Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Cyclin के आश्रित कळेनासे 1 विशिष्ट फास्फारिलीकरण साइटों की पहचान एक इन विट्रो कळेनासे परख

doi: 10.3791/57674 Published: May 3, 2018
* These authors contributed equally

Summary

Cyclin-निर्भर कळेनासे 1 (Cdk1) कोशिका चक्र के G2 चरण में सक्रिय है और कई सेलुलर रास्ते नियंत्रित करता है । यहां, हम Cdk1, जो इस महत्वपूर्ण कळेनासे के सेलुलर लक्ष्य स्थापित करने के लिए Cdk1-विशिष्ट फास्फारिलीकरण साइटों की पहचान की अनुमति देता है के साथ एक इन विट्रो कळेनासे परख के लिए एक प्रोटोकॉल मौजूद ।

Abstract

Cyclin-निर्भर कळेनासे 1 (Cdk1) सभी eukaryotes में सेल चक्र के लिए एक मास्टर नियंत्रक है और phosphorylates एक अनुमानित 8-13% proteome; हालांकि, विशेष रूप से मानव कोशिकाओं में Cdk1 के लिए पहचान लक्ष्यों की संख्या अभी भी कम है । Cdk1-विशिष्ट फास्फारिलीकरण साइटों की पहचान महत्वपूर्ण है, के रूप में वे यंत्रवत अंतर्दृष्टि प्रदान कैसे Cdk1 कोशिका चक्र को नियंत्रित करता है । सेल चक्र विनियमन वफादार गुणसूत्र अलगाव के लिए महत्वपूर्ण है, और इस जटिल प्रक्रिया में दोष गुणसूत्र विचलन और कैंसर के लिए नेतृत्व ।

यहां, हम इन विट्रो कळेनासे परख है कि Cdk1-विशिष्ट फास्फारिलीकरण साइटों की पहचान करने के लिए प्रयोग किया जाता है का वर्णन । इस परख में, एक शुद्ध प्रोटीन व्यावसायिक रूप से उपलब्ध मानव Cdk1 द्वारा इन विट्रो में phosphorylated है/cyclin बी सफल फास्फारिलीकरण एसडीएस द्वारा पुष्टि की है-पृष्ठ, और फास्फारिलीकरण साइटों को बाद में जन स्पेक्ट्रोमेट्री द्वारा की पहचान कर रहे हैं । हम भी शुद्धि प्रोटोकॉल है कि उच्च शुद्ध और सजातीय प्रोटीन कळेनासे परख के लिए उपयुक्त तैयार उपज का वर्णन है, और फास्फारिलीकरण साइटों की पहचान की कार्यात्मक सत्यापन के लिए एक बाध्यकारी परख है, जो के बीच बातचीत की जांच एक शास्त्रीय परमाणु स्थानीयकरण संकेत (cNLS) और उसके परमाणु परिवहन रिसेप्टर karyopherin α. प्रयोगात्मक डिजाइन के साथ सहायता करने के लिए, हम प्रोटीन दृश्यों से Cdk1-विशिष्ट फास्फारिलीकरण साइटों की भविष्यवाणी के लिए दृष्टिकोण की समीक्षा करें । एक साथ इन प्रोटोकॉल एक बहुत शक्तिशाली दृष्टिकोण है कि पैदावार Cdk1 विशिष्ट फास्फारिलीकरण साइटों और यंत्रवत अध्ययन में सक्षम बनाता है कैसे Cdk1 कोशिका चक्र को नियंत्रित करता है । इस विधि के बाद से शुद्ध प्रोटीन पर निर्भर करता है, यह किसी भी मॉडल जीव और पैदावार विश्वसनीय परिणाम के लिए लागू किया जा सकता है, खासकर जब सेल कार्यात्मक अध्ययन के साथ संयुक्त ।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kinases कि एंजाइमों सब्सट्रेट पर एटीपी से फॉस्फेट समूहों हस्तांतरण और कई सेलुलर प्रक्रियाओं को विनियमित कर रहे हैं. इस फास्फारिलीकरण प्रतिवर्ती है, तेजी से, दो नकारात्मक शुल्क कहते हैं, और मुक्त ऊर्जा भंडार है, और सबसे आम posttranslational कोशिकाओं द्वारा इस्तेमाल संशोधनों में से एक है । Cdk1, जो भी कोशिका विभाजन चक्र प्रोटीन 2 homolog (cdc2) के रूप में जाना जाता है सभी eukaryotes1,2,3,4,5, और phosphorylates एक में सेल चक्र के लिए एक मास्टर नियंत्रक है proteome6,7का अनुमानित 8-13% ।

जबकि हाल के proteomic अध्ययनों में प्रोटीन में कई फास्फारिलीकरण साइटों की पहचान की है, ज्यादातर मामलों में, इन संशोधनों के लिए जिंमेदार कळेनासे अज्ञात है । ज्ञात Cdk1 लक्ष्य की संख्या, विशेष रूप से मानव कोशिकाओं में कम है7. Cdk1-विशिष्ट फास्फारिलीकरण साइटों की पहचान महत्वपूर्ण है, क्योंकि यह यंत्रवत अध्ययन है कि स्थापित कैसे Cdk1 कोशिका चक्र को नियंत्रित करता है सक्षम बनाता है । सेल चक्र विनियमन वफादार गुणसूत्र अलगाव और कोशिका विभाजन के लिए महत्वपूर्ण है, और सेलुलर प्रक्रियाओं के असंख्य के लिए इस महत्वपूर्ण शारीरिक समारोह का समर्थन करने के लिए होने की जरूरत है । इस जैसे परमाणु लिफाफा, गुणसूत्र संघनित्र के विधानसभा, और mitotic धुरी विधानसभा का बँटवारा, के रूप में अच्छी तरह के रूप में सेलुलर संरचना और संगठन में एक नाटकीय पुनर्गठन के शुरू होने से पहले प्रतिलेखन और अनुवाद रोकने शामिल हैं । इन प्रक्रियाओं में विनियमन और त्रुटियों के कारण कैंसर, जंम दोष, या mitotic कोशिका मृत्यु । इस तरह के आरओ के रूप में Cdk1 के विशिष्ट अवरोधकों-३३०६ विकसित किए गए थे8, जो कार्यात्मक अध्ययन के लिए शक्तिशाली उपकरण प्रदान करते हैं, और इन अवरोधकों में से कुछ वर्तमान में कैंसर के उपचार के लिए नैदानिक परीक्षणों में कर रहे हैं (समीक्षा के लिए9 देखें).

यहां, हम इन विट्रो कळेनासे परख कि Cdk1-विशिष्ट फास्फारिलीकरण साइटों की पहचान की अनुमति देता है में एक का वर्णन । इस परख में, व्यावसायिक रूप से उपलब्ध मानव Cdk1/cyclin B को phosphorylate करने के लिए प्रयोग किया जाता है इन विट्रो मेंएक शुद्ध लक्ष्य प्रोटीन । एक सब्सट्रेट के फास्फारिलीकरण अपने द्रव्यमान बढ़ जाती है और दो नकारात्मक शुल्क कहते हैं; इसलिए, सफल फास्फारिलीकरण एसडीएस-पृष्ठ पर प्रोटीन जेल बैंड की एक ऊपर की ओर बदलाव से पुष्टि की है । Cdk1-विशिष्ट फास्फारिलीकरण साइटें बाद में मास स्पेक्ट्रोमेट्री विश्लेषण द्वारा की पहचान की जाती है इन विट्रो phosphorylated प्रोटीन । प्रयोगात्मक डिजाइन के साथ सहायता करने के लिए, हम भी गणना उपकरण और प्रोटीन अनुक्रम से Cdk1-विशिष्ट फास्फारिलीकरण साइटों की भविष्यवाणी के लिए संदर्भ की समीक्षा करें । इसके अलावा, हम भी शुद्धि प्रोटोकॉल है कि उच्च शुद्ध और सजातीय प्रोटीन कळेनासे परख के लिए उपयुक्त तैयारी उपज का वर्णन । अंत में, की पहचान की फास्फारिलीकरण साइटों कार्यात्मक अध्ययन द्वारा सत्यापित किया जाना चाहिए, और एक सरल बाध्यकारी परख यहां वर्णित है कि प्रयोजन के लिए । संयुक्त, यह एक बहुत शक्तिशाली दृष्टिकोण है कि पैदावार Cdk1-विशिष्ट फास्फारिलीकरण साइटों और कैसे Cdk1 सेल चक्र7,10,11नियंत्रण में यंत्रवत अध्ययन में सक्षम बनाता है । इस विधि के बाद से शुद्ध प्रोटीन पर निर्भर करता है, यह किसी भी मॉडल जीव और पैदावार विश्वसनीय परिणाम के लिए लागू किया जा सकता है । हालांकि, इन विट्रो में प्राप्त फास्फारिलीकरण साइटों के कार्यात्मक सत्यापन की सिफारिश की है, के रूप में कोशिकाओं के स्थान पर अतिरिक्त विनियामक तंत्र, जैसे posttranslational संशोधनों, संपर्क भागीदारों, या सेलुलर स्थानीयकरण है कि Cdk1 द्वारा मांयता के लिए पहुंच योग्य या पहुंच योग्य फास्फारिलीकरण साइट्स रेंडर कर सकते हैं ।

Cdk1 एक आम सहमति फास्फारिलीकरण साइट है कि (Ser/-प्रो एक्स-Lys/Arg), जहां एक्स किसी भी अवशेषों और एक serine या threonine है के होते है पहचानता फास्फारिलीकरण की साइट है । मांयता के लिए विशेष रूप से महत्वपूर्ण + 1 स्थिति में पंक्ति की उपस्थिति है । इसके अलावा, बुनियादी अवशेषों में + 3 स्थिति6,12पर एक Lys या Arg युक्त सबसे Cdk1-विशिष्ट फास्फारिलीकरण साइटों के साथ + 2 या 3 पदों, में पसंद कर रहे हैं ।

Cdk1 के सक्रियकरण कसकर विनियमित है और बँटवारा1,2,3,4,5की शुरुआत की ओर जाता है । सामांय में cyclin-निर्भर kinases की गतिविधि अलग cyclins (cyclin A, B, C, D, और मनुष्यों में ई) के साथ उनके सहयोग पर निर्भर करती है, जो कोशिका चक्र13भर में दोलन स्तर पर व्यक्त किए जाते हैं । Cdk1 अभिव्यक्ति सेल चक्र के पार स्थिर है और अपनी गतिविधि के विनियमन विनियामक उपइकाइयों cyclin एक और cyclin बी5,13,14,15के साथ अपने सहयोग पर निर्भर करता है, के रूप में अच्छी तरह से पोस्ट-शोधों संशोधनों के रूप में । Cdk1/cyclin बी कॉंप्लेक्स के गठन कळेनासे सक्रियण के लिए आवश्यक है5,14,15,16,17,18। G2 चरण में, cyclin B cytosol में अनुवादित की गई है और नाभिक में आयात किया जाता है जहां यह Cdk1 के लिए बाइंड कर देता है5,14,15,16,17,18; तथापि, Cdk1/cyclin ख के अवशेषों पर फास्फारिलीकरण द्वारा निष्क्रिय ठहराया जाता है Thr14 और Tyr15 द्वारा मानव Cdk1-निरोधात्मक kinases Myt1 (झिल्ली-संबद्ध tyrosine-और threonine-विशिष्ट cdc2-निरोधात्मक कळेनासे) और Wee1, क्रमशः19, 20,21. देर से G2 चरण में, सेल डिवीजन चक्र 25 फॉस्फेट (cdc25) द्वारा Thr14 और Tyr15 के dephosphorylation कळेनासे/Cdk1 बी परिसर के cyclin गतिविधि को सक्रिय करता है और बँटवारा12,14की दीक्षा से चलाता है, 18 , 20 , 22 , 23. Thr161 के फास्फारिलीकरण भी Cdk1/cyclin बी सक्रियण के लिए आवश्यक है और Cdk7 द्वारा मध्यस्थता है, Cdk-सक्रिय कळेनासे (कैक)18. anaphase में cyclin बी का क्षरण Cdk1 को निष्क्रिय करता है, बँटवारा२४,२५से बाहर निकलने की अनुमति. Cdk1/cyclin B के सक्रियकरण इसलिए एक जटिल प्रक्रिया है । प्रोटोकॉल यहां प्रस्तुत व्यावसायिक रूप से उपलब्ध Cdk1/cyclin बी के साथ किया जाता है । कीट कोशिकाओं में इस परिसर की रिकॉमबिनेंट अभिव्यक्ति के दौरान, यह अंतर्जात kinases14,20 द्वारा vivo में सक्रिय है और शुद्ध राज्य में सक्रिय रहता है । जिसके परिणामस्वरूप सक्रिय, रिकॉमबिनेंट मानव Cdk1/cyclin B के लिए उपयुक्त है इन विट्रो कळेनासे परख ।

यहां, हम मानव centromere प्रोटीन एफ में Cdk1-विशिष्ट फास्फारिलीकरण साइटों की पहचान के लिए एक प्रोटोकॉल का वर्णन (CENP-f)10। CENP-F एक kinetochore प्रोटीन है कि एक के दौरान नाभिक में रहता है (G1 और एस चरण) और G2 चरण में cytosol के लिए निर्यात किया जाता है26,27,28 एक Cdk1-निर्भर तरीके से10, 11. नाभिकीय स्थानीयकरण एक द्विपक्षीय cNLS26द्वारा संमानित किया गया है । cNLSs परमाणु परिवहन कारक karyopherin α, जो karyopherin β और RanGDP, cNLS-कार्गो के नाभिक में29के आयात के साथ की सुविधा के द्वारा मांयता प्राप्त कर रहे हैं । G2 के चरण में परमाणु निर्यात एक अज्ञात निर्यात मार्ग10के माध्यम से सुविधा है । एक बार CENP-एफ cytosol में रहता है, यह परमाणु लिफाफे में भर्ती है और बदले में मोटर प्रोटीन जटिल dynein30,31भर्ती । इस मार्ग में एक dynein-निर्भर तरीके से mitotic धुरी विधानसभा के प्रारंभिक चरणों के दौरान centrosome करने के लिए संबंधित नाभिक की स्थिति के लिए महत्वपूर्ण है, जो mitotic प्रविष्टि के सही समय के लिए और मस्तिष्क में एक मौलिक प्रक्रिया के लिए महत्वपूर्ण है विकास30,31,३२. G2 चरण में शुरू, CENP-F भी kinetochore में इकट्ठे हुए है जहां यह वफादार गुणसूत्र अलगाव के लिए महत्वपूर्ण भूमिका है27,28,३३,३४,३५ . इन रास्ते का एक महत्वपूर्ण नियामक कदम CENP के परमाणु निर्यात-G2 चरण में एफ, जो Cdk110,11पर निर्भर है । हम यहां CENP के cNLS में Cdk1-विशिष्ट फास्फारिलीकरण साइटों की पहचान के लिए एक प्रोटोकॉल का वर्णन एफ । इन साइटों के Phosphomimetic उत्परिवर्तनों CENP के परमाणु आयात-एफ नीचे धीमी, सुझाव है कि Cdk1/cyclin बी सीधे CENP के सेलुलर स्थानीयकरण को नियंत्रित करता है-फास्फारिलीकरण द्वारा अपने cNLS10के एफ ।

कुल मिलाकर, इस में इन विट्रो कळेनासे परख कळेनासे Cdk1 के लिए विशिष्ट सब्सट्रेट की पहचान की अनुमति देता है. शुद्ध लक्ष्य प्रोटीन व्यावसायिक रूप से उपलब्ध Cdk1 द्वारा इन विट्रो में phosphorylated कर रहे हैं/cyclin बी कॉंप्लेक्स और फास्फारिलीकरण साइटें बाद में जन स्पेक्ट्रोमेट्री द्वारा पहचाने जाते हैं. Cdk1-विशिष्ट फास्फारिलीकरण साइटों की पहचान यंत्रवत अध्ययनों का समर्थन करता है जो पता चलता है कि कोशिका चक्र को कैसे Cdk1 नियंत्रित करता है ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. प्रोटीन अनुक्रम से Cdk1-विशिष्ट फास्फारिलीकरण साइटों की भविष्यवाणी

  1. कळेनासे परख शुरू करने से पहले, भविष्यवाणी Cdk1-विशिष्ट फास्फारिलीकरण साइटों के लिए प्रोटीन अनुक्रम का विश्लेषण और अज्ञात कळेनासे विशिष्टता के साथ प्रयोग स्थापित फास्फारिलीकरण साइटों के लिए साहित्य खोज । सारांशित निंन उपकरण, डेटाबेस, और संदर्भ का उपयोग करें ।
    1. iGPS ३.० सॉफ्टवेयर३६,३७ (http://gps.biocuckoo.org/online_full.php) का उपयोग करने के लिए लक्ष्य प्रोटीन अनुक्रम में Cdk1 विशिष्ट फास्फारिलीकरण साइटों की भविष्यवाणी । एक व्यापक भविष्यवाणी है कि माध्यमिक संरचना और सतह पहुंच के एनोटेशन शामिल है के लिए यहां लिंक का उपयोग करें ।
    2. सॉफ्टवेयर में, फसता प्रारूप में प्रोटीन अनुक्रम दर्ज करें । कळेनासे विशिष्टता के लिए, जांच Serine/Threonine कळेनासे, CMGC, CDK, CDC2, CDK1, और अंय सभी विशिष्टताओं को अनचेक करें । सीमा के रूप में मध्यम का चयन करें और सबमिट बटन क्लिक करे ।
    3. Cdk1 आम सहमति फास्फारिलीकरण साइट के साथ परिणामी अनुमानित साइटों की तुलना करें (Ser/-प्रो एक्स-Lys/Arg) ।
    4. महत्वपूर्ण बात, phosphorylated अवशेषों के बगल में (कुछ Cdk1 सब्सट्रेट एक ंयूनतम साइट पर phosphorylated रहे है के लिए अनुमानित साइट की जांच करें (Ser/6,12) । इसके अलावा, बुनियादी अवशेषों के लिए जांच, कि + 2 या 3 पदों में पसंद कर रहे हैं, सबसे Cdk1-विशिष्ट फास्फारिलीकरण साइटों के साथ एक Lys या Arg से युक्त + 3 स्थिति में6,12
  2. इसके अलावा जांच करें कि साइट मांयता के लिए सुलभ है, के रूप में एक पूर्ण आम सहमति साइट की उपस्थिति Cdk1 फास्फारिलीकरण के लिए पर्याप्त नहीं है ।
    1. iGPS आउटपुट में सतह पहुंच क्षमता और द्वितीयक संरचना पूर्वानुमान एनोटेशन का निरीक्षण करें, जो यह बताता है कि साइट पर पहुंच की भविष्यवाणी की गई है या नहीं; एन-और सी-प्रोटीन के टर्मिनी कई मामलों में लचीला और फास्फारिलीकरण के लिए सुलभ हैं ।
    2. यदि लक्ष्य प्रोटीन की एक एक्स-रे संरचना उपलब्ध है, संरचना में उनके स्थान का निरीक्षण करके ख्यात फास्फारिलीकरण साइटों की पहुंच की जांच करें ।
  3. UniProtKB/स्विस-Prot डेटाबेस३८ (http://www.uniprot.org) का उपयोग करके अज्ञात कळेनासे विशिष्टता के साथ प्रयोगात्मक रूप से स्थापित फास्फारिलीकरण साइटों के लिए साहित्य खोजें ।
    1. खोज बॉक्स में प्रोटीन का नाम डालें और खोज बटन क्लिक करें । सही अनुक्रम प्रविष्टि का चयन करें । फास्फारिलीकरण साइटों व्याख्या और अमीनो एसिड संशोधनों अनुभाग में संदर्भित कर रहे हैं ।
    2. मानव कोशिका लाइनों के mitotic अर्क के प्रोटियोमिक् अध्ययन के लिए खोज7,३९,४०, जो विशेष रूप से उपयोगी होते हैं क्योंकि Cdk1 कोशिका चक्र के G2 चरण में सक्रिय हो जाता है.
  4. NLSmapper (ऐच्छिक) द्वारा द्विपक्षीय cNLS की पहचान करना ।
    नोट: cytosol और नाभिक, सेलुलर स्थानीयकरण के विनियमन के लिए एक आम तंत्र के बीच शटल प्रोटीन के लिए Cdk1 द्वारा प्रमुख आकृति की-1 स्थिति में एक द्विपक्षीय cNLS के फास्फारिलीकरण है । फास्फारिलीकरण G2 चरण10,४१,४२,४३में परमाणु स्थानीयकरण समाप्त ।
    1. ऐसे गढ़शंकर प्रोटीन के लिए NLSmapper४३ (http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi) द्वारा प्रोटीन अनुक्रम में cNLS की पहचान करें । प्रोटीन अनुक्रम को पाठ के रूप में चिपकाएं अनुक्रम बॉक्स में, ५.० के कट-ऑफ स्कोर का चयन करें, और संपूर्ण क्षेत्रमें एनएलएस के लिए खोज करने के लिए चुनें । एनएलएस पूर्वानुमान बटन क्लिक करें ।
    2. एक द्विपक्षीय cNLS के आम सहमति अनुक्रम के खिलाफ परिणामस्वरूप भविष्यवाणी cNLS की तुलना करें, जो मामूली आकृति (Lys-Arg) के होते हैं, एक linker कम से कम 10 अवशेषों, और प्रमुख आकृति (Lys-Lys/Arg-x-Lys/Arg), जहां X किसी भी अवशेष है कि नकारात्मक शुल्क नहीं है .
    3. अगर भविष्यवाणी Cdk1 फास्फारिलीकरण साइट की जांच करें (*) लिंकर के-1 स्थिति में प्रमुख आकृति के निकट स्थित है: Ser/---प्रो/x-x-Lys-Lys/Arg-x-Lys/Arg ।
      नोट: Cdk1 द्वारा-1 स्थिति में एक द्विपक्षीय cNLS के फास्फारिलीकरण की स्थापना कई गढ़शंकर प्रोटीन के लिए सेलुलर स्थानीयकरण के लिए एक विनियामक तंत्र के रूप में स्थापित किया गया था10,४१,४२, ४३.

2. ई कोलाई में रिकॉमबिनेंट प्रोटीन की अभिव्यक्ति

  1. ई. कोलाईमें रिकॉमबिनेंट प्रोटीन की अभिव्यक्ति के लिए कदम 2.1.1-2.1.2 से अभिव्यक्ति plasmids का प्रयोग करें ।
    1. बनाने के लिए मानव CENP-च (अवशेषों २,९८७-३,०६५) अभिव्यक्ति का निर्माण, पोलीमरेज़ चेन रिएक्शन (पीसीआर) द्वारा डीएनए टुकड़े बढ़ाना द्वारा आवेषण उत्पन्न एक पूर्ण लंबाई CENP-F निर्माण (GenBank प्रवेश: u 19769.1) से. निंनलिखित प्राइमरों का प्रयोग करें: AGTCGGGGATCCCAGCAATCTAAACAAGATTCCCG और AGTCGGCTCGAGTCATTATTCTGCAGGGTGAATACCACTCATG ।
      नोट: पूर्ण लंबाई मानव CENP-F प्लाज्मिड उदारता Dr. X. झू, जैव विज्ञान, चीनी विज्ञान अकादमी, शंघाई, चीन के लिए संस्थानों द्वारा प्रदान की गई थी ।
      1. क्लोन pGEX6p1 वेक्टर में BamHI और XhoI प्रतिबंध साइटों के साथ संमिलित करें । इस प्लाज्मिड का उपयोग CENP-एफ (अवशेषों 2987-3065) के एन-टर्मिनल glutathione एस-ट्रांस्फ़्रेज़ (जीएसटी) फ्यूजन प्रोटीन को व्यक्त करने के लिए करें ।
        नोट: जीएसटी-टैग को PreScission (इसके बाद के रूप में पीएस को छेड़ने के लिए भेजा) द्वारा बंद किया जा सकता है ।
    2. के लिए मानव karyopherin α अभिव्यक्ति का निर्माण, एक पूर्ण लंबाई karyopherin α2 सीडीएनए टेंपलेट से पीसीआर द्वारा डीएनए टुकड़े बढ़ाना द्वारा आवेषण उत्पंन (अनुक्रम प्रवेश nm_ 002264.3; प्राइमरों: GCACTACATATGTCCACCAACGAGAATGCTAATA और TCACGCCTCGAGTTATCAAAAGTTAAAGGTCCCAGGAGCC) ।
      नोट: isoforms की समानता के कारण, इस karyopherin α2 निर्माण karyopherin α के रूप में बाद के पाठ में संदर्भित किया जाता है ।
      1. क्लोन pET28a में डालें-दबाव वेक्टर NdeI और XhoI प्रतिबंध साइटों के साथ ।
        नोट: यह है एक संशोधित pET28a वेक्टर जिसमें अनुक्रम thrombin दरार साइट के लिए एंकोडिंग किसी अनुक्रम के द्वारा प्रतिस्थापित किया गया था जो encodes के लिए एक PS reटीज़ दरार साइट । इस प्लाज्मिड का प्रयोग करें एक एन के साथ karyopherin α का फ्यूजन प्रोटीन एक्सप्रेस-टर्मिनल अपने6टैग, जहां उसके6टैग पुनश्च चिढ़ा द्वारा बंद किया जा सकता है ।
  2. एक लक्ष्य प्रोटीन के बिंदु उत्परिवर्तनों बनाने के लिए, साइट प्रदर्शन एक किट के साथ mutagenesis निर्देश दिया ।
  3. बाद शुद्धि के लिए ई. कोलाई में रिकॉमबिनेंट प्रोटीन व्यक्त करते हैं ।
    1. निंनलिखित स्टॉक्स बनाएं: ५० मिलीग्राम/एमएल कनमीसिन (1:1000 स्टॉक समाधान), ३५ मिलीग्राम/एमएल क्लॉरॅंफेनिकोल ७०% इथेनॉल (1:1000), १०० मिलीग्राम/एमएल एम्पीसिलीन (1:1000), और 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG; 1:5000) ।
    2. -20 डिग्री सेल्सियस पर स्टॉक और स्टोर बाँझ फिल्टर । IPTG के लिए दोहराया फ्रीज-गल चक्र से बचें ।
    3. 1 µ एल की अभिव्यक्ति प्लाज्मिड में ५० µ एल के सक्षम कोशिकाओं के ई. कोलाई Rosetta 2 (DE3) pLysS तनाव, निर्माता के निर्देशों के अनुसार, को रूपांतरित करें ।
    4. Luria पर संस्कृति प्लेट-Bertani (पौंड) क्लॉरॅंफेनिकोल के साथ आगर (३५ µ जी/एमएल पौंड) और एम्पीसिलीन के लिए (१०० µ जी/एमएल पौंड) CENP-F construct के लिए, या क्लॉरॅंफेनिकोल और कनमीसिन (५० µ g/एमएल संस्कृति) के लिए karyopherin α के निर्माण के लिए । ३७ डिग्री सेल्सियस पर 12-20 ज के लिए प्लेटें मशीन ।
    5. एक ही कॉलोनी उठाओ और inoculate ५० मिलीलीटर के पूरक एंटीबायोटिक दवाओं के साथ (2.3.4 कदम देखें) । जबकि 160-180 आरपीएम पर 12-20 एच के लिए ३७ डिग्री सेल्सियस पर मिलाते हुए संस्कृति की गर्मी ।
    6. एक २,८०० मिलीलीटर चकित Fernbach कुप्पी में पौंड मध्यम के 1 एल तैयार करें । प्रत्येक संस्कृति के लिए दो कुप्पी बनाओ और उंहें आटोक्लेव । वातन की अनुमति देने के लिए, दो तिहाई से अधिक कुप्पी मात्रा तक कुप्पी को न भरें । Erlenmeyer कुप्पी के रूप में अच्छी तरह से इस्तेमाल किया जा सकता है ।
    7. एंटीबायोटिक्स जोड़ें (कदम 2.3.4) और एक बाँझ के 10 मिलीलीटर-फ़िल्टर ४०% (डब्ल्यू/वी) 1 के प्रति ग्लूकोज समाधान ठंडा पौंड के 1 l के प्रति संस्कृति के 20 मिलीलीटर जोड़ें ।
      नोट: संस्कृति के 1:10 कमजोर पड़ने के ६०० एनएम पर अवशोषक 0.15-0.2 के बीच होना चाहिए ।
    8. जबकि ३७ डिग्री सेल्सियस पर 160-180 आरपीएम पर मिलाते हुए कुप्पी गर्मी । नियमित रूप से जीवाणु संस्कृति के ६०० एनएम पर अवशोषक उपाय । अगर अवशोषक 0.5-0.6 तक पहुंचता है, तो ०.२ mM IPTG (२०० µ l को 1 M शेयर के 1 l पौंड मीडियम के प्रति) जोड़कर प्रोटीन एक्सप्रेशन प्रेरित करते हैं ।
      नोट: यह महत्वपूर्ण है कि कोशिकाओं को सही अवशोषक में प्रेरित कर रहे हैं । आमतौर पर इस मुकाम तक पहुंचने के लिए 3-4 ज लगते हैं ।
    9. जबकि ३७ डिग्री सेल्सियस पर 3 घंटे के लिए मिलाते हुए कुप्पी की मशीन । फसल (15 मिनट, ४,१०० एक्स जी, 4 ° c, स्विंग आउट रोटर) केंद्रापसारक द्वारा कोशिकाओं । supernatant को त्यागें । 20 मिलीलीटर जीएसटी-बाइंडिंग बफ़र (CENP-F) या उसके6-बाइंडिंग बफ़र (karyopherin α) में कक्ष छर्रों को पुनर्निलंबित करना संस्कृति के 1 L. -८० डिग्री सेल्सियस पर कोशिकाओं को संग्रहीत ।
      1. जीएसटी-बाइंडिंग बफ़र तैयार करें (25 डिग्री सेल्सियस पर 10 mM Tris pH ८.०, १५० मिमी NaCl, 1 मिमी dithiothreitol (डीटीटी), ०.५ मिमी EDTA) और अपने6बाध्यकारी बफर (10 मिमी Tris पीएच ८.० 25 डिग्री सेल्सियस, २५० मिमी NaCl, 5 मिमी Imidazole पीएच ८.०, 5 मिमी β-mercaptoethanol (BME)) अग्रिम में.

3. Glutathione-अपनत्व क्रोमैटोग्राफी और जेल निस्पंदन द्वारा रिकॉमबिनेंट प्रोटीन का शुद्धिकरण

  1. निंनलिखित स्टॉक्स बनाएं: 1 M डीटीटी (1:1000 शेयर, बाँझ ०.२ µ मीटर ताकना आकार के साथ फ़िल्टर, और degassed); २५० मिमी phenylmethylsulfonyl फ्लोराइड (PMSF; 1: dimethylsulfoxide में 1000 शेयर). -20 डिग्री सेल्सियस पर स्टोर । दोहराया फ्रीज-गल चक्र से बचें ।
  2. निम्न बफ़र्स बनाएँ और उन्हें 4 ° c करने के लिए शांत ।
    1. 25 ° c, १५० mm NaCl, 1 mm डीटीटी, ०.५ mm EDTA पर 10 mM Tris pH ८.० का उपयोग करके GST-बाइंडिंग बफ़र तैयार करें ।
    2. 25 डिग्री सेल्सियस, १५० mm NaCl, 1 mm डीटीटी पर ५० mm Tris pH ८.० के बफर में भंग किए गए 10 mm घटाए glutathione (०.१५ g/50 एमएल) का उपयोग कर GST-रेफरेंस बफर तैयार करें । पुष्टि करें कि अंतिम बफ़र का pH ८.० है और उसी दिन इसे बनाया गया था पर उपयोग ।
    3. 25 डिग्री सेल्सियस, ६० मिमी NaCl, 2 मिमी डीटीटी पर 20 मिमी Tris पीएच ७.५ का उपयोग जेल निस्पंदन बफर तैयार करें । एक बोतल टॉप फिल्टर (०.२ µ मी ताकना आकार) के साथ बफर फिल्टर । 15 मिनट के लिए वैक्यूम (-6 साई) के तहत सरगर्मी करते हुए बफर Degas ।
    4. उपयोग के दिन पर सभी उपरोक्त बफ़र्स करने के लिए डीटीटी जोड़ें ।
  3. CENP-F construct वाले खंड 2 से कक्षों को गल । वॉल्यूम को जीएसटी-बाइंडिंग बफ़र के साथ ४० mL में समायोजित करें । 1 एमएम डीटीटी, ०.२५ एमएम PMSF, ०.५ एमएम EDTA (०.५ मीटर स्टॉक सॉल्यूशन, पीएच ८.०), 7 एमजी benzamidine हाइडरोक्लॉराइड (1 एमएम), और ४० एमजी डी/एल methionine जोड़ें ।
    नोट: proteolytic गिरावट को कम करने के लिए, अधिमानतः एक ठंडे कमरे में, 4 डिग्री सेल्सियस पर सभी कदम प्रदर्शन, जब तक अंयथा उल्लेख किया । कोशिकाओं, lysates, और हर समय बर्फ पर शुद्ध प्रोटीन भागों रखें, और चिढ़ाने अवरोधकों जोड़ें । cysteine और methionine अवशेषों के ऑक्सीकरण को रोकने के लिए, प्रयोग के दिन पर डीटीटी और methionine जैसे reductants जोड़ें । proteolytic क्षरण को कम करने के लिए, कदम के माध्यम से जल्दी काम करते हैं ।
  4. किसी sonicator में कक्षों को निम्नानुसार लाइसे । lysate के साथ एक गिलास चोंच भरें और इसे एक बर्फ पानी स्नान में विसर्जित कर दिया । Sonicate संस्कृति (1 ंयूनतम ४० s, पर १०० W (५०%) आउटपुट/आयाम, 10 एस दालों और 10 एस आराम चक्र के साथ) । sonication के बाद २५० µ m PMSF जोड़ें । कक्ष lysate का निरीक्षण करें, जो अधिक पारदर्शी दिखना चाहिए और अब चिपचिपा नहीं होना चाहिए ।
  5. 12000-40000 x g, 25 मिनट, 4 ° c पर केंद्रापसारक द्वारा lysate साफ़ करें । गोल नीचे केंद्रापसारक ट्यूबों और एक निश्चित कोण रोटर का प्रयोग करें ।
  6. एक डिस्पोजेबल क्रोमैटोग्राफी कॉलम करने के लिए glutathione agarose 1:1 घोल के 2 मिलीलीटर जोड़कर equilibration प्रदर्शन करते हैं । परिणामी स्तंभ में 1 मिलीलीटर की मात्रा होगी । ultrapure पानी के 25 मिलीलीटर और GST बाध्यकारी बफर के 25 मिलीलीटर के साथ कॉलम धो लें ।
  7. इस रूप में बाइंडिंग निष्पादित करें । एक ठंडे कमरे या ठंड बॉक्स में काम कर रहे, छर्रों से lysate नहीं कर सकते । lysate फ़िल्टर (०.२ µm ताकना आकार) और इसे खामियों को दूर कॉलम पर डालना । स्तंभ कैप और यह गर्मी जबकि धीरे 4 डिग्री सेल्सियस पर 30 मिनट के लिए nutating ।
  8. कॉलम धोने के लिए, यह एक रैक पर डाल दिया, राल बसा दो, और के माध्यम से प्रवाह इकट्ठा । स्तंभ को दो बार GST-बाइंडिंग बफ़र के 25 मिलीलीटर के साथ धो लें ।
  9. Elute ने proteolytic क्लीवेज.
    1. स्तंभ प्लग करें । जोड़ें ४०० µ GST के एल-बाध्यकारी बफर और २५० µ एल पी एस की चिढ़ाना (2 mg/एमएल स्टॉक की एक गतिविधि के साथ १,००० U/mg, या तो लैब में शुद्ध या खरीदी; सामग्री की तालिकादेखें) ।
    2. स्तंभ कैप और धीरे से बफर में राल reसस्पेंड करने के लिए घूमता है । 4 डिग्री सेल्सियस पर 16-20 घंटे के लिए कॉलम की मशीन । तब elute के लिए proteolytically सट CENP-F अंश स्तंभ से 4 mL GST-बाइंडिंग बफ़र जोड़ें ।
  10. Glutathione रेफरेंस
    1. कॉलम प्लग, जीएसटी के 4 मिलीलीटर-रेफरेंस बफर (4 कॉलम मात्रा) जोड़ने के लिए, और 10 मिनट के लिए मशीन के लिए बाध्य जीएसटी-टैग elute । eluate लीजिए. निर्माता द्वारा वर्णित के रूप में पुन: उपयोग करने से पहले स्तंभ जनरेट करें ।
  11. PS चिढ़ाना रेफरेंस अंश का विश्लेषण और glutathione रेफरेंस अंश को एसडीएस-पेज द्वारा 16% acrylamide जैल पर । ४५ मिनट के लिए 25 वी/सेमी पर ट्रो प्रदर्शन Coomassie नीले रंग से जैल दाग । पुनश्च चिढ़ाने के अंश शुद्ध CENP-F अंश होते हैं, जबकि glutathione अंश में सट जीएसटी-टैग शामिल होगा । proteolytic क्लीवेज दक्षता का आकलन करने के लिए जेल का निरीक्षण करें ।
  12. एक 3 केडीए आणविक वजन कटऑफ के साथ केंद्रापसारक फिल्टर इकाइयों का उपयोग कर ०.५ मिलीलीटर के लिए पुनश्च चिढ़ाने eluate ध्यान दें ( सामग्री की तालिकादेखें). फिल्टर के ऊपरी डिब्बे में eluate जोड़ें, और यह 10-15 मिनट वेतन वृद्धि में ४,१०० x g, 4 ° c (स्विंग आउट रोटर) में नमूना ध्यान केंद्रित करने के लिए केंद्रापसारक । प्रत्येक वेतन वृद्धि के बाद pipetting द्वारा मिश्रण ।
  13. एक उपयुक्त जेल निस्पंदन कॉलम कनेक्ट (जानकारी खरीदने के लिए सामग्री की तालिका देखें) एक तेजी से प्रोटीन तरल क्रोमैटोग्राफी (FPLC) प्रणाली के लिए, और यह जेल निस्पंदन बफर के 1 कॉलम मात्रा के साथ equilibrate ।
  14. एक microcentrifuge (20 मिनट, २१,७०० एक्स जी, 4 डिग्री सेल्सियस) में केंद्रित CENP-F टुकड़ा केंद्रापसारक । कॉलम पर नमूना सुई और यह जेल निस्पंदन बफर के 1 कॉलम मात्रा के साथ elute । लीजिए ०.६ एमएल अंश ।
    नोट: जेल निस्पंदन बफर बाद कळेनासे परख के साथ संगतता के लिए अनुकूलित है । यदि लक्ष्य प्रोटीन इस बफर में स्थिर है परीक्षण । यदि यह स्थिर नहीं है, और अधिक सोडियम क्लोराइड जोड़ने की कोशिश करो ।
  15. एसडीएस द्वारा चोटी अंशों का विश्लेषण-पृष्ठ (३.११ कदम) । पूल पीक अंशों कि शुद्ध CENP-F टुकड़े होते हैं । ३.३ मिलीग्राम/एमएल (चरण ३.१२) के लिए शुद्ध CENP-F टुकड़े ध्यान केंद्रित । एसडीएस द्वारा शुद्ध CENP-F अंशों का विश्लेषण-पृष्ठ (चरण ३.११).
  16. प्रोटीन एकाग्रता निर्धारण
    1. ultrapure पानी में नमूना 1:100 पतला और यह एक क्वार्ट्ज माइक्रो cuvette में जगह है । एक spectrophotometer में 220-300 एनएम के एक तरंग दैर्ध्य सीमा पर स्पेक्ट्रा रिकार्ड ।
      नोट: प्रोटीन एकाग्रता सी (मिलीग्राम/एमएल) निंनलिखित समीकरण से व्युत्पंन है:
      Equation
  17. ०.५ मिलीलीटर microtubes में शुद्ध प्रोटीन के ५० µ एल aliquots बनाएं और फ्लैश- तरल नाइट्रोजन में उंहें फ्रीज । -८० ° c पर aliquots स्टोर ।

4. नी-ंत् अपनत्व क्रोमैटोग्राफी द्वारा रिकॉमबिनेंट प्रोटीन का शुद्धिकरण

  1. निम्न बफ़र्स और 4 ° c करने के लिए शांत करें ।
    1. अपने6बाध्यकारी बफर 25 डिग्री सेल्सियस, २५० मिमी NaCl, 5 मिमी Imidazole पीएच ८.०, 5 मिमी BME में 10 मिमी Tris पीएच ८.० का उपयोग कर तैयार करें । उपयोग के दिन पर सभी बफ़र्स के लिए BME जोड़ें ।
    2. अपने6-बाइंडिंग बफ़र के रूप में एक ही तरीके से अपने6-वाश बफ़र पर 20 mM Imidazole का उपयोग कर तैयार करें ।
    3. अपने6-रेफरेंस बफ़र को बाइंडिंग बफ़र के रूप में एक ही तरीके से तैयार करें लेकिन १५० mM Imidazole का उपयोग कर रहे हैं ।
  2. गल खंड 2 से कोशिकाओं है कि karyopherin α निर्माण और मात्रा को समायोजित करने के लिए अपने6बाध्यकारी बफर के साथ ४० मिलीलीटर । 5 mm BME, ०.२५० mm PMSF, 7 mg benzamidine हाइडरोक्लॉराइड (1 mm), और ४० mg D/L methionine जोड़ें ।
    1. निम्न रूपांतरों के साथ 3.4-3.8 चरणों में वर्णित के रूप में आगे बढ़ें: सभी चरणों के लिए अपने6-बाइंडिंग बफ़र के बजाय GST बाइंडिंग बफ़र का उपयोग करें । इसके बजाय glutathione agarose, निकल संबध जेल के 4 मिलीलीटर का उपयोग करें ( सामग्री की तालिकादेखें) कॉलम बनाने के लिए, जो 2 मिलीलीटर की एक कॉलम मात्रा होगा ।
      नोट: निकेल संबध कॉलम डीटीटी और EDTA के साथ असंगत हैं । इसके बजाय निकल अपनत्व जेल, Ni2 +-nitrilotriacetic एसिड (ंत्) agarose इस्तेमाल किया जा सकता है, अगर रेफरेंस बफर में imidazole एकाग्रता २५० mM ( सामग्री की तालिकादेखें) में वृद्धि हुई है ।
  3. अपने6-धोने बफर के 8 मिलीलीटर के साथ कॉलम धो लें
  4. Elute ने अपने6-रेफरेंस बफर की 12 एमएल के साथ karyopherin α और एसडीएस-पेज (स्टेप ३.११) से eluate का विश्लेषण किया ।
  5. PS के २५० µ l को जोड़कर छेड़ो (चरण ३.९) eluate करने के लिए और 4 डिग्री सेल्सियस पर 16-20 ज के लिए मशीन । इस बीच, dialyze के खिलाफ eluate दो बार अपने6-बाध्यकारी बफर के 2-20 एच के लिए, एक डायलिसिस झिल्ली का उपयोग कर के साथ एक 6-8 केडीए आणविक वजन cutoff.
  6. निकल संबध जेल स्तंभ निर्माता द्वारा वर्णित के रूप में पुन जनरेट करें । स्तंभ को उसके6-बाइंडिंग बफ़र के 25 मिलीलीटर के साथ Equilibrate । स्तंभ में dialyzed प्रोटीन जोड़ें और चरण ३.७ में बताए गए अनुसार बाइंडिंग चरण को पूरा करें ।
  7. के माध्यम से प्रवाह ले लीजिए, जो शुद्ध karyopherin α (अपने6-टैग के साथ बंद से सट), और elute शेष प्रोटीन के साथ अपने6बाध्यकारी बफर के एक अतिरिक्त 4 मिलीलीटर शामिल हैं । इन भागों पूल । इसके बाद अपने6-रेफरेंस बफर के 12 एमएल वाले कॉलम को elute । इस अंश में अशुद्धियां होती हैं ।
  8. विश्लेषित और सट karyopherin α से स्टेप्स 4.4-4.5 और दो रेफरेंस अंशों से इस कदम से एसडीएस-पेज (step ३.११) का विश्लेषण कर उसके6-टैग क्लीवेज और शुद्धता की कुशलता का मूल्यांकन करें ।
  9. ध्यान दें karyopherin α करने के लिए 8 मिलीग्राम/एमएल और फ्लैश- तरल नाइट्रोजन में फ्रीज (3.15-1, 5) ।

5. इन विट्रो कळेनासे परख with Cdk1/Cyclin B

  1. इन विट्रो कळेनासे परख
    नोट: कळेनासे के आगमन पर, छोटे aliquots बनाने के लिए, फ्लैश-तरल नाइट्रोजन में उन्हें फ्रीज और उन पर दुकान-८० ° c. 6 महीने के भीतर उपयोग करें । जबकि आणविक भार Cdk1 के लिए ३४ केडीए का है और ४८ केडीए के लिए cyclin बी, एसडीएस-पेज पर cyclin बी का स्पष्ट आणविक भार लगभग ६० केडीए का है.
    1. ०.५ एम Tris-एचसीएल, ०.१ एम MgCl2, 1 मिमी EDTA, 20 मिमी डीटीटी, ०.१% बृज ३५, पीएच ७.५ पर 25 डिग्री सेल्सियस का उपयोग कर 10x पीके बफर (कळेनासे के साथ आपूर्ति की) तैयार करें ।
    2. 10x एटीपी स्टॉक तैयार: 1x पीके बफर में 4 मिमी एटीपी का एक समाधान बनाओ, और शेयर के अंतिम पीएच की जांच करें । -20 डिग्री सेल्सियस पर छोटे aliquots में स्टोर और फ्रीज-गल चक्र से बचें ।
    3. मिश्रण ४० µ एल के CENP-F टुकड़ा (३.३ मिलीग्राम/एमएल की एकाग्रता पर, या ४०० µ m), 6 µ l 10x पीके बफर, 3 µ l ultrapure पानी, 6 µ l एटीपी 10x स्टॉक, और 5 µ l मानव Cdk1/cyclin बी (1 µ जी, १०० यू) में एक ०.५ मिलीलीटर microtube.
      नोट: CENP-F अंश में ८.६ केडीए और चार Cdk1-विशिष्ट फास्फारिलीकरण साइट्स का दाढ़ मास है. एक नया सब्सट्रेट के लिए, परख में कळेनासे एकाग्रता प्रोटीन की दाढ़ एकाग्रता के अनुसार और फास्फारिलीकरण साइटों की संख्या के अनुसार समायोजित करें । मानव रिकॉमबिनेंट Cdk1/cyclin B शेयर की गतिविधि २०,००० U/और विशिष्ट गतिविधि है १,०००,००० u/mg. 1 u Cdk1/cyclin B की राशि के रूप में परिभाषित किया गया है उत्प्रेरित करने के लिए आवश्यक 1 pmol के हस्तांतरण के लिए Cdk1 पेप्टाइड सब्सट्रेट PKTPKKAKKL-NH2 (५० µ m) 30 डिग्री सेल्सियस पर 1 मिनट में ( सामग्री की तालिकादेखें).
    4. Cdk1/cyclin B. के बिना एक नियंत्रण प्रतिक्रिया तैयार एक जल स्नान में 30 डिग्री सेल्सियस पर 1-16 ज के लिए प्रतिक्रियाओं ।
  2. कळेनासे परख प्रतिक्रिया और २.५ µ एल के नियंत्रण के २.५ µ एल का विश्लेषण करें एसडीएस-पृष्ठ (चरण ३.११), 16% acrylamide के साथ एक जेल का उपयोग कर । रिज़ॉल्यूशन बढ़ाने के लिए, चल रहे समय का विस्तार करें ।
  3. शेष कळेनासे परख प्रतिक्रिया करने के लिए 6 एम guanidine हाइडरोक्लॉराइड समाधान की एक बराबर मात्रा जोड़ें (और नियंत्रण के लिए) । अंतिम guanidine हाइडरोक्लॉराइड एकाग्रता 3 मीटर होगी । फास्फारिलीकरण साइटों की पहचान करने के लिए या नमूने के विश्लेषण के लिए एक जन स्पेक्ट्रोमेट्री सुविधा के लिए भेजने के लिए मास स्पेक्ट्रोमेट्री (धारा 6) द्वारा इन नमूनों का विश्लेषण, और फिर समारोह सत्यापन प्रदर्शन ( धारा 7) ।
    नोट: बाद के मास स्पेक्ट्रोमेट्री विश्लेषण के लिए, यह बहुत महत्वपूर्ण है कि व्यक्तिगत साइटों की फास्फारिलीकरण दक्षता के रूप में संभव के रूप में उच्च है, अधिमानतः १००%, के रूप में अंयथा फास्फारिलीकरण साइटों को मैप नहीं किया जा सकता है । बहुत फास्फारिलीकरण क्षमता बढ़ाने के लिए, Cdk1/cyclin बी की बड़ी मात्रा में जोड़ने के लिए और 16 एच के लिए मशीन समय बढ़ाएं । एटीपी की एकाग्रता भी दोगुनी हो सकती है ।
  4. समस्या निवारण के लिए, एक सकारात्मक नियंत्रण के रूप में CENP-F (अवशेषों 2987-3065) के इन विट्रो कळेनासे परख करते हैं । उच्च गतिविधियों के साथ Cdk1/cyclin बी के ताजा बैचों का प्रयोग करें ।

6. जन स्पेक्ट्रोमेट्री द्वारा Cdk1-विशिष्ट फास्फारिलीकरण स्थलों की पहचान

  1. करने के लिए प्रकृति और प्रोटीन के नमूनों को नमक, एक PLRP300 कॉलम के साथ microbore रिवर्स चरण तरल क्रोमैटोग्राफी प्रदर्शन ।
  2. CENP-f टुकड़ा में फास्फारिलीकरण साइटों की संख्या प्राप्त करने के लिए, इन विट्रो phosphorylated CENP-f ८४-मेर द्वारा electrospray ionization आयन ट्रैप मास स्पेक्ट्रोमेट्री (ईएसआई-ITMS)४४,४५में बरकरार विश्लेषण ।
  3. CENP-f के phosphoamino अम्ल स्थल स्थान का आकलन करने के लिए, इन विट्रो phosphorylated CENP-f प्रोटीन नमूनों की trypsin डाइजेस्ट तैयार करें । trypsin डाइजेस्टर को नमकीन प्लास्टिक टिप्स के साथ नमक डालें ।
  4. CENP के tryptic डाइजेस्टर का विश्लेषण-एफ द्वारा electrospray ionization रूपान्तर रूपांतरण आयन साइक्लोट्रॉन अनुनाद मास स्पेक्ट्रोमेट्री (ईएसआई-FTICR MS). १६९ µs का संचय समय के साथ एक ईएसआई-FTICR मास स्पेक्ट्रोमीटर पर विश्लेषण प्रदर्शन ।
    नोट: ईएसआई द्वारा निर्धारित जनता की सटीकता-FTICR MS ०.००५ एएमयू के भीतर है । कुल प्रोटीन राशि के लिए संबंधित प्रत्येक phosphorylated प्रजातियों के अनुपात का अंदाजा लगाने के लिए, बड़े पैमाने पर स्पेक्ट्रा की चोटी ऊंचाइयों का निर्धारण ।

7. कार्यात्मक सत्यापन: विश्लेषणात्मक आकार अपवर्जन क्रोमैटोग्राफी द्वारा प्रोटीन पर Phosphomimetic उत्परिवर्तनों के प्रभाव का परीक्षण प्रोटीन बातचीत

नोट: पहचाने गए Cdk1-विशिष्ट फास्फारिलीकरण साइट्स के कार्यात्मक सत्यापन के लिए, CENP के साथ पहचाने गए फास्फारिलीकरण साइट्स को बदलकर aspartates-F अंशों के phosphomimetic म्यूटेंट बनाए गए थे . aspartate के नकारात्मक प्रभारी फास्फारिलीकरण के प्रभाव की नकल । CENP-F टुकड़ा के एक S3048D उत्परिवर्ती (अवशेषों 2987-3065) बनाया गया था ।

  1. कार्यात्मक सत्यापन के लिए, karyopherin α के लिए जंगली प्रकार के बंधन और phosphomimetic CENP-F टुकड़े की तुलना करें । बाध्यकारी परख के रूप में एक विश्लेषणात्मक जेल निस्पंदन का उपयोग । विश्लेषणात्मक जेल निस्पंदन के लिए, glutathione संबध क्रोमैटोग्राफी (कदम 3.1-3.12) द्वारा CENP-F टुकड़े शुद्ध, और जेल निस्पंदन कदम छोड़ ।
  2. 5-6 मिलीग्राम/एमएल के लिए प्रोटीन ध्यान । फ्लैश फ्रीज तरल नाइट्रोजन में प्रोटीन aliquots (कदम 3.15-----) ।
  3. शुद्ध CENP-F टुकड़े मिश्रण (०.१ मिलीग्राम, या तो जंगली प्रकार या S3048D संस्करण) और शुद्ध karyopherin α (०.७ मिलीग्राम) एक 1:1 दाढ़ अनुपात में । जेल निस्पंदन बफर के साथ २०० µ एल के लिए नमूना मात्रा को समायोजित करें । बर्फ पर 30 मिनट के लिए नमूना मशीन, नमूना फ़िल्टर (०.२ µm ताकना आकार), और केंद्रापसारक द्वारा नमूना स्पष्ट (25 मिनट, २१,७०० x g, 4 ° c)
  4. आकार अपवर्जन क्रोमैटोग्राफी (चरण 3.13-) से नमूने अलग । 20 मिमी HEPES, पीएच ७.५, १५० मिमी NaCl, और 2 मिमी डीटीटी से मिलकर एक जेल निस्पंदन बफर का प्रयोग करें । सभी नमूनों के लिए समान शर्तों के तहत विश्लेषणात्मक जेल छानने का प्रयोग करते हैं ।
  5. निर्माता द्वारा वर्णित के रूप में ज्ञात दाढ़ मास के आणविक भार मानकों के साथ विश्लेषणात्मक जेल निस्पंदन कॉलम जांचना ।
  6. 16% एसडीएस द्वारा रेफरेंस अंशों का विश्लेषण-पृष्ठ (३.११ कदम) ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

हम हाल ही में एक इन विट्रो कळेनासे परख (चित्रा 1) एक CENP-F टुकड़ा है कि एक cNLS10निहित में Cdk1-विशिष्ट फास्फारिलीकरण साइटों की पहचान करने के लिए इस्तेमाल किया है । यह संकेत CENP के परमाणु स्थानीयकरण-एफ के सबसे अधिक चरण के दौरान प्रदान । G2 चरण में, CENP-F नाभिक से एक Cdk1-निर्भर तरीके से cytosol करने के लिए निर्यात किया जाता है । कैसे Cdk1 CENP-f के सेलुलर स्थानीयकरण को नियंत्रित करता है पर यंत्रवत अंतर्दृष्टि प्राप्त करने के लिए, हम Cdk1-विशिष्ट फास्फारिलीकरण साइटों का अनुमान लगाने के लिए CENP-f के अनुक्रम का विश्लेषण किया,३६सर्वर,३७. CENP-एफ के cNLS के भीतर, तीन Cdk1-विशिष्ट फास्फारिलीकरण साइटों ३,०४२, ३०४५, और ३,०४८ (तालिका 1) अवशेषों पर भविष्यवाणी की गई थी । एक अंय Cdk1-विशिष्ट फास्फारिलीकरण साइट भी अवशेष ३,००७ (तालिका 1)10के लिए भविष्यवाणी की थी । इसलिए, हम परिकल्पना की है कि Cdk1 CENP-F स्थानीयकरण सीधे इसके cNLS के फास्फारिलीकरण द्वारा नियंत्रित करता है ।

परीक्षण करने के लिए कि CENP के cNLS-F Cdk1 के लिए एक सब्सट्रेट है, हम एक इन विट्रो कळेनासे परख के साथ शुद्ध मानव CENP-च टुकड़ा (अवशेषों 2987-3065) और मानव Cdk1/इन विट्रो cyclin phosphorylated-एफ 16% CENP-पृष्ठ पर विश्लेषण किया गया था, एक नकारात्मक नियंत्रण है कि कळेनासे Cdk1 (चित्रा 2a)10की कमी के साथ साथ । के लिए इन विट्रो phosphorylated CENP-F, एक स्पष्ट ऊपर बदलाव जेल पर बैंड के लिए नकारात्मक नियंत्रण की तुलना में मनाया जाता है । प्रत्येक फॉस्फेट समूह दो नकारात्मक शुल्क और अतिरिक्त द्रव्यमान कहते हैं के रूप में यह phosphorylated प्रोटीन की खासियत है । ये परिणाम सुझाते हैं कि CENP-F Cdk1/cyclin B10द्वारा phosphorylated है ।

CENP-f फास्फारिलीकरण साइटों की संख्या निर्धारित करने के लिए और इन साइटों की फास्फारिलीकरण क्षमता यों तो बरकरार है, इन विट्रो phosphorylated CENP-f अंश (८४-मेर) मास स्पेक्ट्रोमेट्री (ईएसआई-ITMS)10द्वारा विश्लेषण किया गया था । मनाया ईएसआई-आयन ट्रैप जन स्पेक्ट्रम (चित्रा 2 बी) का सुझाव है कि बरकरार CENP-F टुकड़ा चार साइटों (तालिका 1)10पर phosphorylated है ।

CENP-एफ के अनुक्रम में phosphorylated अमीनो अम्ल स्थलों का स्थान ईएसआई-FTICR सुश्री Trypsin द्वारा tryptic डाइजेस्ट का परीक्षण करके मूल्यांकन किया गया था lysines और arginines के बाद, और Trypsin के एक CENP डाइजेस्ट-f अंश के परिणामस्वरूप, कई एक है कि अवशेषों 3031-3052 शामिल पेप्टाइड्स, । इस CENP के मास स्पेक्ट्रा-एफ पेप्टाइड अवशेषों पर फास्फारिलीकरण के साथ संगत थे T3042, T3045, और S3048, जो cNLS के भीतर स्थित हैं (तालिका 1)10. एक और tryptic पेप्टाइड के मास स्पेक्ट्रा (अवशेषों 2995-3016) S3007 पर फास्फारिलीकरण के साथ संगत थे (तालिका 1)10. परिक्रमा से सभी चार Cdk1-विशिष्ट फास्फारिलीकरण स्थलों की भी भविष्यवाणी की गई थी । Cdk1-विशिष्ट सब्सट्रेट अक्सर अवशेषों कि phosphorylated है के बगल में एक पंक्ति होते हैं6, T3042, T3045, और S3007 अवशेषों के लिए मनाया के रूप में. यह ध्यान दिया जाना चाहिए कि S3048 एक कुछ असामांय Cdk1-विशिष्ट फास्फारिलीकरण साइट है, के रूप में एक फेनिलएलनिन serine के बगल में स्थित है । समाप्त करने के लिए, परिणाम सुझाव है कि CENP-F कळेनासे Cdk1 द्वारा ३,००७, ३,०४२, ३,०४५ और ३,०४८ अवशेषों पर विशेष रूप से phosphorylated है । इन अवशेषों में से तीन CENP के cNLS के भीतर स्थित हैं-f (तालिका 1), यह दर्शाता है कि Cdk1 G2 चरण में फास्फारिलीकरण के cNLS के माध्यम से CENP-f सेलुलर स्थानीयकरण को विनियमित कर सकता है, जब Cdk110सक्रिय हो जाता है ।

यह सत्यापित करने के लिए कि इन Cdk1-विशिष्ट फास्फारिलीकरण साइट्स में एक भौतिक फ़ंक्शन है, हमने10S3048D phosphomimetic संस्करण बनाया है । Phosphomimetic उत्परिवर्तनों नकारात्मक आरोप लगाया अवशेषों द्वारा फास्फारिलीकरण के प्रभाव की नकल । अगले, हम CENP-F टुकड़ा है कि cNLS समाहित के phosphomimetic संस्करण शुद्ध । CENP-एफ के cNLS को परमाणु परिवहन रिसेप्टर karyopherin α द्वारा पहचाना जाता है, जो उच्च अपनत्व के साथ बाँधता है और CENP-एफ के परमाणु आयात के लिए आवश्यक है. परीक्षण करने के लिए कि क्या phosphomimetic उत्परिवर्तन अपने परमाणु परिवहन रिसेप्टर karyopherin α के साथ CENP-एफ के cNLS के बीच बातचीत को कमजोर, हम एक बाध्यकारी परख (चित्रा 3)10प्रदर्शन किया । इन प्रयोगों में, एक शुद्ध CENP-F टुकड़ा (या तो जंगली-प्रकार या S3048D संस्करण) शुद्ध मानव karyopherin α के साथ मिलाया गया था, और मिश्रण विश्लेषणात्मक आकार अपवर्जन क्रोमैटोग्राफी द्वारा अलग किया गया था । इसके अलावा, प्रोटीन व्यक्तिगत रूप से भी विश्लेषण किया गया । एसडीएस-रेफरेंस अंशों के पृष्ठ विश्लेषण से पता चला कि जंगली प्रकार के cNLS के साथ CENP-F टुकड़ा karyopherin α के साथ दृढ़ता से इंटरैक्ट करता है, दोनों प्रोटीन सह elute (चित्रा 3)10के बाद से । तथापि, केवल नगण्य मात्रा में CENP-F S3048D अंश बाइंड कर देता है करने के लिए karyopherin α, और इन प्रोटीन elute अलग से (चित्र 3)10. इन परिणामों का सुझाव है कि CENP-एफ के cNLS के अवशेष ३,०४८ के फास्फारिलीकरण परमाणु परिवहन कारक karyopherin α के साथ बातचीत पर एक मजबूत प्रभाव होगा । यह ध्यान दिया जाना चाहिए कि परमाणु आयात दर एक परमाणु परिवहन कारक४६की ओर एक परमाणु स्थानीयकरण संकेत के संबंध पर अत्यधिक निर्भर हैं, और इसलिए, यह उंमीद है कि इन उत्परिवर्तनों परमाणु आयात को धीमा10

Figure 1
चित्रा 1: Cdk1 के योजनाबद्ध प्रतिनिधित्व इन विट्रो कळेनासे परख. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: CENP-F Cdk1/cyclin बी द्वारा phosphorylated है । (A) Cdk1 विशिष्ट फास्फारिलीकरण साइटों की पहचान करने के लिए, एक इन विट्रो कळेनासे परख शुद्ध CENP के साथ प्रदर्शन किया गया था-F (अवशेषों 2987-3065). एसडीएस-Cdk1/cyclin B के बिना एक नकारात्मक नियंत्रण के पृष्ठ विश्लेषण बाएं लेन में दिखाया गया है (-Cdk1), के लिए अगले इन विट्रो phosphorylated CENP-F में सही लेन (+ Cdk1) । आणविक भार मानक संकेत कर रहे हैं । एसडीएस-पृष्ठ पर phosphorylated CENP-F की ऊपर की ओर shift नोट करें, जो सफल फास्फारिलीकरण के अनुरूप है । Cdk1 और cyclin बी ३४ केडीए और ६० केडीए में बेहोश बैंड के रूप में दिखाई देते हैं. () ईएसआई-आयन ट्रैप जन स्पेक्ट्रोमेट्री बरकरार phosphorylated CENP-एफ (ए) से बरकरार phosphorylated CENP-f (८४-मेर) के फास्फेट लोड निर्धारित करने के लिए इस्तेमाल किया गया था । इसी मास स्पेक्ट्रम दिखाया गया है. तीव्रता बनाम बड़े पैमाने पर आरोप अनुपात (एम/जेड) की साजिश रची है । स्पेक्ट्रम फास्फारिलीकरण के बाद बरकरार CENP-F टुकड़ा के 10 से + 14 चार्ज राज्यों से पता चलता है । वे 0, 1, 2, 3, और 4 फॉस्फेट एस्टर के साथ एक प्रजाति की आबादी का संकेत है । कुल प्रोटीन राशि के लिए प्रत्येक प्रजाति के अनुपात का अंदाजा लगाने के लिए, पीक हाइट्स निर्धारित किया गया और तुलना (तालिका 1) । इस आंकड़े को10 से संशोधित किया गया है और टेलर और फ्रांसिस प्रकाशक द्वारा अनुमति के साथ reproduced किया गया था । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: कार्यात्मक सत्यापन: CENP के phosphomimetic उत्परिवर्तनों-एफ दृढ़ता से परमाणु परिवहन रिसेप्टर karyopherin α के साथ बातचीत कम. (-) शुद्ध CENP-एफ टुकड़े (अवशेषों 2987-3065) (०.१ मिलीग्राम) और शुद्ध karyopherin α (०.७ मिलीग्राम) और 1:1 दाढ़ अनुपात में मिश्रित और आकार अपवर्जन क्रोमैटोग्राफी द्वारा विश्लेषण किया गया । CENP-च अंशों और karyopherin α का भी व्यक्तिगत रूप से विश्लेषण किया गया. पीक अंशों का एसडीएस-पृष्ठ विश्लेषण दिखाया गया है । रेफरेंस वॉल्यूम नीचे (०.६ मिलीलीटर वेतन वृद्धि में) पर संकेत कर रहे हैं । बाईं ओर, आणविक भार मार्कर बैंड और केडीए में उनकी जनता के पदों के संकेत दिए गए हैं. एक तारे के निशान अवशिष्ट जीएसटी (glutathione S-ट्रांस्फ़्रेज़) के निशान । (A) Karyopherin α. (B) रेफरेंस प्रोफाइल. २८० एनएम पर अवशोषक रेफरेंस वॉल्यूम बनाम साजिश की जाती है । karyopherin α (red) के लिए रेफरेंस प्रोफाइल CENP-एफ अंशों के साथ karyopherin α के मिश्रण का रेफरेंस प्रोफाइल के साथ मढ़ा जाता है (वाइल्ड-टाइप: ग्रीन; phosphomimetic S3048D उत्परिवर्ती: ब्लू) । जंगली प्रकार के अतिरिक्त CENP-f टुकड़ा के अलावा ध्यान दें कि उच्च द्रव्यमान के लिए karyopherin α चोटी के रेफरेंस की मात्रा में बदलाव, जो CENP के बंधन के अनुरूप है-च जंगली-प्रकार टुकड़ा । यह बदलाव देखा नहीं है जब CENP phosphomimetic उत्परिवर्तन S3048D के साथ एफ टुकड़ा जोड़ा गया है, सुझाव है कि phosphomimetic उत्परिवर्तन बहुत CENP karyopherin के साथ α-एफ के संपर्क घटता है । (C) CENP-f वंय-प्रकार अंश (wt) और karyopherin α (D) CENP-च wt अंश । () CENP-च S3048D अंश तथा karyopherin α () CENP-च S3048D अंश । यह आंकड़ा10से डेटा के साथ बनाया गया था । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

तालिका 1a. CENP के अनुक्रम-F टुकड़ा (अवशेषों 2987-3065) की भविष्यवाणी की Cdk1-विशिष्ट फास्फारिलीकरण बड़े फ़ॉन्ट आकार से प्रकाश डाला साइटों के साथ. Tryptic अंशों को बोल्ड में हाइलाइट किया जाता है और रेखांकित किया जाता है ।
GPLGSQQSKQDSRGSPLLGPVVPGPSPIPSVTEKRLSSGQNKAS
GKRQRSSGIWENGGGPtPAtPESFSKKSKKAVMSGIHPAE
तालिका 1b । बरकरार CENP के जन स्पेक्ट्रोमेट्री विश्लेषण-च
८४ मेर फाद इन विट्रो फास्फारिलीकरण के साथ Cdk1/cyclin ब
# फास्फारिलीकरण साइटें (P) का पता लगाया फॉस्फेट कुल प्रोटीन के% के रूप में व्यक्त लोड
CENP-एफ 2987-3065 0P 6%
1P ३७%
2P ४०%
3P 15%
4P 3%
टेबल 1C । CENP के tryptic पेप्टाइड्स के मास स्पेक्ट्रोमेट्री विश्लेषण-एफ के बाद इन विट्रो फास्फारिलीकरण with Cdk1/cyclin B
# फास्फारिलीकरण साइटें फॉस्फेट लोड
Tryptic phosphopeptide, 0P ५७%
अवशेष 2995-3016 1P ४३%
Tryptic phosphopeptide, 0P 7%
अवशेष 3031-3052 1P ६४%
2P 29%
3P 1%

तालिका 1: मास स्पेक्ट्रोमेट्री विश्लेषण के CENP-F अंश के बाद इन विट्रो फास्फारिलीकरण के साथ Cdk1/cyclin B. यह तालिका10से डेटा के साथ बनाई गई थी ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

हमारे इन विट्रो कळेनासे परख एक बहुत शक्तिशाली तरीका कळेनासे Cdk1 है, जो सेल चक्र के एक मास्टर नियंत्रक है और कई महत्वपूर्ण सेलुलर प्रक्रियाओं को नियंत्रित करता है के लिए आणविक लक्ष्यों की पहचान है । विधि निर्धारित करता है अगर एक शुद्ध प्रोटीन Cdk1 के लिए एक सब्सट्रेट है और विशिष्ट फास्फारिलीकरण साइटों की पहचान की अनुमति देता है । यह Cdk1 के माध्यम से फास्फारिलीकरण द्वारा सेलुलर प्रक्रियाओं के विनियमन के लिए यंत्रवत अध्ययन की सुविधा ।

मास स्पेक्ट्रोमेट्री द्वारा फास्फारिलीकरण स्थलों की सफल पहचान के लिए सबसे महत्वपूर्ण कारक कळेनासे परख की फास्फारिलीकरण दक्षता है । व्यक्तिगत साइटों की फास्फारिलीकरण दक्षता के रूप में संभव के रूप में उच्च, अधिमानतः १००% होना चाहिए । इस Cdk1/cyclin बी की मात्रा में वृद्धि और गर्मी समय 16 ज बढ़ाने के द्वारा प्राप्त किया जा सकता है । Cdk1/cyclin बी की मात्रा की गणना करते समय, प्रोटीन की दाढ़ एकाग्रता और फास्फारिलीकरण साइटों की संख्या पर विचार किया जाना चाहिए । यह विशेष रूप से महत्वपूर्ण है अगर कई फास्फारिलीकरण साइटों लक्ष्य प्रोटीन में मौजूद हैं । यह भी ध्यान दिया जाना चाहिए कि वाणिज्यिक Cdk1/cyclin B की गतिविधि बैच के जत्थे से भिन्न हो सकते हैं, और कळेनासे गतिविधि तेजी से खो सकते हैं । यदि इन विट्रो फास्फारिलीकरण असफल है, यह कळेनासे की गतिविधि का परीक्षण करने के लिए अनुशंसित है । समस्या निवारण के लिए एक सकारात्मक नियंत्रण के रूप में, इन विट्रो फास्फारिलीकरण में CENP-F (अवशेषों 2987-3065) का उपयोग किया जा सकता है । एक नकारात्मक नियंत्रण के रूप में, Cdk1/cyclin बी इसके अलावा के बिना एक प्रतिक्रिया प्रदर्शन और विश्लेषण किया जाना चाहिए । एक और उपयोगी नकारात्मक नियंत्रण Cdk1 के एक कळेनासे मृत उत्परिवर्ती, जो उत्प्रेरक निष्क्रिय है, एक साधारण बिंदु उत्परिवर्तन (D146N)४७,४८,४९के कारण का उपयोग है । इसके अलावा, पहचान फास्फारिलीकरण साइटों की पुष्टि करने के लिए, लक्ष्य प्रोटीन का एक phosphonegative संस्करण बनाया जा सकता है, जहां फास्फारिलीकरण साइटों alanines द्वारा प्रतिस्थापित कर रहे हैं । यदि पहचान फास्फारिलीकरण साइटों सही हैं, इसी phosphonegative उत्परिवर्ती इन विट्रो मेंphosphorylated नहीं किया जा सकता है ।

एक सरल उपकरण लक्ष्य प्रोटीन का सफल फास्फारिलीकरण का पता लगाने के लिए सरल एसडीएस-पृष्ठ जेल पाली परख यहां वर्णित है । Phosphorylated प्रोटीन आमतौर पर अपने unphosphorylated समकक्षों की तुलना में एसडीएस-पृष्ठ पर धीमी माइग्रेट, जोड़ा आकार और नकारात्मक शुल्क के कारण । ध्यान दें कि बड़े प्रोटीन के लिए, एसडीएस-पृष्ठ विश्लेषण का अनुकूलन करने के लिए पर्याप्त रूप से जेल शिफ्ट कल्पना करने के लिए संकल्प बढ़ाने के लिए आवश्यक है । phosphorylated प्रोटीन की विशिष्ट जुदाई के लिए एक उपयोगी उपकरण फॉस्फेट-बाध्यकारी टैग (Phos-टैग) एसडीएस-पृष्ठ है । Phos-टैग acrylamide के साथ तैयार जेल में Phosphorylated प्रोटीन इसी dephosphorylated प्रोटीन५०,५१के साथ तुलना में धीमी गति से पलायन बैंड के रूप में कल्पना कर रहे हैं ।

उच्च गुणवत्ता वाले मास स्पेक्ट्रा प्राप्त करने के लिए, यह बहुत महत्वपूर्ण है कि इन विट्रो कळेनासे परख के लिए प्रोटीन शुद्ध और सजातीय है । हमारे शुद्धि प्रोटोकॉल कई उच्च चयनात्मक क्रोमैटोग्राफी कदम के संयोजन से इस प्राप्त है और तंग अवरोधकों और reductants के अलावा के माध्यम से प्रोटीन क्षरण और ऑक्सीकरण को रोकने के द्वारा । शुद्धिकरण प्रोटोकॉल को glutathione (यानीजीएसटी-टैग के साथ elute) द्वारा प्रोटीन को संशोधित किया जा सकता है; हालांकि, यह माना जाना चाहिए कि जीएसटी-टैग एक और 25 केडीए जोड़ता है, और बड़े प्रोटीन जन स्पेक्ट्रोमेट्री के लिए चुनौतीपूर्ण लक्ष्य हैं । वैकल्पिक रूप से, अपने6टैग फ्यूजन प्रोटीन के लिए हमारे शुद्धि प्रोटोकॉल भी इस्तेमाल किया जा सकता है ।

इस प्रोटोकॉल भी अंय kinases के लिए विशिष्ट है फास्फारिलीकरण साइटों की पहचान करने के लिए संशोधित किया जा सकता है । केवल आवश्यकता है कि शुद्ध कळेनासे उपलब्ध है, सक्रिय है, और पर्याप्त रूप से स्थिर है । परख शर्तों प्रत्येक कळेनासे के लिए समायोजित करने के लिए अधिकतम गतिविधि प्राप्त करने की आवश्यकता है । मानकों का अनुकूलन करने के लिए कळेनासे की राशि शामिल हैं, प्रतिक्रिया बफर (पीएच, नमक एकाग्रता), मशीन समय, प्रतिक्रिया तापमान, और एटीपी एकाग्रता. इन विट्रो कळेनासे परख सफलतापूर्वक Plks सहित कई kinases के लिए फास्फारिलीकरण साइटों की पहचान करने के लिए इस्तेमाल किया गया है (पोलो जैसे kinases)५२,५३,५४, और MAPK/ERK kinases (mitogen-सक्रिय प्रोटीन kinases/extracellular-signal-regulated kinases)५५,५६.

जबकि इस विधि की ताकत एक शुद्ध प्रोटीन में विशिष्ट फास्फारिलीकरण साइटों की पहचान करने के लिए है, यह ध्यान दिया जाना चाहिए कि एक फास्फारिलीकरण साइट है कि इन विट्रो में Cdk1 के लिए एक लक्ष्य है जरूरी नहीं कि vivo मेंphosphorylated हो सकता है । विव ओ मेंअतिरिक्त विनियामक तंत्र ऐसे स्थान पर हैं, जो Cdk1 द्वारा मांयता के लिए दुर्गम फास्फारिलीकरण स्थल को रेंडर कर सके । उदाहरण के लिए, अतिरिक्त सहभागिता साझेदार vivo मेंमौजूद हो सकते हैं, जो या तो किसी फास्फारिलीकरण साइट को छुपा सकते हैं या उसे संरचनात्मक परिवर्तनों के माध्यम से सुलभ बनाते हैं. इसके अलावा, सब्सट्रेट Cdk1 के साथ colocalize करने के लिए की जरूरत है/cyclin बी G2 चरण में नाभिक में आदेश phosphorylated किया जा करने के लिए. इसके अलावा, बाद में अनुवाद संशोधन या अंय विनियामक प्रक्रियाओं vivo मेंलक्ष्य प्रोटीन के अनुरूप है, जो एक फास्फारिलीकरण साइट दुर्गम प्रदान कर सकता प्रभाव सकता है । इन सीमाओं कोशिकाओं या पशु मॉडल है कि सत्यापित करें कि पहचान फास्फारिलीकरण साइटों एक शारीरिक समारोह है में उचित प्रयोग डिजाइन द्वारा दूर किया जा सकता है । यहां, हम कार्यात्मक सत्यापन के लिए एक सरल बाध्यकारी परख का उपयोग करें, क्योंकि फास्फारिलीकरण CENP की बातचीत कम-karyopherin α के साथ एफ । कार्यात्मक सत्यापन भी कोशिकाओं या एक पशु मॉडल के संदर्भ में किया जाना चाहिए । इसलिए, हम भी CENP के फ्लोरोसेंट फ्यूजन प्रोटीन transfected-F-टुकड़े कि हेला कोशिकाओं में cNLS शामिल10। CENP के cNLS के भीतर Phosphomimetic उत्परिवर्तनों-एफ परमाणु स्थानीयकरण, जो इन फास्फारिलीकरण साइटों की एक शारीरिक समारोह की पुष्टि कम हो10

कई उपकरण कोशिकाओं या पशु मॉडल में फास्फारिलीकरण साइटों के कार्यात्मक सत्यापन के लिए उपलब्ध हैं । Phosphomimetic उत्परिवर्तनों, जो नकारात्मक आरोपों से फास्फारिलीकरण के प्रभाव की नकल, व्यापक रूप से इस प्रयोजन के लिए इस्तेमाल कर रहे हैं । इन के लिए, फास्फारिलीकरण साइट (serine या threonine) aspartate या ग्लूटामेट की जगह है । लाभ यह है कि केवल लक्ष्य प्रोटीन की एक बिंदु उत्परिवर्तन की आवश्यकता है । यह ध्यान दिया जाना चाहिए, कि जबकि phosphomimetic उत्परिवर्तनों सफलतापूर्वक कार्यात्मक सत्यापन के लिए कई मामलों में इस्तेमाल किया गया, वे विशेष रूप से मामलों में जहां प्रभार परिवर्तन विनियमन के बजाय एक संरचनात्मक परिवर्तन के लिए प्रमुख योगदानकर्ता है काम करते हैं । Phosphomimetic उत्परिवर्तनों कई अंय मामलों में फास्फारिलीकरण के प्रभाव की नकल करने में विफल (उदा, 11) । हालांकि, अंय दृष्टिकोण फास्फारिलीकरण साइटों के कार्यात्मक सत्यापन के लिए उपलब्ध हैं, phosphonegative उत्परिवर्तनों के उपयोग सहित: इन उत्परिवर्तनों alanine के साथ फास्फारिलीकरण साइटों की जगह से फास्फारिलीकरण को रोकने के । सेलुलर संदर्भ में कार्यात्मक सत्यापन के लिए एक और उपयोगी दृष्टिकोण एक कळेनासे-Cdk1 के मृत उत्परिवर्ती, जो एक आसान-परिचय अंक उत्परिवर्तन (D146N)४७,४८,४९द्वारा निष्क्रिय है की अभिव्यक्ति है । विशेष रूप से, कई छोटे अणु Cdk1 अवरोधकों व्यावसायिक रूप से Flavopiridol और RO-३३०६, जो या तो कोशिकाओं या पशु मॉडल में कार्यात्मक अध्ययन के लिए इस्तेमाल किया जा सकता है के रूप में उपलब्ध है7,8,11। इन अवरोधकों अच्छी तरह से विशेषता हैं, और कई कैंसर के इलाज के लिए नैदानिक परीक्षणों में है (एक समीक्षा के लिए9देखें) ।

जबकि प्रोटीन फास्फारिलीकरण साइटों की एक बड़ी संख्या proteomic अध्ययन में पहचान की गई है, कळेनासे विशिष्टता ज्यादातर मामलों में अज्ञात है, और इन विट्रो कळेनासे परख कुछ Cdk1 के सब्सट्रेट की पहचान उपलब्ध तरीकों में से एक है । अन्य दृष्टिकोणों का भी उपयोग किया गया है. Cdk1 लक्ष्य एक इंजीनियर Cdk1 एंजाइम का उपयोग करके पहचाने गए । यह एक बड़ा सब्सट्रेट बाध्यकारी जेब है और एक सब्सट्रेट6के रूप में एटीपी के अधिक भारी संस्करण स्वीकार करता है । इस भारी सब्सट्रेट जंगली-प्रकार kinases के लिए बाध्य नहीं कर सकते । radiolabeled एक कोशिका संशोधित Cdk1 एंजाइम युक्त निकालने के लिए भारी एटीपी के अलावा इसलिए Cdk1 के प्रत्यक्ष सब्सट्रेट की विशिष्ट लेबलिंग की ओर जाता है. २०० Cdk1 लक्ष्य इस विधि के साथ नवोदित खमीर में पहचान की गई; हालांकि, यह स्तनधारी कोशिकाओं के लिए लागू नहीं किया जा सकता है, जो एक महत्वपूर्ण सीमा है । एक अंय अध्ययन में, Cdk1 सब्सट्रेट Cdk1, Flavopiridol, और आरओ-३३०६ के दो छोटे अणु अवरोधकों का उपयोग मात्रात्मक phosphoproteomics विश्लेषण प्रदर्शन द्वारा मानव ऊतक संस्कृति कोशिकाओं में पहचाने गए । १२१५ phosphopeptides पर ५५१ प्रोटीन Cdk1 अवरोधक के अलावा7पर काफी कम थे. इस विधि संभावित Cdk1 लक्ष्य के लिए एक पूरी proteome स्क्रीन कर सकते हैं, लेकिन जिसके परिणामस्वरूप लक्ष्य की जरूरत है सत्यापित करने के लिए, जैसे, एक इन विट्रो कळेनासे परख ।

भविष्य में, इन विट्रो कळेनासे परख की संभावना Cdk1 सब्सट्रेटs कि विकास के तहत वर्तमान में कर रहे है के लिए उच्च प्रवाह स्क्रीन के साथ संयुक्त होगा । proteome में Cdk1 सब्सट्रेट की बड़ी संख्या के कारण, कई मानव Cdk1 सब्सट्रेट करने के लिए पहचाने जाते रहते हैं, और इन विट्रो कळेनासे परख एक महत्वपूर्ण उपकरण की पहचान करने के लिए किया जाएगा, नक्शा, और इन साइटों को सत्यापित.

इन विट्रो कळेनासे परख कळेनासे Cdk1 के लिए लक्ष्य की पहचान करने के लिए और विशिष्ट फास्फारिलीकरण साइटों की पहचान करने के लिए एक शक्तिशाली उपकरण है । इन फास्फारिलीकरण साइटों की पहचान Cdk1 द्वारा सेलुलर प्रक्रियाओं के विनियमन के लिए यंत्रवत अध्ययन सक्षम बनाता है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

हम डॉ डेविड किंग, हावर्ड ह्यूजेस चिकित्सा संस्थान, कैलिफोर्निया विश्वविद्यालय के मास स्पेक्ट्रोमेट्री विश्लेषण और उपयोगी टिप्पणियों के लिए बर्कले में धंयवाद । हम Dr. Xuelian झू, शंघाई, जैव विज्ञान के लिए संस्थानों, चीनी विज्ञान अकादमी, शंघाई, चीन के लिए एक पूर्ण लंबाई CENP-च निर्माण प्रदान करने के लिए धंयवाद । अंत में, हम dr. Susan बने, डॉ ब्रायन Callahan और डॉ Christof ग्रेवाल Binghamton विश्वविद्यालय में उपकरणों तक पहुंच के लिए धंयवाद । यह शोध ंयूयॉर्क के राज्य विश्वविद्यालय के लिए अनुसंधान फाउंडेशन द्वारा वित्त पोषित किया गया था और रसायन विज्ञान विभाग, Binghamton में ंयूयॉर्क के राज्य विश्वविद्यालय ।

Materials

Name Company Catalog Number Comments
2800 mL baffled Fernbach flask Corning 44232XL
ampicillin Gold Biotechnology A-301-25
ATP Fisher Scientfiic BP413-25
benzamidine hydrochloride Millipore Sigma B6506-25
bottletop filter Corning 431161
Cdk1/cyclin B recombinant, human 20,000 U/mL New England Biolabs P6020
Cdk1/cyclin B (alternate source) EMD Millipore 14-450
Cdk1/cyclin B (alternate source) Invitrogen PV3292
Cdk1/cyclin B + 10x PK buffer New England Biolabs P6020
CENP-F (residues 2987 – 3065) pGEX6P1 plasmid Available upon request.
centrifuge: Heraeus Multifuge X3R, cooled, with TX-1000 swing-out rotor Thermo Scientific 10033-778
centrifugal filter units: Amicon Ultra-15 centrifugal filter units, 3 kDa cutoff, Ultracel-PL membranes EMD Millipore UFC900324
chlorampenicol Gold Biotechnology C-105-100
D/L methionine Agros Organics / Fisher 125650010
desalting pipet tips: Zip tips Millipore Sigma ZTC18S008
disposable chromatography columns, Econo-Pac 1.5 x 12 cm Biorad 7321010
dithiothreitol Gold Biotechnology DTT50
E. coli Rosetta 2(DE3)pLysS strain EMD Millipore 71403
electrospray ionization Fourier transform ion Bruker Amazon Apex III
cyclotron resonance mass spectrometer
electrospray ionization ion trap mass spectrometer Bruker Amazon custom
fixed angle rotor: Fiberlite F15-8x-50cy Thermo Scientific 97040-276
FPLC system: Äkta Pure FPLC GE Healthcare 29032697
Gel filtration column: Superdex 200 Increase 10/300 GL GE Healthcare 28990944
glutathione agarose Pierce 16101
glutathione, reduced Millipore Sigma G4251-50g
incubation shaker: multitron shaker Infors I10102
isopropyl β-D-1-thiogalactopyranoside Gold Biotechnology I2481C50
kanamycin Gold Biotechnology K-120-25
karyopherin α pet-28a pres plasmid Available upon request.
Luria Bertani medium Fisher Scientfiic BP1426-2
microcentrifuge 5418R, refrigerated Eppendorf 5401000013
microtubes (0.5 mL) Eppendorf 30121023
microtubes (1.5 mL) Eppendorf 30120086
Nickel affinity gel: His-Select Nickel affinity gel Millipore Sigma P6611-100ml
pGEX-6P-1 plasmid Millipore Sigma GE28-9546-48
phenylmethylsulfonyl fluoride Gold Biotechnology P470-10
PS protease: PreScission protease GE Healthcare 27084301
Phos-tag acrylamide Wako Pure Chem. Ind. 304-93521
reduced gluthathione Millipore Sigma G4251-50g
roundbottom centrifuge tubes (Oakridge tubes) Fisher Scientfiic 055291D
site-directed mutagenesis kit: QuikChange Lightning Agilent 210518
Site-Directed Mutagenesis Kit
sonifier: Branson S-250D sonifier Branson 15 338 125
Spectra/Por 1RC dialysis membrane (6-8 kDa cutoff) Spectrum Labs 08 670B
swing out rotor TX-1000 Thermo Scientific 10033-778

DOWNLOAD MATERIALS LIST

References

  1. Nurse, P. Cyclin dependent kinases and cell cycle control (Nobel Lecture). ChemBioChem. 3, (7), 596-603 (2002).
  2. Lee, M. G., Nurse, P. Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327, 31 (1987).
  3. Lohka, M. J., Hayes, M. K., Maller, J. L. Purification of maturation-promoting factor, an intracellular regulator of early mitotic events. Proc Natl Acad of Sci U S A. 85, (9), 3009-3013 (1988).
  4. Gautier, J., Norbury, C., Lohka, M., Nurse, P., Maller, J. Purified maturation-promoting factor contains the product of a Xenopus homolog of the fission yeast cell cycle control gene. Cell. 54, (3), 433-439 (1988).
  5. Gautier, J., Minshull, J., Lohka, M., Glotzer, M., Hunt, T., Maller, J. L. Cyclin is a component of maturation-promoting factor from Xenopus. Cell. 60, (3), 487-494 (1990).
  6. Ubersax, J. A., Woodbury, E. L., Quang, P. N., Paraz, M., Blethrow, J. D., Shah, K., Shokat, K. M., Morgan, D. O. Targets of the cyclin-dependent kinase Cdk1. Nature. 425, (6960), 859-864 (2003).
  7. Petrone, A., Adamo, M. E., Cheng, C., Kettenbach, A. N. Identification of Candidate Cyclin-dependent kinase 1 (Cdk1) Substrates in Mitosis by Quantitative Phosphoproteomics. Mol Cell Proteomics. 15, (7), 2448-2461 (2016).
  8. Vassilev, L. T., Tovar, C., Chen, S., Knezevic, D., Zhao, X., Sun, H., Heimbrook, D. C., Chen, L. Selective small-molecule inhibitor reveals critical mitotic functions of human CDK1. Proc Natl Acad of Sci U S A. 103, (28), 10660-10665 (2006).
  9. Balakrishnan, A., Vyas, A., Deshpande, K., Vyas, D. Pharmacological cyclin dependent kinase inhibitors: Implications for colorectal cancer. World J Gastroenterol. 22, (7), 2159-2164 (2016).
  10. Loftus, K. M., Coutavas, E., Cui, H., King, D., Ceravolo, A., Pereiras, D., Solmaz, S. Mechanism for G2 phase-specific nuclear export of the kinetochore protein CENP-F. Cell Cycle. 16, (15), 1414-1429 (2017).
  11. Baffet, A. D., Hu, D. J., Vallee, R. B. Cdk1 activates pre-mitotic nuclear envelope dynein recruitment and apical nuclear migration in neural stem cells. Dev Cell. 33, (6), 703-716 (2015).
  12. Songyang, Z., Blechner, S., Hoagland, N., Hoekstra, M. F., Piwnica-Worms, H., Cantley, L. C. Use of an oriented peptide library to determine the optimal substrates of protein kinases. Curr Biol. 4, (11), 973-982 (1994).
  13. Malumbres, M. Cyclin-dependent kinases. Genome Biol. 15, (6), 122 (2014).
  14. Peeper, D. S., Parker, L. L., Ewen, M. E., Toebes, M., Hall, F. L., Xu, M., Zantema, A., van der Eb, A. J., Piwnica-Worms, H. A- and B-type cyclins differentially modulate substrate specificity of cyclin-cdk complexes. EMBO J. 12, (5), 1947-1954 (1993).
  15. Trembley, J., Ebbert, J., Kren, B., Steer, C. Differential regulation of cyclin B1 RNA and protein expression during hepatocyte growth in vivo. Cell Growth Differ. 7, (7), 903-916 (1996).
  16. Pines, J., Hunter, T. The differential localization of human cyclins A and B is due to a cytoplasmic retention signal in cyclin B. EMBO J. 13, (16), 3772-3781 (1994).
  17. Morgan, D. O. Principles of CDK regulation. Nature. 374, 131 (1995).
  18. Larochelle, S., Merrick, K. A., Terret, M. -E., Wohlbold, L., Barboza, N. M., Zhang, C., Shokat, K. M., Jallepalli, P. V., Fisher, R. P. Requirements for Cdk7 in the assembly of Cdk1/cyclin B and activation of Cdk2 revealed by chemical genetics in human cells. Mol cell. 25, (6), 839-850 (2007).
  19. Parker, L. L., Sylvestre, P. J., Byrnes, M. J., Liu, F., Piwnica-Worms, H. Identification of a 95-kDa WEE1-like tyrosine kinase in HeLa cells. Proc Natl Acad of Sci U S A. 92, (21), 9638-9642 (1995).
  20. Atherton-Fessler, S., Parker, L. L., Geahlen, R. L., Piwnica-Worms, H. Mechanisms of p34cdc2 regulation. Mol Cell Biol. 13, (3), 1675-1685 (1993).
  21. Liu, F., Stanton, J. J., Wu, Z., Piwnica-Worms, H. The human Myt1 kinase preferentially phosphorylates Cdc2 on threonine 14 and localizes to the endoplasmic reticulum and Golgi complex. Mol Cell Biol. 17, (2), 571-583 (1997).
  22. McGowan, C. H., Russell, P. Human Wee1 kinase inhibits cell division by phosphorylating p34cdc2 exclusively on Tyr15. EMBO J. 12, (1), 75-85 (1993).
  23. Strausfeld, U., Labbé, J. C., Fesquet, D., Cavadore, J. C., Picard, A., Sadhu, K., Russell, P., Dorée, M. Dephosphorylation and activation of a p34cdc2/cyclin B complex in vitro by human CDC25 protein. Nature. 351, 242 (1991).
  24. Leuken, R., Clijsters, L., Wolthuis, R. To cell cycle, swing the APC/C. Biochim Biophys Acta. 1786, (1), 49-59 (2008).
  25. Acquaviva, C., Pines, J. The anaphase-promoting complex/cyclosome: APC/C. J Cell Sci. 119, (12), 2401-2404 (2006).
  26. Zhu, X., Chang, K. -H., He, D., Mancini, M. A., Brinkley, W. R., Lee, W. -H. The C-terminus of mitosin is essential for its nuclear localization, centromere/kinetochore targeting, and dimerization. J Biol Chem. 270, (33), 19545-19550 (1995).
  27. Liao, H., Winkfein, R. J., Mack, G., Rattner, J. B., Yen, T. J. CENP-F is a protein of the nuclear matrix that assembles onto kinetochores at late G2 and is rapidly degraded after mitosis. J Cell Biol. 130, (3), 507-518 (1995).
  28. Rattner, J. B., Rao, A., Fritzler, M. J., Valencia, D. W., Yen, T. J. CENP-F is a ca 400 kDa kinetochore protein that exhibits a cell-cycle dependent localization. Cell Motil Cytoskeleton. 26, (3), 214-226 (1993).
  29. Christie, M., Chang, C. -W., Rona, G., Smith, K. M., Stewart, A. G., Takeda, A. A. S., Fontes, M. R. M., Stewart, M., Vertessy, B. G., Forwood, J. K., Kobe, B. Structural biology and regulation of protein import into the nucleus. J Mol Biol. 428, (10A), 2060-2090 (2016).
  30. Zuccolo, M., Alves, A., Galy, V., Bolhy, S., Formstecher, E., Racine, V., Sibarita, J. B., Fukagawa, T., Shiekhattar, R., Yen, T., Doye, V. The human Nup107/160 nuclear pore subcomplex contributes to proper kinetochore functions. EMBO J. 26, 1853-1864 (2007).
  31. Bolhy, S., Bouhlel, I., Dultz, E., Nayak, T., Zuccolo, M., Gatti, X., Vallee, R., Ellenberg, J., Doye, V. A Nup133-dependent NPC-anchored network tethers centrosomes to the nuclear envelope in prophase. J Cell Biol. 192, (5), 855-871 (2011).
  32. Hu, D. J., Baffet, A. D., Nayak, T., Akhmanova, A., Doye, V., Vallee, R. B. Dynein recruitment to nuclear pores activates apical nuclear migration and mitotic entry in brain progenitor cells. Cell. 154, (6), 1300-1313 (2013).
  33. Vergnolle, M. S., Taylor, S. S. Cenp-F links kinetochores to Ndel1/Nde1/Lis1/Dynein microtubule motor complexes. Curr Biol. 17, (13), 1173-1179 (2007).
  34. Yang, Z. Y., Guo, J., Li, N., Qian, M., Wang, S. N., Zhu, X. L. Mitosin/CENP-F is a conserved kinetochore protein subjected to cytoplasmic dynein-mediated poleward transport. Cell Res. 13, (4), 275-283 (2003).
  35. Yang, Z., Guo, J., Chen, Q., Ding, C., Du, J., Zhu, X. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, (10), 4062-4074 (2005).
  36. Xue, Y., Ren, J., Gao, X., Jin, C., Wen, L., Yao, X. GPS 2.0, a tool to predict kinase-specific phosphorylation sites in hierarchy. Mol Cell Proteomics. 7, (9), 1598-1608 (2008).
  37. Song, C., Ye, M., Liu, Z., Cheng, H., Jiang, X., Han, G., Songyang, Z., Tan, Y., Wang, H., Ren, J., Xue, Y., Zou, H. Systematic analysis of protein phosphorylation networks from phosphoproteomic data. Mol Cell Proteomics. 11, (10), 1070-1083 (2012).
  38. UniProt-Consortium. UniProt: the universal protein knowledgebase. Nucleic Acids Res. 45, (D1), D158-D169 (2017).
  39. Olsen, J. V., Vermeulen, M., Santamaria, A., Kumar, C., Miller, M. L., Jensen, L. J., Gnad, F., Cox, J., Jensen, T. S., Nigg, E. A., Brunak, S., Mann, M. Quantitative phosphoproteomics reveals widespread full phosphorylation site occupancy during mitosis. Science Signal. 3, (104), ra3 (2010).
  40. Dephoure, N., Zhou, C., Villén, J., Beausoleil, S. A., Bakalarski, C. E., Elledge, S. J., Gygi, S. P. A quantitative atlas of mitotic phosphorylation. Proc Natl Acad of Sci U S A. 105, (31), 10762-10767 (2008).
  41. Rona, G., Marfori, M., Borsos, M., Scheer, I., Takacs, E., Toth, J., Babos, F., Magyar, A., Erdei, A., Bozoky, Z., Buday, L., Kobe, B., Vertessy, B. G. Phosphorylation adjacent to the nuclear localization signal of human dUTPase abolishes nuclear import: structural and mechanistic insights. Acta Cryst D. 69, (12), 2495-2505 (2013).
  42. Harreman, M. T., Kline, T. M., Milford, H. G., Harben, M. B., Hodel, A. E., Corbett, A. H. Regulation of nuclear import by phosphorylation adjacent to nuclear localization signals. J Biol Chem. 279, (20), 20613-20621 (2004).
  43. Kosugi, S., Hasebe, M., Tomita, M., Yanagawa, H. Systematic identification of cell cycle-dependent yeast nucleocytoplasmic shuttling proteins by prediction of composite motifs. Proc Natl Acad Sci U S A. 106, (25), 10171-10176 (2009).
  44. McLachlin, D. T., Chait, B. T. Analysis of phosphorylated proteins and peptides by mass spectrometry. Curr Opin Chem Biol. 5, (5), 591-602 (2001).
  45. Van Berkel, G. J., Glish, G. L., McLuckey, S. A. Electrospray ionization combined with ion trap mass spectrometry. Anal Chem. 62, (13), 1284-1295 (1990).
  46. Hodel, A. E., Harreman, M. T., Pulliam, K. F., Harben, M. E., Holmes, J. S., Hodel, M. R., Berland, K. M., Corbett, A. H. Nuclear localization signal receptor affinity correlates with in vivo localization in Saccharomyces cerevisiae. J Biol Chem. 281, (33), 23545-23556 (2006).
  47. Hong, K. U., Kim, H. -J., Kim, H. -S., Seong, Y. -S., Hong, K. -M., Bae, C. -D., Park, J. Cdk1-Cyclin B1-mediated Phosphorylation of Tumor-associated Microtubule-associated Protein/Cytoskeleton-associated Protein 2 in Mitosis. J Biol Chem. 284, (24), 16501-16512 (2009).
  48. Meraldi, P., Lukas, J., Fry, A. M., Bartek, J., Nigg, E. A. Centrosome duplication in mammalian somatic cells requires E2F and Cdk2–Cyclin A. Nature Cell Biol. 1, 88 (1999).
  49. Heuvel, S., Harlow, E. Distinct roles for cyclin-dependent kinases in cell cycle control. Science. 262, (5142), 2050-2054 (1993).
  50. Kinoshita, E., Kinoshita-Kikuta, E., Takiyama, K., Koike, T. Phosphate-binding Tag, a New Tool to Visualize Phosphorylated Proteins. Mol Cell Proteomics. 5, (4), 749-757 (2006).
  51. Takeda, H., Kawasaki, A., Takahashi, M., Yamada, A., Koike, T. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of phosphorylated compounds using a novel phosphate capture molecule. Rapid Commun Mass Spectrom. 17, (18), 2075-2081 (2003).
  52. Linder, M. I., Köhler, M., Boersema, P., Weberruss, M., Wandke, C., Marino, J., Ashiono, C., Picotti, P., Antonin, W., Kutay, U. Mitotic Disassembly of Nuclear Pore Complexes Involves CDK1- and PLK1-Mediated Phosphorylation of Key Interconnecting Nucleoporins. Dev Cell. 43, (2), (2017).
  53. Arai, T., Haze, K., Iimura-Morita, Y., Machida, T., Iida, M., Tanaka, K., Komatani, H. Identification of β-catenin as a novel substrate of polo-like kinase 1. Cell Cycle. 7, (22), 3556-3563 (2008).
  54. Hansen, D. V., Tung, J. J., Jackson, P. K. CaMKII and Polo-like kinase 1 sequentially phosphorylate the cytostatic factor Emi2/XErp1 to trigger its destruction and meiotic exit. Proc Natl Acad of Sci U S A. 103, (3), 608-613 (2006).
  55. Zhang, Y., Dong, Z., Nomura, M., Zhong, S., Chen, N., Bode, A. M., Dong, Z. Signal Transduction Pathways Involved in Phosphorylation and Activation of p70S6K Following Exposure to UVA Irradiation. J Biol Chem. 276, (24), 20913-20923 (2001).
  56. Richard, D. E., Berra, E., Gothié, E., Roux, D., Pouysségur, J. p42/p44 Mitogen-activated Protein Kinases Phosphorylate Hypoxia-inducible Factor 1α (HIF-1α) and Enhance the Transcriptional Activity of HIF-1. J Biol Chem. 274, (46), 32631-32637 (1999).
Cyclin के आश्रित कळेनासे 1 विशिष्ट फास्फारिलीकरण साइटों की पहचान एक इन <em>विट्रो</em> कळेनासे परख
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cui, H., Loftus, K. M., Noell, C. R., Solmaz, S. R. Identification of Cyclin-dependent Kinase 1 Specific Phosphorylation Sites by an In Vitro Kinase Assay. J. Vis. Exp. (135), e57674, doi:10.3791/57674 (2018).More

Cui, H., Loftus, K. M., Noell, C. R., Solmaz, S. R. Identification of Cyclin-dependent Kinase 1 Specific Phosphorylation Sites by an In Vitro Kinase Assay. J. Vis. Exp. (135), e57674, doi:10.3791/57674 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter