Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Generering av fluorescerande protein Fusioner i doi: 10.3791/55333 Published: March 4, 2017

Summary

PCR-medierad gen modifiering kan användas för att generera fluorescerande proteinfusioner i Candida species, vilket underlättar visualisering och kvantifiering av jästceller och proteiner. Häri presenterar vi en strategi för att konstruera ett fluorescerande protein fusion (Eno1-FP) i Candida parapsilosis.

Abstract

Candida-arter, förhärskande kolonisatörer av tarm och urogenitala regionerna, är orsaken till de flesta av invasiva svampinfektioner hos människor. Således, är molekylära och genetiska verktyg som behövs för att underlätta studier av deras patogenes mekanismer. PCR-medierad gen modifiering är en enkel och snabb metod för att generera epitopmärkta proteiner för att underlätta deras detektering. I synnerhet fluorescerande protein (FP) -fusioner är kraftfulla verktyg som tillåter visualisering och kvantifiering av både jästceller och proteiner genom fluorescensmikroskopi och immunoblotting, respektive. Plasmider innehållande FP-kodande sekvenser, tillsammans med närings-markörgener som underlättar omvandlingen av Candida arter, har genererats i syfte att FP konstruktion och expression i Candida. Häri presenterar vi en strategi för att konstruera en FP fusion i en Candida-arter. Plasmider innehållande nourseothricin tåligiou transformation markörgen (NAT1) tillsammans med sekvenser för antingen grönt, gult eller körsbärs bps (GFP, YFP, mCherry) används tillsammans med primrar som inkluderar genspecifika sekvenser i en polymeraskedjereaktion (PCR) för att generera en FP kassett . Denna gen specifika kassetten har förmåga att integrera sig i 3'-änden av den motsvarande genlocus via homolog rekombination. Framgångsrik i-ram fusion av FP-sekvensen in i genlocus av intresse verifieras genetiskt, följt av analys av fusionsprotein-expression genom mikroskopi och / eller metoder immuno-detektion. Dessutom, för fallet med höggradigt uttryckta proteiner, framgångsrika fusioner kan screenas för i första hand genom fluorescensavbildningstekniker.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Candida-arter är kommen svampar som koloniserar tarm och urogenitala skrifter av alla människor. Under förhållanden med nedsatt immunförsvar, såsom att inträffa med för tidig födsel eller immunsuppressiva effekter från behandlingar för cancer, kan Candida arter bli opportunistiska patogener. Av Candida arter, är Candida albicans den vanligaste svamp kolonisatör och orsakar majoriteten av invasiva svampinfektioner. Andra Candida arter såsom C. glabrata, C. parapsilosis, C. tropicalis och C. kruseii också orsaka allvarliga infektioner i patienter med nedsatt immunförsvar, med några uppvisar inneboende resistens mot vanligen använda anti-svamp antibiotika såsom flukonazol och amfotericin B. Därför infektioner med några av dessa arter följs oftare, särskilt hos patienter som behandlas profylaktiskt med antisvampmedel. Även med lämplig och snabb enNTI-svamp behandling, invasiva Candida infektioner fortsätter att förknippas med betydande morbiditet och mortalitet 1. På grund av betydelsen av Candida arter i människors hälsa, det finns ett behov av lättillgängliga molekylära verktyg som gör det möjligt att studera och klarlägga deras patogenes mekanismer.

Ett viktigt verktyg som gör det möjligt för forskarna att visualisera och kvantifiera mikrobiella celler och proteiner som de uttrycker är FP fusionsteknik. Polymeraskedjereaktion (PCR) -medierad genmodifiering, som beskrivs i detta dokument tillåter byggandet av fusioner mellan FP-sekvenser och en Candida proteinkodande sekvensen av intresse vid dess iska locus. Stabil integrering av konstruktionen underlättar analys av proteinuttryck samt proteinlokaliseringsdynamik. Plasmider innehållande FP-sekvenser, optimerad för uttryck i Candida albicans och som kan användas i PCR-medierad gene modifiering strategi, har tidigare konstruerats 2, 3, 4, 5. Plasmider innehåller FP transformations "kassetter": en FP-sekvens kopplad till en närings markörgen som underlättar omvandlingen av C. albicans och C. parapsilosis 2, 3, 4, 5, 6, 7. Närvarande tillgängliga plasmider innehåller en mängd olika selekterbara näringsmarkörgener (URA3, HIS1, ARG4) för transformation av auxotrofa stammar samt en dominerande läkemedelsresistensmarkör (NAT1), vilket underlättar omvandlingen av kliniska stammar som saknar auxotrophies. Dessutom plasmider innehåller alternativ för upp till fyra olika FP sekvenser (grön [GFP], yellow [YFP], cyan [GFP], och körsbär [mCherry]) och antingen en ADH1-termineringssekvens för konstruktion av karboxiterminus proteinfusioner, eller en promotorsekvens för konstruktion av amino-terminala proteinfusioner. Primrar är utformade med homologi med den plasmid-DNA som omger FP kassetten. Dessutom primers innehåller också 5'-förlängningssekvenser som bär homologi med jäst genen av intresse märkas, vilket underlättar integrering av kassetten i iska locus via homolog rekombination (figur 1). Genspecifika FP kassetter genereras med PCR och sedan omvandlas till Candida-celler som gjorts kompetenta för upptag av DNA genom behandling med litium-acetat.

Figur 1
Figur 1: Diagram över hur FP sekvensfusioner genereras i Candida. (A) Plasmid-DNA includes en FP-sekvens och en sekvens som kodar nourseothricin resistens (NAT1). Relativa lägen i Forward (FWD) och bakåt (REV) primers visas med svarta delar av primers indikerar regionen av homologi med plasmiden sekvens och lila delarna betecknar den genspecifika homologi region eller primerförlängning. (B) FP kassetter förvandlas till Candida och integrera i ENO1 iska locus via homolog rekombination (streckade linjer). (C), vilket gav FP fusionssekvensen vid 3'-änden av ENO1. Klicka här för att se en större version av denna siffra.

Häri presenterar vi ett exempel på proteinfusion (Eno1-FP) konstruktioner i Candida. Vi använder märkning plasmider innehållande NAT1 omvandling markörgen tillsammans med sekvenser som kodar för GFP, YFP, ellermCherry (Figur 2). Dessa plasmider används tillsammans med primrar i PCR för att generera genspecifika kassetter som underlättar fusion av ramprogrammen till 3'-änden av ENO1, vilket resulterar i expression av Eno1 fuserad till FP vid dess karboxiterminus.

figur 2
Figur 2: Kartor över FP kassettinnehållande plasmider. Framåt (F) och reverse (R) primrar som användes för att generera kassetterna från plasmiderna indikeras tillsammans med det relativa läget för deras homologi till plasmiderna. Primersekvenser är såsom anges i tabell 1. F1 och R1 användes också för att generera pYFP- NAT1 kassetten. Plasmiden innehållande YFP- NAT1 kassetten (pMG2263) är identisk med pMG2120 med undantag för YFP i stället för den GFP-sekvensen. Kassettstorlekar: GFP-NAT1, 3,7 kbp; mCherry- NAT1, 3,2 kbp; YFP- NAT1, 3.7 kbp. Denna siffra har modifierats Gerami-Nejad, et al. 4 Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Koppla mall plasmider från E. coli

  1. Växer E. coli innehållande mallen plasmiden över natten i 10 ml lysogeni buljong (LB) + 200 mg / L ampicillin (AMP) vid 37 ° C med skakning.
  2. Harvest cellerna genom centrifugering vid 6000 xg under 2 min.
  3. Dekantera vätskan, isolera och rena DNA från E. coli-celler medelst en standardmetod såsom beskrivits tidigare i Ausubel et al. 8.
  4. Resuspendera DNA i Tris-EDTA (TE; 10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0) vid en arbetskoncentration på 50-100 ng / ml.

2. Design Primrar

Primer primer sekvens
F1 5 ' GGTGGTTCTAAAGGTGAAGAATTATT 3 '
R1 5 'GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC
GTAAAACGACGGCCAGTGAATTC 3 '
F2 5 'GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG
GGTGGTGTTTCAAAAGGTGAAGAAGATAAT 3 '
R2 5 'GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC
ACTGGATGGCGGCGTTAGTATC 3 '

Tabell 1: Primersekvenser som används i denna studie. Fet kursiv text anger homologi med ENO1 iska locus, Normal text regioner homologa med plasmid DNA.

    <li> Design primrar vara homologa med plasmidsekvenser som gränsar till kassetten som skall förstärkas och till 3'-änden av målgenen av intresse (t.ex. ENO1) för att underlätta rekombination in i genens genomiska lokuset (Figur 2 och Tabell 1) .
    1. Se till att de främre primersekvenser matcha de sista 70 basparen (bp) av genen av intresse, 5'-3 ', minus stoppkodonet, för att upprätthålla den kodande ram, plus den första ca 30 bp av plasmiden sekvensen att vara amplifieras. Som en anteckning är GGTGGTGGTT i varje primer en poly-glycin länk utan FP homologi. Notera i avsaknad av en länk, kan det vara direkt fusion av funktionella domäner, vilket teoretiskt kan leda till protein misfolding, låg avkastning i proteinproduktion eller nedsatt bioaktivitet.
    2. Se till att omvända primersekvenser är 70 bp strax nedströms genen, 3'5 ', inte inklusive gensekvens, plus den sista förekommandeximately 30 bp av den näringsmässiga eller läkemedelsresistensmarkör används i plasmiden.
    3. Användning F1 och R1 för att generera GFP- NAT1 och YFP- NAT1 kassetter med pMG2120 och pMG2263, respektive och F2 och R2 för att generera mCherry- NAT1 med pMG2343.

3. Skapa FP Kassetter med PCR (Dag 1)

  1. Förbered reagenser för PCR. Gör en huvudblandning (500 pl slutlig volym) genom att lägga till följande volymer och koncentrationer till ett 1,5 ml rör: 50 ul PCR-buffert (500 mM kaliumklorid, 100 mM Tris pH 8,0 i vatten), 20 pl deoxinukleotider (dNTP; lager blandning av nukleotiderna vid 10 mM vardera), 40 | il 25 mM magnesiumklorid, 20 | j, l renad plasmid (från ~ 50 till 100 ng / pl stamlösning), 10 ^ il vardera framåt och bakåt primer (från 10 mM förrådslösningar), 30 | j, l Taq polymeras (generiskt, 5000 enheter / ml) och 320 pl vatten.
    1. Alikvotera 50 ul av masterblandning i vart och ett av 10 PCR-compatible 0,5 ml rör.
  2. Placera PCR-rör i termo och köra följande steg: en cykel av 5 min vid 94 ° C för att denaturera dsDNA; 40 cykler i följd av 45 sek vid 94 ° C, 30 sek vid 55 ° C för att tillåta primers att hybridisera till plasmiden mall-DNA, och 4 minuter vid 68 ° C under förlängning av DNA-produkter; och en slutlig förlängning cykel av 15 min vid 72 ° C.
    OBS: PCR Master Mix och cykelparametrar kan behöva modifieras baserat på den särskilda Taq-polymeras användes.
  3. Pool alla produkter från de 10 PCR-reaktioner i en 1,5 ml rör.
    1. Subject 5 pl av poolade PCR-produkt för agarosgelelektrofores för att kontrollera amplicon storlek och få en uppskattning av produktkoncentrationen, baserad på jämförelse med en DNA-stege. Generellt använder ~ 250 mikrogram av kassett-DNA i varje efterföljande transformationsblandningen.
    2. Fälla ut DNA genom tillsats av 50 | il 3 M natriumacetat följt av 750 | il 95% etanol för att de produkter och inkubera i minst 30 minvid -20 ° C.
    3. Skörda PCR-produkter genom att centrifugera röret vid 16.000 xg under 10 min. Försiktigt bort och kassera supernatanten och torka pelleten över natten. Återsuspendera den torkade DNA-kassett pelleten i 40 | il TE pH 8,0 och lagra vid rumstemperatur fram till användning.

4. Omvandla Candida Celler med FP DNA-kassetter

  1. På dag ett, återhämta jäststam som skall transformeras från en 15% glycerol fryst (-80 ° C) lager av strimmor några skrapade kristaller på jäst pepton dextros med adenin (YPAD) agar och inkubera vid 30 ° C. Efter återvinning av kolonitillväxt, inokulera en enda koloni i 2 ml flytande YPAD-medium i en glas odlingsrör med andningsbar lock och inkubera över natten vid 30 ° C under omröring.
  2. På dag 2, späd 300 | il av över natt jästkultur i 50 ml färskt YPAD (till en slutlig OD 600 på ~ 0,2) i en 125 ml Erlenmeyer-kolv med en andningsbar cap. Skaka vid 30 ° Cför ~ 3 h (till en slutlig OD 600 ~ 0,6-0,8).
    1. Häll över natt-kulturen i en 50 ml koniskt rör och pelletera cellerna genom centrifugering under 5 min vid en 500 x g i en bordscentrifug.
    2. Häll av och korrekt kassera supernatanten. Resuspendera cellpelleten i 5 ml vatten. Re-pellets cellerna genom centrifugering igen under 5 minuter vid 1500 xg i en bordscentrifug.
    3. Häll av och korrekt kassera supernatanten. Resuspendera cellerna i 500 | j, l TELiAc (TE litiumacetat: 10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0, 0,1 M litiumacetat) samtidigt förflyttas till en 1,5 ml rör. Centrifugera röret under 2 min vid 3000 xg i en mikrocentrifug.
    4. Resuspendera cellerna i 250 | j, l TELiAc. Den totala volymen inklusive pelleten bör vara ~ 300 | il.
  3. Till en ren (annan mikrofugrör än i 4.2.4), tillsätt 5 l bärar-DNA (10 mg / ml) och 150 pl beredda Candida-celler (från 4.2.4). Detta är den negativa kontrollen för transformation.
    1. Till en andra ren mikrofugrör, tillsätt 5 | il denaturerat bärar-DNA (som har kokas vid 90 ° C under 10 minuter och kyldes till 4 ° C), alla 40 | il av den framställda PCR-produkten (från 3.3.1) och 150 pl förberedda Candida celler (från 4.2.4).
    2. Inkubera de två omvandlingsBlandningar 30 minuter vid rumstemperatur.
    3. Till varje transformationsblandningen rör, tillsätt 700 | il PLATE blandning (10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0, 0,1 M litiumacetat i 50% polyetylenglykol 3350). Invertera rören för att blanda och inkubera dem över natten vid RT.
  4. På dag 3, inkubera omvandlingen blandar vid 42 ° C under 1 h (värmechock).
    1. Centrifugera omvandlingen blandar under 30 sekunder vid 16000 x g i en mikrocentrifug. Ta bort och korrekt kassera supernatanten. Resuspendera var och en av cellpellet i 150 | il vatten genom att försiktigt pipettera upp och ned så att det inte skadar cellerna.
    2. För transformationer UTilizing auxotrofa markörgener (t ex URA3), plåt varje hela blandningen genom att pipettera lösningarna på lämpliga selektiva media agar (t.ex. saknar uridin) och sprida blandningen jämnt med sterila glaspärlor.
    3. För transformationer som utnyttjar nourseothricin resistens markörgen (NAT1), såsom beskrivits här, blandar plattan omvandling först på icke-selektiv YPAD agar och inkubera vid 30 ° C under 6-12 h. Detta steg hjälper till vid cellåtervinning, post värmechock, före nourseothricin spänning anbringas.
    4. Efter partiell tillväxt återhämtning, replika platta Candida celler på YPAD innehållande 400 mikrogram / ml nourseothricin. För transformationer som använder näringsmarkörgener (t.ex. URA3), behövs inte denna mellan plätering steg och celler kan direkt ströks ut på selektiva jästmedia (t.ex. YPAD saknar uridin) som beskrivs i 4.4.2.
      OBS: Om omvandlingen är framgångsrik, colonies ska visas inom en till tre dagar (eventuellt upp till fem dagars utväxt för val på nourseothricin innehållande agar). Inga kolonier ska visas på plattor sprids med omvandlingsblandningar som innehåller bärar-DNA enbart (negativ kontroll).
  5. För auxotrof och nourseothricin markör selektion, strimmig förmodade transformanter som enstaka kolonier till färskt selektivt medium agarplattor och inkubera vid 30 ° C för att propagera jästceller som kan screenas för framgångsrik konstruktion av FP-fusioner.
  6. Skärmtransformanter för korrekt integrering av den märkning kassetten (se Representativa resultat för ett detaljerat exempel). Om den intressanta genen uttrycks vid tillräckliga mängder, kan hela kolonin fluorescens inträffar så att det är möjligt att detektera potentiella kandidat integranter med användning av en plattavbildningssystem med fluorescensdetektion förmåga.
    1. Kontrollera förmodade integranter genom PCR med användning av primrar homologa med sekvenser outside av regionen av integration för att bekräfta fusion till målgenen.
    2. Dessutom anser Western blot-analys för att bestämma uttrycket och storlek av fusionsproteinet, såväl som genom fluorescensmikroskopi av enstaka celler för visuell bekräftelse av proteinlokalisering, om den är känd.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Som ett exempel har vi använt det protokoll som beskrivits ovan för att konstruera GFP och mCherry fusioner till Eno1 i en C. parapsilosis laboratoriestam. Varje förmodade trans ursprungligen ströks för tillväxt. I det här exemplet, eftersom den resulterande fusionsproteinet uttrycks kraftigt (enolas) och FPS är ljusa, kunde vi screena transformanter genom fluorescensmikroskopi före utföra diagnostisk PCR (Figur 3) 6.

Figur 3
Figur 3: Colony fluorescens som uppvisas av Candida anter. Representativa bilder av jäst platta tillväxt erhålls med hjälp av en laserskanningssystem utrustat med en Cy3 filter för att avbilda mCherry-uttryckande stammen och en Cy2 filter för att avbilda YFP- och GFP-uttryckande stammar. Vänstra panelen i varje par, FP-expressing-stammar; högra panelen i varje par, icke-transformerade föräldrastammen (4175) avbildas med samma filter som motsvarande FP-uttryckande stam. Efter visualisering, var bilderna inverterade och ljusstyrka och kontrast justerades identiskt för FP-uttryckande och kontrollstammar. Denna siffra återges med tillstånd från Gonia, et al. 6 Klicka här för att se en större version av denna siffra.

Genomiskt DNA isolerades 9 från var och en av dessa förmodade transformanter och användes som DNA-mallen, tillsammans med primrar som är komplementära till sekvenser som flankerar ställena för kassett integration (dvs sekvenser utanför där F och R primers annelerar i den avsedda genomiska lokus som skall märkas) i diagnostiska PCR för att kontrollera korrekt integrering av FP kassetten bara prIOR till stoppkodonet av genen av intresse. Notera för litiumacetat transformationer med C. parapsilosis, observerade vi lägre effektivitet (~ 1-2% av kolonier screenade innehöll en korrekt integrering) jämfört med vår erfarenhet med C. albicans transformationer.

För att analysera enolas lokalisering, observerade vi jästceller som uttrycker Eno1-FP-konstruktioner genom fluorescensmikroskopi med användning av en fotomikroskop utrustad med en 100 W kvicksilverlampa och epifluorescence belysning med GFP, YFP och Texas Red filteruppsättningar. En charge-coupled device (CCD) kamera användes för att samla in bilder som bearbetats med bildanalysmjukvara (figur 4A) 6. Dessutom fann vi att olika FP färger var användbara för att visuellt särskilja olika jäststammar inom en blandning (figur 4B) 6. Eftersom enolas uttrycks kraftigt och ligger ien stor del av jästcellen, kan FP fusioner till den användas för att generera fluorescerande jäststammar som lätt kan visualiseras, till exempel, i analyser av Candida -host interaktioner.

figur 4
Figur 4: Expression och lokalisering av Eno1-FP-fusioner genom fluorescensmikroskopi. (A) Fluorescens (överst) och differential interferens kontrast (DIC, botten) bilder för Candida stammar som uttrycker Eno1-FPS. Eno1-FP i C. albicans och C. parapsilosis tenderar att koncentreras i kärnan såväl som i cytoplasman, men i mycket lägre grad. (B) mikroskopiska bilder av en blandad kultur av Candida stammar som uttrycker Eno1-mCherry och Eno1-GFP. Högra panelen Texas röd filter; center panel, GFP filter; högra panelen, slå samman de båda fluorescerande paneler med DIC bilden. Skalstrecken = 10 | j, m. Denna siffra återges med tillstånd från Gonia, et al. 6 Klicka här för att se en större version av denna siffra.

FP fusioner underlättar även analys av proteinuttrycksnivåer med Western blotting. Med användning av jästceller som genereras av det protokoll som beskrivits ovan, överfördes proteiner isolerade från cellysat, separerades genom natriumdodecylsulfat-polyakrylamidgelelektrofores (SDS-PAGE), och överförs till en polyvinylidendifluorid (PVDF) membran 10. Eno1-FP fusioner upptäcktes på blottarna med användning av kommersiellt tillgängliga antikroppar som tidigare beskrivits 6. Kortfattat, mus-anti-GFP (1: 2000 spädning), följt av pepparrotsperoxidas-konjugerad get-anti-mus-IgG (1: 10000 utspädning) antikroppar användes för att sondera för GFP- och YFP-tagged enolas. Kanin-anti-mCherry (1: 2000 spädning) följt av pepparrotsperoxidas-konjugerad get-anti-kanin-IgG (1: 10000 utspädning) antikroppar användes för att sondera för mCherry-märkta enolas. Alla fusionsproteiner lätt detekteras från lysat av framgångsrika transformanter (figur 5, spår 2, 5 och 7) 6 och var av förväntad storlek (~ 75 kDa) i jämförelse med ett protein stege standard och C. albicans enolas-FP standarder ( figur 5 är bana 1 och 6) 6. Ingen signal observerades för omärkta moderjäststam (Figur 5, raderna 3 och 4) 6.

figur 5
Figur 5: Immunoblot av cellysat från Candida stammar. Bana 1, C. albicans innehåller ENO1 -mCherry fusion (J. Berman, University of Minnesota)(Positiv kontroll); spår 2, C. parapsilosis innehållande ENO1 -mCherry fusion; spår 3 och 4, otransformerad C. parapsilosis moderstammen 4175 11 (negativ kontroll); spår 5, C. parapsilosis innehållande ENO1 -YFP fusion; bana 6, C. albicans innehåller ENO1 -GFP fusion (J. Berman, University of Minnesota) (positiv kontroll); lane 7, C. parapsilosis innehållande ENO1 -GFP fusion; bana L, protein stege med 98 och 64 kDa proteinstandarder anges. Raderna 1-3 inkuberades med anti-mCherry antikropp och banorna 4-7 inkuberades med anti-GFP-antikropp. Denna siffra återges med tillstånd från Gonia, et al. 6 Klicka här för att se en större version av denna siffra.

Protokoll Step / Föremål Modifiering Potentiell förbättring (varningar)
primer design Förlänga primers genom att ta längre region av homologi med genomisk lokus av intresse Förbättra bindningseffektivitet och homolog rekombination (modifierande primer längd kan förändras optimala glödgningstemperaturer)
PCR (amplikon kvalitet) Använd högre trohet Taq
Gel rena PCR-produkten
Minska införande av fel i kassettsekvenser för att förbättra målsökning av primer till arvsmassa och transformationseffektivitet (gelrening kan minska amplikon kvantitet och därmed omvandlingseffektiviteten)
PCR (amplikon kvantitet) Öka antalet PCR-reaktioner och poolprodukter increase antalet transformerade celler (för mycket amplikon kan också resultera i minskad transformationseffektivitet)
kassett utfällning Utför centrifugering vid 4 ° C, hålla alla reagenser och rör på is Öka DNA avkastning och därmed omvandlingseffektiviteten
Värme shock Förkorta den tid Förbättra lönsamheten stressade jästceller (kortare värmechock gånger kan också leda till minskat upptag av DNA-kassett av celler)
Återhämtning Tillväxt 1 Tillåt längre återhämtning på YPAD agar innan plätering agar innehållande nourseothricin Stressade jästceller kan behöva längre återhämtningstider när de utsätts för nourseothricin (längre inkubationstider kan också öka föroreningen och falskt positiva transformant tillväxt)
Koloni Utväxt 1,2 Inkubera plattorna under längre tider (~ 5 d) stressed jästceller kan behöva längre inkubationstider för kolonitillväxt (längre inkubationstider kan också öka föroreningen och falskt positiva transformant tillväxt)
1 Specifikt för omvandlingar som använder NAT1 selektionsmarkör eller 2 transformationer av jäststammar som innehåller genetiska mutationer som påverkar tillväxt

Tabell 2: Vägledning för felsökning och optimering.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Konstruktion av epitopmärkt sekvenser i Candida-arter med hjälp av PCR-medierad genmodifiering strategi som beskrivs ovan kan sammanfattas som en process i tre steg. Först görs en kassett tillverkad genom PCR som kodar både den önskade för integrering och regioner homologa med den geometriska orten för insättning i jästgenomet sekvensen. För det andra är de jästceller som skall transforme göras kemiskt kompetenta med litiumacetat och saminkuberades med kassetten. Tredje cellerna ströks ut på selektiva media för att återvinna transformanter och resulterande kolonierna testas med avseende på korrekt integrering av kassetten till den önskade genomiska lokuset.

Det finns flera viktiga steg i detta protokoll för att förbättra andelen framgångsrika få en fluorescerande fusionsprotein i C. albicans och C. parapsilosis. Först, användning av primrar som har renats genom polyakrylamidgelelektrofores; är mycket rec (PAGE av tillverkaren)menderas. Utan rening, det finns en ökad sannolikhet för att erhålla primrar av felaktiga längder i den slutliga produkten, vilket skulle kunna minska effektiviteten med vilken kassetten integreras i den avsedda genomiska lokuset genom homolog rekombination. För det andra rekommenderar vi att ha kontrollerat att de PCR-genererade taggning kassetten är av hög kvalitet, genom att analysera ~ 5 | il av kassett-DNA genom agarosgelelektrofores för att säkerställa korrekt storlek av PCR-produkten. För det tredje, för att erhålla jästceller som är optimerade för transformation, bör cellerna i log tillväxtfas, med jäst knoppar uppenbara genom mikroskopi före deras användning. För det fjärde är det absolut nödvändigt att använda försiktig pipettering teknik under återsuspension av transformerade jästceller efter värmechock och före utstrykning på selektivt media. Femte, för trans val på nourseothricin, som är giftigt för jästceller, vilket möjliggör mer tid för tillväxt på YPAD agar innan replikera på nourseothricin innehållande medium kan vara benefofficiella att främja återvinning av transformanter. Sista, intakt plasmid och PCR kassett integration utanför av den avsedda genomiska läge inträffar vid låga frekvenser i Candida och kommer också att resultera i kolonitillväxt. Således är det nödvändigt att analysera alla transformerade kolonier med PCR med användning av primrar utanför den sekvens som används för integrering. För transformanter som kontrolleras av PCR men inte uppvisar fluorescens av mikroskopi, bör övervägas Western blot-analys av cellysat och sekvensering för att ytterligare undersöka orsaken till konstruktion eller visualisering misslyckande. Utöver dessa kritiska steg, det finns flera steg i protokollet som kan ändras, om det behövs, för att förbättra omvandlingseffektiviteten och öka frekvensen av korrekt integrering kassett. En felsökningsguide presenteras i tabell 2.

Det finns potentiella begränsningar av denna teknik som skulle kunna optimeras för framtida tillämpningar. den lithium acetat metod som används för DNA-transformation resulterar i en lägre effektivitet (~ 1-2% av kolonier screenade innehöll en korrekt integrering) för C. parapsilosis 12, jämfört med C. albicans. Elektroporation är ett alternativ till litium acetat omvandling som kan förbättra omvandlingseffektiviteten 13. Användning av ADH1 terminator, medan nödvändig för en universell märkning metod, kan förändra stabiliteten och / eller reglering av den genererade mRNA från den som skulle ha skett med de infödda terminatorsekvensen. Denna potential fråga måste övervägas när den nativa funktionen hos ett protein är viktig för den specifika frågeställningen. För fluorescerande fusionsproteiner som uttrycks vid låga nivåer, hela kolonin mikroskopi för att identifiera eller skärm för framgångsrika transformanter kan inte vara ett alternativ. I detta fall kommer PCR och Western blot-analyser ge bevis för lyckad fusionsprotein SEQUhet / proteinkonstruktion. En begränsning, som är gemensam för alla fusionsproteinkonstruktioner, är att epitopmärkningar kan störa den nativa funktionen hos proteinet, vilket resulterar i oönskade mutanta fenotyper, inklusive onormal lokalisering av fusionsproteinet. Behandling av dessa frågor är viktiga och lämpliga kontroller bör ingå som anges.

Plasmider användbara för att generera epitopmärkningar i Candida genom denna PCR-medierad tillvägagångssätt, förutom de som nämns här, har tidigare genererats av våra forskargrupper och är tillgängliga för forskare genom Fungal Genetics Stock Center (http: //www.fgsc. netto). Mer information om flera av dessa plasmider kan också hittas på (http://www6.tau.ac.il/berman/). De tillgängliga plasmider innehåller en myriad av kombinationer av närings- och läkemedelsresistensmarkörer, FP-sekvenser för att generera olika färgade jäst, andra epitop taggalternativ (HA, myc, V5, HIS9) för att generera proteiner som are taggade på antingen karboxi- eller amino-terminaler, och promotorsekvenser för konstitutiv och reglerbar uttryck av proteiner. Plasmider innehållande läkemedelsresistensmarkörer är särskilt fördelaktigt till området för svamp patogenes som detta verktyg gör det möjligt att transformationen och studier av kliniska jäststammar som är prototrofa, rendering konventionella näringsmarkörer oanvändbara. Konstruktionen av kliniska Candida-stammar som fluorescerar vid olika våglängder kommer att vara användbart för en mängd olika cellbiologiska analyser som kräver förmågan att visualisera och differentiera flera jäststammar i samodling.

Invasiv svampsjukdom på grund av Candida arter fortsätter att vara en betydande mänsklig hälsa utmaning som är svår att behandla och är förknippad med hög sjuklighet och dödlighet, särskilt i patienter med nedsatt immunförsvar 14, 15. Således, molekylära verktyg som gör forskningers att snabbare och enklare studera Candida species-värd interaktioner är av avgörande betydelse för att främja vår förståelse av Candida biologi och patogenes mekanismer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att lämna ut.

Acknowledgments

Vi tackar N. Dean för att ge den ursprungliga mCherry FP sekvens, M. Gerami-Nejad för konstruktionen av plasmider, B. Larson för tekniskt stöd, och T. Heisel för råd under utvecklingen av detta projekt. JB stöddes av Europeiska forskningsrådet Advanced Award 340.087 (RAPLODAPT). Mikroskopi och bildsystem tillhandahölls av University of Minnesota Pediatrics Foundation och University of Minnesota Imaging Center.

Materials

Name Company Catalog Number Comments
100 W mercury lamp CHIU Technical Corporation M-100T
95% Ethanol Any NA
Adenine Any NA
Ampicillin Any NA
Carrier DNA Ambion AM9680 Sheared Salmon Sperm DNA 10 mg/ml
CCD Camera Photometrics CoolSNAP HQ
Conical Tube Corning 430828 50 ml
Culture Tube Rotator New Brunswick 2013923 TC-8, or Any Culture Tube Rotator
Deoxynucleotides (dNTP) PCR Grade Any NA
Eppendorf Tubes Eppendorf 022363719, 022363212 0.5 ml, 1.5 ml
Erlenmeyer Flask Fisher Scientific 7250089 125 ml
Ethylenediaminetetraacetic Acid (EDTA) Any NA
Freezer (-80 °C) Thermo Electron Corporation ULT-1386-9-V Revco Ultima II
GFP, YFP and Texas Red Filter Sets Chroma Technology Corporation 49002, 86004v2, 49008
Glass culture tubes Fisher Scientific 1496126 75 mm
HRP goat anti-mouse antibody Santa Cruz Biotechnology SC-2005
HRP goat anti-rabbit antibody Santa Cruz Biotechnology SC-2301
Incubator (30 °C) Any NA
Lithium Acetate Any NA
Lysogeny Broth (LB) Media Any NA
Magnesium Chloride Any NA
Microcentrifuge Eppendorf 5415 D
Microscope Nikon E600 Nikon Eclipse E600
Microscope Image Analysis Software Universal Imaging Corporation 6.3r7 MetaMorph Software Series 6.3r7
Mouse anti-GFP antibody Roche 11814460001
Nourseothricin Fisher Scientific 50997939
PCR Thermocycler Applied Biosystems 9700 GeneAmp PCR System
PCR tubes BioExpress, GeneMate T-3035-1 0.2 ml
Polyethylene Glycol 3350 Any NA
Potassium Chloride Any NA
Rabbit anti-mCherry antibody BioVision 5993-100
Refrigerator (4 °C) Any NA
Sodium Acetate Any NA
Stereomicroscope Nikon SMZ1500
Table Top Centrifuge Labnet Z 400 Hermle Z 400
Taq DNA Polymerase Any NA
Tris(hydroxymethyl)aminomethane (Tris) Any NA
Vortex Mixer Scientific Industries SI-0236 Vortex Genie 2
Yeast Extract Peptone Dextrose (YPD) Media Any NA

DOWNLOAD MATERIALS LIST

References

  1. Bendel, C. M. Colonization and epithelial adhesion in the pathogenesis of neonatal candidiasis. Semin. Perinatol. 27, (5), 357-364 (2003).
  2. Gerami-Nejad, M., Berman, J., Gale, C. A. Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans. Yeast. 18, (9), 859-864 (2001).
  3. Gerami-Nejad, M., Dulmage, K., Berman, J. Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans. Yeast. 26, (7), 399-406 (2009).
  4. Gerami-Nejad, M., Forche, A., McClellan, M., Berman, J. Analysis of protein function in clinical C. albicans isolates. Yeast. 29, (8), 303-309 (2012).
  5. Gerami-Nejad, M., Hausauer, D., McClellan, M., Berman, J., Gale, C. Cassettes for the PCR-mediated construction of regulatable alleles in Candida albicans. Yeast. 21, (5), 429-436 (2004).
  6. Gonia, S., Larson, B., Gale, C. A. PCR-mediated gene modification strategy for construction of fluorescent protein fusions in Candida parapsilosis. Yeast. 33, (2), 63-69 (2016).
  7. Milne, S. W., Cheetham, J., Lloyd, D., Aves, S., Bates, S. Cassettes for PCR- mediated gene tagging in Candida albicans utilizing nourseothricin resistance. Yeast. 28, (12), 833-841 (2011).
  8. Ausubel, F. M., et al. Current Protocols in Molecular Biology. Wiley. New York. (1995).
  9. Wilson, R. B., Davis, D., Mitchell, A. P. Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J. Bacteriol. 181, (6), 1868-1874 (1999).
  10. Pulver, R., et al. Rsr1 focuses Cdc42 activity at hyphal tips and promotes maintenance of hyphal development in Candida albicans. Eukaryotic Cell. 12, (4), 482-495 (2013).
  11. Falgier, C., et al. Candida species differ in their interactions with immature human gastrointestinal epithelial cells. Pediatr. Res. 69, (5), 384-389 (2011).
  12. Nosek, J., et al. Genetic manipulation of the pathogenic yeast Candida parapsilosis. Curr. Genet. 42, (1), 27-35 (2002).
  13. Zemanova, J., Nosek, J., Tomaska, L. High-efficiency transformation of the pathogenic yeast Candida parapsilosis. Curr. Genet. 45, (3), 183-186 (2004).
  14. Benjamin, D. K., et al. Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months. Pediatrics. 117, (1), 84-92 (2006).
  15. Kullberg, B. J., Arendrup, M. C. Invasive Candidiasis. N Engl J Med. 373, (15), 1445-1456 (2015).
Generering av fluorescerande protein Fusioner i<em&gt; Candida</em&gt; Arter
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gonia, S., Berman, J., Gale, C. A. Generation of Fluorescent Protein Fusions in Candida Species. J. Vis. Exp. (121), e55333, doi:10.3791/55333 (2017).More

Gonia, S., Berman, J., Gale, C. A. Generation of Fluorescent Protein Fusions in Candida Species. J. Vis. Exp. (121), e55333, doi:10.3791/55333 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter