Figur 7 sammenligner den "gamle" metode for å identifisere den biosyntetiske klynge ved kloning av et cosmid bibliotek og elaborative screening, ogden "nye" metoden hele genomsekvensering med påfølgende genom gruvedrift på en grov tidsskala. De nye sekvense teknologi og nye genomet gruve programmer fremskynde hele prosessen.

Figur 7
Figur 7: Sammenligning av den "gamle" og "nye" Måte Tildele en Biosyntetiske Gene Cluster. Den "gamle" fremgangsmåte omfatter kloning av et cosmid bibliotek med utvalg av positive kloner og sekvensering av de respektive kosmid (e) (ovenfor); Den "nye" Fremgangsmåten omfatter hele genomet sekvensering og -mining å identifisere alle sekundære metabolitter gensamlingene lokalisert på genomet av stammen (nedenfor). Varighet av enkle trinnene er vist på en grov tidsskala. Klikk her for å se en større versjon av dette tallet.

Discussion

I denne prøve et genomisk cosmid bibliotek av Streptomyces diastatochromogenes ble generert og vist for mange år siden, noe som resulterer i identifikasjonen av polyketomycin-klyngen gjennom en meget tidkrevende prosess. Karakterisering av enkeltgener var mulig ved hjelp av målrettede genet slettinger og analyse av de resulterende mutanter 12. Nylig ble et utkast genomsekvens S. diastatochromogenes innhentet tillater rask identifisering av polyketomycin biosyntetiske genet klynge. Vi kunne lett gjenkjenne biosyntetiske gener, selv om utkastet genomsekvens inneholder fortsatt mange contigs. Den beskrevne fremgangsmåte kan oppnås i løpet av måneder. Imidlertid omfatter fremgangsmåten mange trinn. Enkle trinn kan mislykkes flere ganger, og hindrer progresjon til påfølgende trinn:

Slekten Streptomyces er kjent for sin evne til å produsere bioaktive forbindelser. Mens de bærer ofte mer enn 20 biosynthetic gensamlingene, vanligvis bare en eller to forbindelser som er fremstilt under laboratoriebetingelser. Anvendelsen av OSMAC metoden (dyrking av en stamme under forskjellige betingelser) for å vekke opp stille gensamlingene noen ganger kan det ikke være nok. Genetisk manipulering av regulatoriske gener, slik som de pleiotrope regulatoriske gener ADPA 44 og bldA 45,46, er også en effektiv metode for å aktivere produksjonen av andre sekundære metabolitter.

For klarlegging av den sammensatte struktur, for eksempel ved NMR-analyse, er nødvendig vanligvis mer enn 2 mg av renset forbindelse. Derfor er gjæring av mer enn 10 l kultur ofte nødvendig. Uten en fermenter som er i stand til å opprettholde oksygen, pH og temperaturforhold, kan det være utfordrende i et lite laboratorium for å håndtere denne mengden av kultur og påfølgende utvinning. Under rensing, kan forbindelsen bli endret på grunn av oksydasjon, bestråling eller temperatur.Dessuten er flere rensetrinn anvendes, jo høyere er sjansen for degradering.

Ved å analysere strukturen av det naturlige produktet, og de klynger i genomet, noen ganger er det ikke så lett å finne passende klynge. For det første, hvis det bare er et utkast genomsekvens noen del av klyngen kan mangle. For det andre, ikke alle gener som er nødvendige for biosyntesen er i klyngen. For det tredje, noen ganger i en klynge er delt i to deler adskilt fra hverandre ved hjelp av flere kilobaser. For det fjerde kan det være vanskelig å avgjøre hvilken som er den riktige genet klyngen. Ved stor PKS type I eller NRPS systemer, hvor det er mulig å beregne antall extender enhetene basert på antall av moduler, eller til å identifisere de enkelte extender enhetene ved analyse av velge domener, viser det seg lett. Imidlertid, i tilfelle av gjentatte arbeidsenzymene prediksjonen av de syntetiserte forbindelsene er ofte ikke mulig, særlig hvis strai mer enn 40 gensamlingene. For det femte er naturen svært kompleks og full av ukjente forbindelser. Ofte biosyntesen er en blanding av ulike baner. Hvis den nye forbindelsen ikke er identifisert ennå, eller ikke er knyttet til en annen forbindelse, kan det være vanskelig å identifisere klyngen, å foreslå en modell biosyntese og å påvise den.

Når klyngen er identifisert, er det enkelt crossover teknikken en god og rask metode for å bekrefte hypotesen. PCR, kloning inn et selvmord vektor, konjugasjon, valg av positive kloner, og produksjon analysen er de eneste skritt som kreves. En ulempe med denne teknikken er at integrasjonen av vektoren i kromosomet er ikke stabil grunnet ytterligere rekombinasjonshendelser. Derfor, for ytterligere å analysere enkeltgener, er nøyaktige gendelesjoner nødvendig. Også det kan være vanskelig å manipulere Streptomyces stammer på genetisk nivå.

Den beskrevne fremgangsmåte kan tildeles to en hvilken som helst annen forbindelse fremstilt ved en Streptomyces-stamme eller en annen mikroorganisme. Kunnskapen om en biosyntetiske gen-klynge og dens syntetiserte sammensatte gir oss ytterligere muligheter til å modifisere allerede eksisterende molekyler med det formål å forbedre dem for kampen mot multiresistente patogener.

Materials

Name Company Catalog Number Comments
agar Carl Roth GmbH + Co. KG, Karlsruhe, Germany 5210.4
agarose Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6352.4
D-mannitol  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4175.1
glucose  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6780.1
LB  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X964.3
malt extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany X976.2
MgCl2 Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2189.1
Peptone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany
soy flour  W.Schoenemberger GmbH, Magstadt, Germany Hensec-Vollsoja
tryptic soy broth Carl Roth GmbH + Co. KG, Karlsruhe, Germany X938.3 Caso-Bouillon
yeast extract  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 2363.2
Solvents
Acetic acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 3738.5
Acetone  Carl Roth GmbH + Co. KG, Karlsruhe, Germany 9372.2
Acetonitrile Avantor Performance Materials B.V., Deventer, The Netherlands JT-9012-03
Dichlorofrom  Fisher Scientific GmbH, Schwerte, Germany 1530754
DMSO (Dimethyl sulfoxide) Carl Roth GmbH + Co. KG, Karlsruhe, Germany 4720.1
DMSO-d6 (Dimethyl sulfoxide-d6) 99.9 atom% D ARMAR Chemicals, Döttingen, Switzerland 15200.204
Ethyl acetate Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6784.4
Hydrochloric acid Carl Roth GmbH + Co. KG, Karlsruhe, Germany 6331.4
Methanol Carl Roth GmbH + Co. KG, Karlsruhe, Germany 7342.1
Enzymes
restriction enzymes New England Biolabs GmbH, Frankfurt am Main, Germany
polymerase  New England Biolabs GmbH, Frankfurt am Main, Germany
DNA Polymerase I Large (Klenow) Fragment Promega GmbH, Mannheim, Germany
Antibiotics
apramycin AppliChem GmbH, Darmstadt, Germany  A7682.0005
fosfomycin Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany P5396-50G
kanamycin Carl Roth GmbH + Co. KG, Karlsruhe, Germany T832.2
Plasmid/Vectors
pKC1132 Bierman et al. 1992
Primer 
pokPI_for TGATGGTGCCGCTGGCCATGG Primer to amplify fragment containing pokPI gene
pokPI_rev AGCGTTCACTGTTCCGCCCGAC
Bacterial strains
Bacillus subtilis COHN ATCC6051 Gram-positive test strain 
Escherichia coli ET12567 pUZ8002  MacNeil et al. 1992 strain for conjugation
Escherichia coli XL1 Blue Agilient Technologies, Santa Clara, USA Gram-negative test strain + cloning host 
Streptomyces diastatochromogenes Tü6028 Paululat et al., 1999 Polyketomycin producer
Online services
antismash (Antibiotics and Secondary Metabolite Analysis Shell) http://antismash.secondarymetabolites.org/ Detection of secondary metabolite gene cluster
BLAST (Basic Local Alignment Search Tool) http://blast.ncbi.nlm.nih.gov/Blast.cgi finds regions of similarity between biological sequences
GenDB https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb Annotation of ORFs 
MiBIG (Minimum Information about a Biosynthetic Gene cluster) http://mibig.secondarymetabolites.org/ Database of biosyntetic gene clusters
NaPDoS http://napdos.ucsd.edu/ Detection of seconary metabolite gene cluster
NCBI Prokaryotic Genome Annotation Pipeline http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ Annotation of ORFs 
NRPSpredictor http://nrps.informatik.uni-tuebingen.de/ Detection of NRPS domains
Prokka (rapid prokaryotic genome annotation) http://www.vicbioinformatics.com/software.prokka.shtml Annotation of ORFs 
RAST (rapid annotation using subsystems technology) http://rast.nmpdr.org/ Annotation of ORFs 
Other programs
Chem Station Rev. A.09.03 Agilent Technologies, Waldbronn, Germany Handling program for HPLC 
Clone Manager Suite 7 Scientific and Educational Software, Cary, USA Designing Cloning Experiment 
Newbler v2.8 Roche Diagnostics Alignment of sequencing reads
Machines 
Centrifuge Avanti J-6000, Rotor JA-10 Beckman Coulter GmbH, Krefeld, Germany
HPLC/MS Agilent Technologies, Waldbronn, Germany
_Autosampler: G1313A Agilent Technologies, Waldbronn, Germany
_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 µm) Agilent Technologies, Waldbronn, Germany
_Column:Xbridge C18 (100 mm × 4.6 mm; Particle size: 3.5 μm) Agilent Technologies, Waldbronn, Germany
_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 µm) Agilent Technologies, Waldbronn, Germany
_Degasser: G1322A  Agilent Technologies, Waldbronn, Germany
_Quarternary pump: G1311A Agilent Technologies, Waldbronn, Germany
_Diode array detector (DAD )G1315B (λ = 254 nm and 400 nm) Agilent Technologies, Waldbronn, Germany
_Quadrupole mass detector (MSD) G1946D(2-3000 m/z) Agilent Technologies, Waldbronn, Germany
rotary evaporator
_heating bath Hei-VAP Value/G3 Heidolph Instruments GmbH & Co.KG, Schwabach, Germany
_vacuum pump system SC 920 G KNF Global Strategies AG, Sursee, Switzerland
Other material
Sephadex LH20 GE Healthcare, 
Chromafil PVDF-45/15MS (pore size 0.45 µm; filter Ø15 mm) MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany
SPE column Oasis HLB 20 35 cc (6g) Waters GmbH, Eschborn, Germany 
E. coli  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Bacillus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g
Streptomyces sp. Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g
fungus  Carl Roth GmbH + Co. KG, Karlsruhe, Germany Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g
for agar plates add 2% agar

DOWNLOAD MATERIALS LIST

References

  1. Fleming, A. On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae. Br J Exp Pathol. 10, (3), 226-236 (1929).
  2. Lemke, A., Kiderlen, A. F., Kayser, O. Amphotericin B. Appl. Microbiol. Biotechnol. 68, (2), 151-162 (2005).
  3. Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. Daptomycin. Nat. Rev. Drug Discov. 2, (12), 943-944 (2003).
  4. Zakeri, B., Wright, G. D. Chemical biology of tetracycline antibiotics. Biochem. cell Biol. 86, (2), 124-136 (2008).
  5. Schatz, A., Bugle, E., Waksman, S. A. Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria. Exp. Biol. Med. 55, (1), 66-69 (1944).
  6. Burg, R. W., et al. Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob. Agents Chemother. 15, (3), 361-367 (1979).
  7. Egerton, J. R., Ostlind, D. A., et al. Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component. Antimicrob. Agents Chemother. 15, (3), 372-378 (1979).
  8. Walsh, C. T., Fischbach, M. A. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132, (8), 2469-2493 (2010).
  9. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination. J. Antibiot. (Tokyo). 51, (1), 26-32 (1998).
  10. Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.Tü6028. J. Antibiot. (Tokyo). 52, (2), 96-101 (1999).
  11. Momose, I., et al. Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities. J. Antibiot. (Tokyo). 51, (1), 21-25 (1998).
  12. Daum, M., et al. Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin. Chembiochem. 10, (6), 1073-1083 (2009).
  13. Bode, H. B., Bethe, B., Höfs, R., Zeeck, A. Big effects from small changes: possible ways to explore nature's chemical diversity. Chembiochem. 3, (7), 619-627 (2002).
  14. Wolfender, J. -L. HPLC in Natural Product Analysis: The Detection Issue. Planta Med. 75, (07), 719-734 (2009).
  15. Stahl, E. Thin-layer chromatography. A laboratory handbook. 2nd edition (1967).
  16. Snyder, L. R., Kirkland, J. J., Glajch, J. L. Preparative HPLC Separation. Pract. HPLC Method Dev. 616-642 (2012).
  17. Granath, K. A., Kvist, B. E. Molecular weight distribution analysis by gel chromatography on sephadex. J. Chromatogr. A. 28, 69-81 (1967).
  18. Jackman, L. M., Sternhell, S. Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry. Int. Ser. Org. Chem. (1969).
  19. Xian, F., Hendrickson, C. L., Marshall, A. G. High resolution mass spectrometry. Anal. Chem. 84, (2), 708-719 (2012).
  20. Metzker, M. L. Sequencing technologies - the next generation. Nat. Rev. Genet. 11, (1), 31-46 (2010).
  21. Tatusova, T., et al. Prokaryotic Genome Annotation Pipeline. NCBI Handb. 2nd Ed. (2013).
  22. Angiuoli, S. V., et al. Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation. OMICS. 12, (2), 137-141 (2008).
  23. Aziz, R. K., et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 9, 75 (2008).
  24. Overbeek, R., et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 42, 206-214 (2014).
  25. Brettin, T., et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 5, 8365 (2015).
  26. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 30, (14), 2068-2069 (2014).
  27. Meyer, F. GenDB--an open source genome annotation system for prokaryote genomes. Nucleic Acids Res. 31, (8), 2187-2195 (2003).
  28. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, (3), 403-410 (1990).
  29. Madden, T. The BLAST Sequence Analysis Tool. NCBI Handb. 2nd Ed. Chapter 16 (2003).
  30. Marchler-Bauer, A., et al. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, (Database issue) 222-226 (2014).
  31. Medema, M. H., et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39, (Web Server issue) 339-346 (2011).
  32. Blin, K., et al. antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 41, (Web Server issue) 204-212 (2013).
  33. Weber, T., et al. antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, (W1) 237-243 (2015).
  34. Ziemert, N., et al. The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity. PLoS One. 7, (3), 34064 (2012).
  35. Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res. 33, (18), 5799-5808 (2005).
  36. Röttig, M., et al. NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39, (Web Server issue) 362-367 (2011).
  37. Medema, M. H., et al. Minimum Information about a Biosynthetic Gene cluster. Nat. Chem. Biol. 11, (9), 625-631 (2015).
  38. Mullis, K., et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51, Pt 1 263-273 (1986).
  39. Bierman, M., et al. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 116, (1), 43-49 (1992).
  40. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli.using the heat shock method. J. Vis. Exp. (6), e253 (2007).
  41. Bimboim, H. C., Doly, J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, (6), 1513-1523 (1979).
  42. MacNeil, D. J., et al. Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector. Gene. 111, (1), 61-68 (1992).
  43. Pospiech, A., Neumann, B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet. 11, (6), 217-218 (1995).
  44. Makitrynskyy, R., et al. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin. Open Biol. 3, (10), 130121 (2013).
  45. Kalan, L., et al. A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene. Chem. Biol. 20, (10), 1214-1224 (2013).
  46. Gessner, A., et al. Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains. ChemBioChem. 16, (15), 2244-2252 (2015).
Fra et naturlig produkt til sin Biosyntetiske Gene Cluster: En demonstrasjon Bruke Polyketomycin fra<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).More

Greule, A., Zhang, S., Paululat, T., Bechthold, A. From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028. J. Vis. Exp. (119), e54952, doi:10.3791/54952 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter