Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Reverse transcriptie-lus-gemedieerde isotherme amplificatie (RT-LAMP) Assay voor Zika-Virus en huishouden genen in Urine, Serum en Mosquito monsters

doi: 10.3791/58436 Published: September 14, 2018

Summary

Dit protocol biedt een efficiënte en goedkope methode speurder Zika virus te bepalen van doelen in menselijke urine en serum monsters of muggen door omgekeerde transcriptie lus-gemedieerde isotherme amplificatie (RT-LAMP). Deze methode vereist geen RNA isolatie en kan worden gedaan binnen 30 min.

Abstract

Infectie met Zika-virus (ZIKV) kan asymptomatisch bij volwassenen, echter de infectie tijdens de zwangerschap kan leiden tot miskraam en ernstige neurologische tekorten van de geboorte. Het doel van dit protocol is te snel opsporen van ZIKV in zowel de mens als de mug monsters. De huidige gouden standaard voor ZIKV-detectie is kwantitatieve omgekeerde transcriptie PCR (qRT-PCR); omgekeerde transcriptie lus-gemedieerde isotherme amplificatie (RT-LAMP) kan toestemming geven voor een meer efficiënte en goedkope testen zonder de noodzaak voor dure apparatuur. In deze studie, wordt RT-LAMP gebruikt voor de detectie van de ZIKV in verschillende biologische monsters binnen 30 min, zonder eerste isoleren RNA van het monster. Deze techniek wordt aangetoond met behulp van ZIKV geïnfecteerde patiënt urine en serum, en besmette mug monsters. 18s ribosomal RNA zuur en actine worden gebruikt als besturingselementen in mens- en muskietenhuif monsters, respectievelijk.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In 2015, Zika-virus (ZIKV) die is opgedaan vooraanstaande wereldwijde aandacht als een besmettelijke ziekte van zorg omdat de infectie tijdens de zwangerschap was gekoppeld aan een miskraam, doodgeboorte, ernstige neurologische tekorten van de geboorte met inbegrip microcefalie, evenals andere aangeboren aangeboren afwijkingen1. In zeldzame gevallen geweest ZIKV geassocieerd met Guillain-Barré syndroom. ZIKV wordt vooral overgedragen door Aedes -muggen; het kan echter ook worden verspreid via seksueel contact1. Gezien het feit dat de infectie met ZIKV asymptomatisch in de meeste mensen of geschenken met milde griep-achtige symptomen die overlappen met de symptomen van infectie van andere arborviruses1, was er behoefte aan een verbeterde methoden voor snelle en kostenefficiënte detectie van ZIKV om het scherm zowel mensen als lokale mug populaties.

Kwantitatieve omgekeerde transcriptie PCR (qRT-PCR) is een betrouwbare test voor de opsporing van ZIKV; Deze techniek vereist echter duur gespecialiseerde apparatuur, opgeleid personeel en RNA isolatie uit de steekproef van belang. Omgekeerde transcriptie lus-gemedieerde isotherme amplificatie (RT-LAMP) is een one-step nucleïnezuur amplificatie methode gebaseerd op technologie van PCR die slechts één incubatietemperatuur als gevolg van het gebruik van een thermophilic polymerase van DNA met strand vereist de eigenschappen van de verplaatsing. Dit omzeilt de behoefte aan een thermocycler en vermindert de lengte van de tijd die nodig is voor het voltooien van de test. Extra voordelen van RT-LAMP zijn haar hoge specificiteit, de gevoeligheid en de robuustheid bij een bereik van pH niveaus en temperaturen en weerstand tegen vele PCR remmers2. Het heeft een relatief lage kostprijs en reagentia zijn stabiel bij kamertemperatuur. Gegeven deze kenmerken, kan RT-LAMP worden geïmplementeerd in een laboratorium of in het veld. Als zodanig, zijn LAMP reacties ontwikkeld voor het detecteren van een scala van ziekteverwekkers en andere soorten infectie3,4,5. Het doel van het protocol van de RT-LAMP in dit artikel wordt beschreven is om ZIKV detecteren zonder RNA isolatie in menselijk serum en de urine monsters zo goed als in een enkele geïnfecteerde mug binnen 30 min door RT-LAMP. Deze methode kan worden gebruikt ter vervanging van qRT-PCR, want het is een gevoelige en snelle diagnostische tool die snel en in instellingen buiten het laboratorium werkt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle methoden die hier worden beschreven zijn goedgekeurd door de institutionele Review Board (IRB) van Beaumont gezondheid. Alle experimenten werden uitgevoerd volgens de relevante richtlijnen en verordeningen.

Let op: Alle mogelijk besmettelijke materialen moeten worden behandeld volgens de normen van bioveiligheid niveau 2 met inbegrip van het gebruik van persoonlijke beschermingsmiddelen. Alle procedures die aërosols kunnen produceren moeten worden uitgevoerd in een kabinet bioveiligheid. Bovendien moet werken met levende muggen worden uitgevoerd in het hiervoor geschikte faciliteit Arthropod Containment Level 1-3. Gezien de vereniging van ZIKV besmetting met aangeboren afwijkingen, moeten vrouwen die zwanger zijn, proberen te bedenken, of de partners van deze vrouwen aanzienlijk beperken hun laboratorium blootstelling aan ZIKV. Transport van ZIKV monsters is ingedeeld in de Verenigde Staten als categorie B biologische stoffen overeenkomstig afdeling of vervoer gevaarlijke materialen Regulations (49 CFR Part 171-180) en daarom verzending monsters moet voldoen aan de richtsnoeren. Invoer in de Verenigde Staten van ZIKV biospecimens vereist een Centers voor Disease Control and Prevention (CDC) invoervergunning. Importeren van een geleedpotigen die dienen kunnen als een vector voor de ZIKV overdracht, zelfs als zij niet zijn besmet, een vergunning van het Amerikaanse ministerie van landbouw (USDA vereist). Deze informatie is bijgewerkt op het moment van publicatie. Actuele aanbevelingen kunnen gevonden worden op https://www.cdc.gov/zika/laboratories/lab-safety.html.

Opmerking: RT-LAMP reacties zijn onderhevig aan hogere tarieven van valse positieve reacties, dus voorzorgsmaatregelen moeten worden genomen bij de planning van de experimentele. Alle opzet en uitvoering van RT-LAMP reacties moeten gebruiken aangewezen pipetten en tips van de filter. In het ideale geval moet een laterale werkstroom worden vastgesteld. Indien mogelijk, plaatsvindt analyse en beeldvorming (sectie 5) in een aparte afgesloten ruimte om verontreiniging te voorkomen. Opening van reageerbuisjes met RT-LAMP producten moet tot een minimum worden beperkt.

1. de RT-LAMP Primer voorbereiding

  1. Reconstrueren elke gelyofiliseerd RT-LAMP primer in moleculaire rang water met een eindconcentratie van 100 µM (tabel 1). Kort vortex de primer oplossing kort spin down de oplossing bij maximale snelheid in een centrifuge tafelblad voor het verzamelen van alle primer oplossing te zorgen voor een homogene oplossing.
  2. Bereiden van een 10 x RT-LAMP Primer Mix van de inleidingen van het FIP, BIP F3, B3, LF en LB met behulp van de volumes in tabel 2. Kort vortex de primer oplossing te zorgen voor een homogene oplossing kort draaien onderaan de oplossing bij maximale snelheid in een tafelblad centrifuge om verlies te voorkomen.
    Opmerking: De primer van de RT-LAMP instellen voor Ae. aegypti actine (AEDAE) bevat geen een LB-primer (lus inleidingen is niet altijd noodzakelijk voor RT-LAMP reacties). In dit geval vervangen door het volume van de primer LB moleculaire rang water.
  3. Opslaan van de inleidingen bij-20 ° C tussen toepassingen en Vermijd gratis-dooi cyclus.

2. de monstervoorbereiding

  1. Voor menselijke urine monsters: Gebruik verse urine, bevroren urine of urine in conserveermiddel. Voor verse of bevroren monster: onmiddellijk spin naar beneden van het monster na de collectie voor 10 min 700 x gen gebruiken van het supernatant voor analyse of bevriezen bij-80 ° C voor toekomstig gebruik. Ontdooi bevroren monsters op ijs vóór gebruik.
  2. Voor menselijk serummonsters: Beide vers of bevroren serummonsters gebruiken
  3. Voor ZIKV besmet cellijnen: geconditioneerde media of cel lysates gebruiken.
    Opmerking: Cel-vrije media van Ae geconditioneerd. albopictus C6/36 cellen 8 dagen na infectie kunnen als positieve controle worden gebruikt voor ZIKV RT-LAMP reacties.
  4. Voor Ae. aegypti muggen: gebruiken beide hele vers of bevroren mug karkassen. Ontdooi bevroren muggen op het ijs. Een ruwe mug lysate bereiden door het plaatsen van een individuele mug in 100 µL-fosfaatgebufferde zoutoplossing (PBS) en meng door het pletten van de mug 10 keer met een P10 Pipetteer tip (Figuur 1). Kort centrifugeren van de ruwe lysate naar pellet puin. Gebruik het supernatant voor downstream RT-LAMP analyse.
    Opmerking: Positieve controles kunnen worden gegenereerd in een laboratorium-instelling door het infecteren van vrouwelijke muggen intrathoracale microinjection met ongeveer 103 genoom equivalenten van virus in een volume van 200 nL en het oogsten van de mug 5 dagen na infectie.

3. voorbereiding van de RT-LAMP Master Mix

  1. Een RT-LAMP master mix reactie op ijs bereiden voor elke primer ingesteld om te worden gebruikt met behulp van volume gids in tabel 3.
    Opmerking: Het gebruik van de thermolabile Uracil DNA Glycosylase (UDG) helpt bij het voorkomen van valse positieven.
  2. Vortex kort om ervoor te zorgen dat alle monsters goed vermengd zijn, draai vervolgens neer kort om volume verlies te voorkomen.

4. RT-LAMP Assay

  1. Pipetteer 23,0 µL van de RT-LAMP master mix per reactie in een buis van 200 µL PCR. Voeg 2.0 µL van monster (urine, serum of ruwe mug lysate supernatant zoals beschreven in stap 2). Dit brengt het totale volume naar 25.0 µL per RT-LAMP reactie. Voor de negatieve controle, moleculaire rang water te gebruiken. Een positieve controle omvatten.
    Opmerking: Een PCR standard of virus voorraden van supernatant van besmette cellijnen kunnen als positieve controle worden gebruikt.
    1. Optioneel: Omvatten een specificiteit controle reactie van een verwante arbovirus zoals dengue virus (DENV). Voorbereiding van het monster zoals beschreven in stap 2 volgens monster type. 2.0 µL van het besturingselement specificiteit aan 23,0 µL van de RT-LAMP master mix in een buis van 200 µL PCR toevoegen.
  2. Verwarm de monsters bij 61 ° C gedurende 30 minuten met behulp van een blok van warmte, waterbad of thermocycler.
  3. De polymerase warmte deactiveren door verhitting tot 80 ° C gedurende 10 minuten.

5. RT-LAMP analyse

Opmerking: RT-LAMP analyses uit te voeren in een apart, afgesloten ruimte.

  1. Na de incubatie, toegang tot RT-LAMP reacties visueel door te zoeken naar de aanwezigheid van een kleur te veranderen.
    1. Verdun het nucleïnezuur fluorescerende kleurstof 1:10 in TAE (40 mM Tris, azijnzuur 20 mM, 1 mM EDTA) buffer.
      Let op: Elke vlek van de nucleïnezuur bindt aan nucleïnezuren en daarom is een kankerverwekkende stof. Draag handschoenen bij hantering.
    2. Voeg aan 12 µL van de reactie van de RT-LAMP, 2 µL van nucleïnezuur fluorescerende kleurstof verdunning.
      Opmerking: Negatieve reacties worden oranje in kleur en positieve reacties zullen geel/groen van kleur.
    3. Optioneel: Neem foto's van RT-LAMP reacties op een witte achtergrond met behulp van een camera.
  2. Leg de monsters onder 302 nm UV-licht om te bevestigen de aanwezigheid van RT-LAMP producten door fluorescentie. Maak foto van het resultaat met behulp van een camera.
    Opmerking: Positieve RT-LAMP reacties zal een fluorescerende uitgang hebben.
    Let op: Draag UV beschermende eye googles of gezicht schild bij het werken met UV-licht.
  3. Optioneel: Bevestigen de aanwezigheid van RT-LAMP producten door te voeren van de Elektroforese van het gel op de monsters.
    1. Giet een 2% agarose gel in 1 x TAE buffer met een vlek van nucleic zuur voor visualisatie.
      Let op: Elke vlek van de nucleïnezuur bindt aan nucleïnezuren en daarom is een kankerverwekkende stof. Draag handschoenen bij hantering.
    2. Voeg 5 µL van een DNA-ladder in de eerste baan te vergelijken het molecuulgewicht.
    3. Meng 13 µL van het reactiemengsel RT-LAMP met 2 µL van DNA laden kleurstof voor elke reactie RT-LAMP. Het laden van het mengsel van de 15 µL met het DNA laden kleurstof.
    4. De gel bij 90 V gedurende 90 minuten of totdat de bands zijn gescheiden en afbeelding uitvoert met 302 nm UV-licht.
      Opmerking: Positieve RT-LAMP reacties zal hebben een laddering patroon. Negatieve reacties van de RT-LAMP moeten niet bevatten alle bands.

6. de verwijdering

  1. Beschikken over RT-LAMP reacties in dubbele verzegelde tassen. Doen niet autoclaaf als dit kan het aerosolize van de RT-LAMP producten, leiden tot valse positieve reacties in de toekomst.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RT-LAMP reacties kunnen worden geanalyseerd met behulp van drie verschillende methoden. Ten eerste, met de toevoeging van een nucleïnezuur fluorescerende kleurstof, positieve reacties zullen geel/groen van kleur waar negatieve reacties oranje in kleur met het blote oog wordt weergegeven. Ten tweede, de toevoeging van de fluorescerende nucleïnezuur kleurstof naar RT-LAMP reactie resulteert in een fluorescent signaal wanneer de monsters zijn opgewonden door UV-licht. Negatieve reacties zal een opspoorbaar signaal van de TL niet hebben een achtergrond fluorescentie die mogelijk aanwezig is in kleine hoeveelheden in de negatieve controle. Tot slot kunnen RT-LAMP reacties uit worden uitgevoerd op een agarose gel. Positieve reacties van de RT-LAMP zal hebben een banding patroon, terwijl negatieve reacties geen DNA-bands hebben zal. Voorbeelden van dit gebruik van alle drie van deze analysemethoden zijn aangetoond in Figuur 2 en 3. Geen van deze monsters had RNA geïsoleerd voorafgaand aan RT-LAMP. Figuur 1 toont het neerslaan van een hele mug in PBS, die volstaat voor het gebruik in de reactie van de RT-LAMP. In Figuur 2, de specificiteit van de reactie van ZIKV RT-LAMP wordt aangetoond: alleen de moleculaire controle van de ZIKV, niet de DENV moleculaire besturingselement of negatieve controle, heeft een positieve reactie van de RT-LAMP. Bovendien wordt de ZIKV ontdekt in zowel de urine als serum van de patiënt met bekende ZIKV-infectie, maar niet in de patiënt asymptomatisch controle zonder ZIKV infectie(Figuur 2). In Figuur 2B, de monsters worden getest op menselijke 18s rRNA met behulp van RT-LAMP. Alleen de monsters van de patiënten (urine of serum), maar niet de moleculaire besturingselementen of de negatieve controle, zijn positief voor 18s rRNA. Daarom 18s rRNA RT-LAMP kan worden gebruikt als een kwaliteitscontrole voor reacties van de RT-LAMP voor de monsters van menselijke patiënten. Mosquito monsters kunnen ook worden getest voor de ZIKV of de kwaliteitscontrole van de RT-LAMP, AEDAE (Figuur 3). In dit voorbeeld zijn de positieve moleculaire controle voor zowel ZIKV als de mug die besmet zijn met ZIKV positief voor ZIKV. De negatieve controle, de moleculaire control voor DENV, de mock besmette mug (mug microinjected met cel voedingsbodems die geen virus bevatten), en de mug DENV besmet zijn allemaal negatief voor ZIKV (Figuur 3A). Alle de muggen zijn echter positief voor AEDAE door RT-LAMP (Figuur 3B).

Indien mogelijk, moeten alle drie de analytische methoden worden gebruikt ter bevestiging van een positieve of negatieve reactie als soms het fluorescent signaal kan zwak en sommige individuen mogelijk kleurenblind, waardoor de visuele kleurverandering moeilijk te bepalen. In gevallen waar de negatieve controle positief is, de gehele set van geteste monsters is ongeldig als verontreiniging en daarom de valse positieven kunnen niet worden uitgesloten. In gevallen waar de positieve controle negatief is, is de gehele set van monsters ongeldig als de reactie van de RT-LAMP kan niet hebben gewerkt. Dit is een kwalitatieve lezen uit, echter hogere kopieën van het virus zal resulteren in een toename van de RT-LAMP producten die kan worden gewaardeerd door fluorescerende intensiteit of door de intensiteit van het DNA "banding" patroon door gelelektroforese.

Figure 1
Figuur 1 : Voorbereiding van de mug ruwe lysate. (A) plaats een mug in 100 µL van PBS in een microcentrifuge buis. (B) gebruik van een P10 Pipetteer tip, crush de mug tegen de kanten van de buis 10 keer. (C) Dit levert een ruwe lysate die moet worden gesponnen beneden kort in een centrifuge tafelblad naar pellet puin. Alleen het supernatant moet worden gebruikt voor RT-LAMP reactie. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : ZIKV en 18S rRNA RT-LAMP in patiënt urine en serum monsters. Urine of serum monsters van een asymptomatische controle patiënt (C01) of ZIKV besmette patiënt (Z01) werden onderworpen aan een ZIKV (A) of 18S rRNA (B) specifieke RT-LAMP reacties. RT-LAMP reacties waren gevisualiseerd na de toevoeging van een fluorescerende nucleïnezuur kleurstof door oog (bovenste deelvenster), groene fluorescentie (middelste deelvenster), of gel elektroforese (onderkant). Lane M: DNA massa Marker; NTC: Geen sjabloon controle (negatieve controle); ZIKV: ZIKV PCR standaard positieve controle; DENV: DENV positieve controle. Klik hier voor een grotere versie van dit cijfer. 

Figure 3
Figuur 3 : ZIKV en AEDAE RT-LAMP in Aegypti AE. . Enkele Ae. aegypti besmet met mock besturingselement, ZIKV of DENV werden onderworpen aan ZIKV (A) of AEDAE (B) specifieke RT-LAMP reacties. RT-LAMP reacties waren gevisualiseerd na de toevoeging van een fluorescerende nucleïnezuur kleurstof door oog (bovenste deelvenster), groene fluorescentie (middelste deelvenster), of gel elektroforese (onderkant). Lane M: DNA massa Marker; NTC: Geen sjabloon controle (negatieve controle); ZIKV: ZIKV PCR standaard positieve controle; DENV: DENV positieve controle. Klik hier voor een grotere versie van dit cijfer. 

Doel Primer Volgorde (5' - 3')
Homo sapien 18S rRNA 18SrRNA-FIP *
18SrRNA-BIP *
18SrRNA-F3
18SrRNA-B3
18SrRNA-LF
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-BIP *
ZIKV-F3
ZIKV-B3
ZIKV-LF
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
AE. Aegypti actine Ae21-FIP *
Ae21-BIP *
Ae21-LF
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* Primers moeten gezuiverd worden door snelle krachtige vloeibare chromatografie (HPLC). Voor alle andere primers volstaan demineralisatie standaardvoorwaarden.

Tabel 1: Primer sequenties voor RT-LAMP reacties. Primer sequenties zijn oorspronkelijk beschreven in eerdere publicatie6.

Volume (µL) Primer Voorraad concentratie (µM) Eindconcentratie (µM)
80 Voorwaartse innerlijke Primer (FIP) 100 16
80 Achterwaartse innerlijke Primer (BIP) 100 16
10 Voorwaartse buitenste Primer (F3) 100 2
10 Achterwaartse buitenste Primer (B3) 100 2
20 Loop vooruit (LF) 100 4
20 Loop achteruit (LB) 100 4
280 moleculaire rang water - -
500 Totaal

Tabel 2: voorbereiding van 10 x RT-LAMP Primer Mix. De RT-LAMP primer instellen voor Ae. aegypti actine bevat geen een BF primer; Dit volume vervangen door water.

1 x Volume (µL) Component Definitieve Conc. Voor 25 µL Volume
2.5 10 x isothermische versterking Buffer 1 x
1.8 100 mM dU/A/T/C/GTPs 1.4 mM
2.0 100 mM MgSO4 6 mM + 2 mM in buffer = 8 mM [4-10 mM bereik]
2.5 10 x Primers 1.6 ΜM FIP/BIP, 0,2 ΜM F3/B3, 0.4 ΜM-FL/BL
1.0 thermophilic polymerase van DNA met strand displacement (8.000 U/mL) 8 U
0,5 Reverse-Transcriptase (15.000 U/mL) 7.5 U
0,5 UDG (1.000 U/mL) 0,5 U
12.3 moleculaire rang water -
23,0 Totaal

Tabel 3: Bereiding van RT-LAMP Master Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De bepaling van ZIKV RT-LAMP in dit papier werkt met behulp van zowel de mens als de mug monsters6beschreven. De limiet van detectie was ongeveer 1 genoom gelijkwaardig6, dat voldoende moeten zijn zou aangezien de typische virale lading van een symptomatische patiënt van de ZIKV besmet 10 is3 te 106 PFU/mL7. Daarnaast kan deze methode ZIKV detecteren in monsters zonder eerste isoleren RNA en zonder versterking van virus in celkweek. Dit aanzienlijk vermindert de tijd, kosten en gezondheidsrisico's van deze test in vergelijking met qRT-PCR.

Urine monsters gebruikt op de volumeverhouding aangegeven in dit protocol mag RT-LAMP reacties optreden zonder een RNA-isolatie. Terwijl men theoretisch de hoeveelheid staal dat wordt gebruikt in een reactie van de RT-LAMP vergroot kon, moet voorzichtigheid worden betracht wanneer dit monster urine. Urine bevat meerdere chemische stoffen die PCR reacties remmen kon; ureum in de urine is bekend dat het degraderen van polymerase8 en met behulp van een reactie van urine/RT-LAMP-verhouding te hoog wordt voorkomen dat de reactie van de RT-LAMP. Als een lage hoeveelheid virus wordt verwacht, zou het beter zijn voor het uitvoeren van een RNA-isolatie met behulp van een specifieke kit voor urine. Evenzo kan serum PCR-remmers die RT-LAMP remmen kunnen als serum wordt gebruikt op een hoger volume8bevatten.

In dit protocol opgenomen is de opname van kwaliteitscontroles voor RT-LAMP reacties, verwant aan een besturingselement laden in Westelijke Bevlekkende Protocollen. Als een klinisch monster negatief voor de kwaliteitscontrole van de RT-LAMP is, kan dan een negatieve reactie voor de ZIKV RT-LAMP zijn een vals negatief aangezien het monster een hoog gehalte aan PCR-remmers of lage bedragen van de totale RNA bevatten kan. Het is niet nodig om te isoleren van RNA uit het monster vóór de bepaling van de RT-LAMP. De representatieve resultaten van de RT-LAMP in dit protocol werden verkregen zonder RNA isolatie. Echter RNA isolatie kan verbeteren de detectie in monsters met een lage virus belasting of die hoge niveaus van PCR-remmers kunnen bevatten. Voor de meeste monster typen met inbegrip van serum, kan een RNA isolatie kit worden gebruikt volgens het voorgestelde protocol van de fabrikant. Voor urine monsters, moet een RNA isolatie kit specifiek voor urine monsters worden gebruikt. Voor mosquito monsters, is het raadzaam lyse van de mug door het uitvoeren van de mug in 100 µL van PBS door een Shredder kolom gedurende 2 minuten op de maximumsnelheid of douncing voor RNA isolatie. RNA kan worden geëlueerd in 30 µL van elutie buffer en opgeslagen bij-80 ° C tot gebruik.

RNA isolatie wordt vervolgens voorgesteld om het verwijderen van de endogene PCR-remmers of te concentreren het RNA voorafgaand aan RT-LAMP. Als de controle van de kwaliteit van de RT-LAMP nog steeds negatief is, moet dan qRT-PCR worden gebruikt voor de detectie van de ZIKV.

De RT-LAMP inleidingen in dit protocol hebben bevestigd te werken aan allerlei temperaturen (57-65 ° C) en incubatie tijden (8-60 min), evenals het gebruik van onconventionele verwarming bronnen (bv., vlamloze rantsoen kachel, waterbad) buiten de standaard laboratoriumomstandigheden. Alle de temperaturen getest gaf vergelijkbare resultaten. De optimale tijd voor de detectie van ZIKV RT-LAMP producten was gebaseerd op de detectie door alleen visuele kleur te veranderen, 30 min. Echter, de detectie onder UV licht excitatie of patronen op gels in een strookpatroon waren positief met zo weinig als 8 min totaal incubatietijd. Sommige RT-LAMP protocollen omvatten DMSO, maar in dit protocol, kan het resulteren in de remming van de RT-LAMP-reactie. Met behulp van een thermophilic polymerase van DNA die kunnen worden ingesteld bij kamertemperatuur wellicht voordelen ten opzichte van wild-type thermophilic polymerase van DNA met inbegrip van snellere amplificatie signalen en toegenomen stabiliteit bij kamertemperatuur9,10 . Ethidiumbromide in plaats daarvan kan worden gebruikt voor nucleïnezuur visualisatie in 2% agarose gel, andere tl nucleïnezuur kleurstoffen voor agarose gel wel lagere mutagene werking waardoor ze een veiligere keuze. Passende voorzorgsmaatregelen zoals het dragen van handschoenen moeten echter nog worden gebruikt.

Een beperking van dit protocol is dat het een kwalitatieve en niet een kwantitatieve techniek, echter relatieve kwantificering6kan gebeuren. Bovendien, RT-LAMP primers zijn zeer specifiek en tegen een zeer geconserveerde opeenvolging van het nonstructural-eiwit 5 van ZIKV die is gevonden in 16 stammen en gecontroleerd om te werken in ten minste 5 stammen6werden ontworpen. Het is mogelijk dat uitgebreide mutaties tot ZIKV in het wild kunnen niet aantoonbaar met deze inleidingen in de toekomst. Andere groepen hebben ook ontwikkeld voor nieuwe technologieën voor het opsporen van ZIKV die mogelijk van belang11,12,13,14,15,16,17 .

Kortom biedt dit protocol een snelle, eenvoudige en kosteneffectieve methode voor ZIKV in een verscheidenheid van monster types die geen gespecialiseerde apparatuur vereist. Hierdoor een nieuwe diagnostische tool voor de detectie van de ZIKV waarin RNA niet hoeft te worden geïsoleerd voordat de RT-LAMP-reactie.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL en MBC hebben intellectuele eigendom op Zika virus diagnose methoden. De resterende auteurs hebben geen concurrerende belangen.

Acknowledgments

Dit werk werd gesteund door de Maureen en Ronald Hirsch familie filantropische bijdrage en veld Neurosciences Institute, St. Mary's van Michigan. De financiers had geen rol in de studie ontwerp, gegevensverzameling en analyse, besloten tot bekendmaking of voorbereiding van het manuscript. Wij danken ook Dr. Bernadette Zwaans en Elijah Ward voor hun kritische evaluatie van het manuscript.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
Reverse transcriptie-lus-gemedieerde isotherme amplificatie (RT-LAMP) Assay voor Zika-Virus en huishouden genen in Urine, Serum en Mosquito monsters
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter