Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Reverse transkription-Loop-medieret isotermisk forstærkning (RT-lampe) Assay for Zika Virus og husholdning gener i urin, Serum og myg prøver

doi: 10.3791/58436 Published: September 14, 2018

Summary

Denne protokol giver en effektiv og billig metode til at registrere Zika virus eller styre mål i human urin og serum prøver eller myg ved reverse transkription loop-medieret isotermisk forstærkning (RT-lampe). Denne metode kræver ikke RNA isolering og kan ske inden for 30 min.

Abstract

Infektion med Zika virus (ZIKV) kan være asymptomatisk hos voksne, men infektion under graviditet kan føre til abort og alvorlige neurologiske fødselsdefekter. Målet med denne protokol er at hurtigt opdage ZIKV i både menneskelige og myg prøver. Den nuværende guld standard for ZIKV påvisning er kvantitative reverse transkription PCR (qRT-PCR); reverse transkription loop-medieret isotermisk forstærkning (RT-lampe) kan give mulighed for en mere effektiv og billig test uden behov for dyrt udstyr. I denne undersøgelse bruges RT-LAMPEN til påvisning af ZIKV i forskellige biologiske prøver inden for 30 min, uden første isolering af RNA fra prøven. Denne teknik er påvist ved hjælp af ZIKV inficerede patient urin og serum, og inficerede myg prøver. 18s ribosomale ribonukleinsyre og actin er brugt som kontrolelementer i menneskelige og myg prøver, henholdsvis.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I 2015 fik Zika virus (ZIKV) fremtrædende global opmærksomhed som en smitsom sygdom giver anledning til bekymring for infektion under graviditet var forbundet med abort, dødfødsel, alvorlige neurologiske fødselsdefekter herunder mikrocefali, såvel som andre medfødte fødselsdefekter1. I sjældne tilfælde, har ZIKV været forbundet med Guillain-Barre syndrom. ZIKV er primært overføres af Aedes myg; Det kan dog også spredes gennem seksuel kontakt1. Betragtning af, at infektion med ZIKV er asymptomatisk hos de fleste mennesker eller præsenterer med milde influenza-lignende symptomer som overlapper med symptomer på infektion af andre arborviruses1, var der behov for forbedrede metoder til hurtig og omkostningseffektiv påvisning af ZIKV til skærmen såvel mennesker som lokale mosquito befolkninger.

Kvantitative reverse transkription PCR (qRT-PCR) er en pålidelig analyse til registrering af ZIKV; denne teknik kræver dog dyrt specialudstyr, uddannet personale og RNA isolering fra prøven af interesse. Reverse transkription loop-medieret isotermisk forstærkning (RT-lampe) er en et-trins nukleinsyre amplifikation metode baseret på PCR-teknologi, der kun kræver én inkubation temperatur på grund af brugen af en termofile DNA polymerase med strand forskydning egenskaber. Det omgår behovet for en thermocycler og nedsætter længden af tid, det tager at fuldføre analysen. Yderligere fordele ved RT-lampe omfatter høj specificitet og følsomhed, robusthed på en række pH-niveauer og temperaturer og modstand mod mange PCR-hæmmere2. Det har en relativt lav pris og reagenser er stabile ved stuetemperatur. I betragtning af disse karakteristika, kan RT-lampe være indsat i et laboratorium eller i feltet. Som sådan, har lampe reaktioner udviklet til at opdage en række patogener og andre former for infektion3,4,5. Målet med RT-lampe protokollen beskrevet i denne hvidbog er at opdage ZIKV uden RNA isolering i human serum og urin prøver så godt som en enkelt inficerede myg indenfor 30 min via RT-lampe. Denne metode kan bruges til at erstatte qRT-PCR, da det er en følsom, hurtig diagnostisk værktøj, der fungerer hurtigt og i indstillinger uden for laboratoriet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle metoder beskrevet her er blevet godkendt af institutionelle Review Board (IRB) af Beaumont sundhed. Alle eksperimenter blev udført i overensstemmelse med relevante retningslinjer og forordninger.

Advarsel: Alle potentielt smittefarlige materialer behandles efter biosikkerhedsniveau 2 som standarder, herunder brugen af personlige værnemidler. Procedurer, som kan producere aerosol bør udføres i en biosikkerhed kabinet. Derudover bør arbejde med levende myg udføres i passende leddyr indeslutning niveau 1-3 facilitet. I betragtning af sammenslutningen af ZIKV infektion med medfødte misdannelser, bør kvinder der er gravide, forsøger at blive gravide, eller partnere af disse kvinder betydeligt minimere deres laboratorium eksponering for ZIKV. Transport af ZIKV prøver er klassificeret i USA som kategori B biologiske stoffer i overensstemmelse med afdeling af transport farlige materialer forordninger (49 CFR Part 171-180) og derfor shipping prøver skal overholde dem retningslinjer. Indførsel i USA af ZIKV biospecimens kræver et Centers for Disease Control og forebyggelse (CDC) importtilladelse. Importtilladelse af nogen leddyr, der kunne tjene som en vektor for ZIKV transmission, selvom de ikke er inficeret, kræver en United States Department of Agriculture (USDA). Disse oplysninger er aktuelle på tidspunktet for offentliggørelsen. Opdaterede anbefalinger kan findes på https://www.cdc.gov/zika/laboratories/lab-safety.html.

Bemærk: RT-lampe reaktioner er tilbøjelige til højere satser for falske positive reaktioner, så bør der tages forholdsregler i eksperimentel planlægning. Alle opsætning og udførelse af RT-lampe reaktioner bør bruge udpegede pipetter og filter tips. Ideelt set bør der etableres en tværgående arbejdsflow. Hvis det er muligt, skal analyse og imaging (afsnit 5) forekomme i en separat lukket rum til at forhindre forurening. Åbning af reagensglas indeholdende RT-lampe produkter bør holdes på et minimum.

1. RT-lampe Primer forberedelse

  1. Rekonstruere hver frysetørrede RT-lampe primer i vand af Molekylær renhed til en endelig koncentration på 100 µM (tabel 1). Kort vortex primer løsning til at sikre en ensartet løsning og kortvarigt spin ned løsning ved maksimal hastighed i en bordplade centrifuge til at indsamle alle primer løsning.
  2. Forberede en 10 x RT-lampe Primer Mix af FIP, BIP, F3, B3, LF og LB primere ved hjælp af mængderne, der i tabel 2. Kort vortex primer løsning til at sikre en ensartet løsning, og kort spin ned løsning ved maksimal hastighed i en bordplade centrifuge at undgå tab.
    Bemærk: RT-lampe primer til Ae. aegypti actin (AEDAE) indeholder ikke en LB primer (loop primere er ikke altid nødvendige for RT-lampe reaktioner). I dette tilfælde erstatte LB primer volumen med vand af Molekylær renhed.
  3. Gemme primere ved-20 ° C mellem bruger og undgå gratis-tø cykler.

2. Prøvetilberedning

  1. For human urinprøver: Bruge friske urin, frosne urin eller urin i konserveringsmiddel. For friske eller frosne prøve: straks spin ned prøven efter samlingen i 10 min på 700 x g, og bruge supernatanten analyse eller fryse ved-80 ° C til fremtidig brug. Optø frosne prøver på is før brug.
  2. For human serumprøver: Brug enten friske eller frosne serumprøver.
  3. For ZIKV inficeret cellelinjer: Brug enten konditioneret medier eller cellelysater.
    Bemærk: Celle-gratis aircondition medier fra Ae. albopictus C6/36 celler 8 dage efter infektionen kan bruges som positive kontroller for ZIKV RT-lampe reaktioner.
  4. For Ae. aegypti myg: bruger enten helt friske eller frosne myg slagtekroppe. Optø frosne myg på is. Forberede en rå myg lysate ved at placere en individuel myg i 100 µL af fosfatbufferet saltopløsning (PBS) og homogeniseres ved at knuse myg 10 gange med en P10 afpipetteres tip (figur 1). Kort centrifugeres den rå lysate at sammenpresse snavs. Bruge supernatanten downstream RT-lampe analyse.
    Bemærk: Positive kontroller kan genereres i et laboratorium indstilling ved at inficere kvindelige myg ved hjælp af intrathoracic mikroinjektion med ca. 103 genom ækvivalenter af virus i et volumen på 200 nL og høst myg 5 dage efter infektionen.

3. Forbered RT-lampe Master Mix

  1. Forberede en RT-lampe master mix reaktion på is for hver primer sæt der skal anvendes ved hjælp af volumen guide i tabel 3.
    Bemærk: Brug af termolabile Uracil DNA Glycosylase (UDG) hjælper med at forhindre falske positiver.
  2. Vortex kort for at sikre, at alle prøver er godt blandet, så spin ned kortvarigt for at forhindre tab af volumen.

4. RT-lampe Assay

  1. Med pipette overfoeres 23,0 µL af RT-lampe master mix pr. reaktion i en 200 µL PCR rør. Tilsæt 2,0 µL af prøven (urin, serum eller rå mosquito lysate supernatanten som beskrevet i trin 2). Dette vil bringe den samlede mængde til 25,0 µL pr. RT-lampe reaktion. Brug vand af Molekylær renhed til den negative kontrol. Omfatte en positiv kontrol.
    Bemærk: En PCR standard eller virus bestande fra supernatanten af inficerede cellelinjer kan bruges som en positiv kontrol.
    1. Valgfrit: Omfatte en specificitet kontrol reaktion af en relaterede arbovirus såsom dengue virus (DENV). Forberede prøven, som beskrevet i trin 2 Ifølge prøvetypen. Tilføje 2,0 µL af kontrolelementet specificitet til 23,0 µL af RT-lampe master mix i en 200 µL PCR rør.
  2. Opvarme prøverne på 61 ° C i 30 min. ved hjælp af en varme blok, vandbad eller thermocycler.
  3. Varme deaktivere polymerasen ved opvarmning til 80 ° C i 10 min.

5. RT-lampe analyse

Bemærk: Udføre RT-lampe analyse i en separat, lukkede rum.

  1. Efter inkubering tilsættes adgang RT-lampe reaktioner visuelt ved at se for tilstedeværelsen af en farveændring.
    1. Fortyndes de fluorescerende nukleinsyre farvestof 1:10 i TAE (40 mM Tris, 20 mM eddikesyre, 1 mM EDTA) buffer.
      Forsigtig: Enhver nukleinsyre pletten binder sig til nukleinsyrer og derfor er kræftfremkaldende. Brug handsker når du håndterer.
    2. 12 µL af RT-lampe reaktion, tilføje 2 µL af fluorescerende nukleinsyre farvestof fortynding.
      Bemærk: Negative reaktioner vil være orange i farve og positive reaktioner vil være gul/grøn farve.
    3. Valgfrit: Tage billeder af RT-lampe reaktioner på en hvid baggrund ved hjælp af et kamera.
  2. Placer prøver under 302 nm UV lys til at bekræfte tilstedeværelsen af RT-lampe produkter af fluorescens. Tage billede af resultatet ved hjælp af et kamera.
    Bemærk: Positiv RT-lampe reaktioner vil have en fluorescerende output.
    Forsigtig: Bære UV beskyttende øje motorbriller eller ansigt skjold, når du arbejder med UV-lys.
  3. Valgfrit: Bekræfte tilstedeværelsen af RT-lampe produkter ved at udføre gelelektroforese på prøverne.
    1. Hæld en 2%-agarosegel i 1 x TAE buffer med en nukleinsyre pletten til visualisering.
      Forsigtig: Enhver nukleinsyre pletten binder sig til nukleinsyrer og derfor er kræftfremkaldende. Brug handsker når du håndterer.
    2. Tilføj 5 µL af en DNA stige i de første lane at sammenligne Molekylær vægt.
    3. For hver RT-lampe reaktion, bland 13 µL af RT-lampe reaktionsblandingen med 2 µL DNA lastning farvestof. Indlæse 15 µL blanding, der indeholder DNA lastning farvestof.
    4. Kør gelen på 90 V i 90 min. eller indtil bandene er adskilt og billede med 302 nm UV-lys.
      Bemærk: Positiv RT-lampe reaktioner vil have en laddering mønster. Negative RT-lampe reaktioner bør ikke indeholde enhver bands.

6. bortskaffelse

  1. Bortskaffe RT-lampe reaktioner i dobbelt forseglede poser. Gør ikke autoklave, som dette kan aerosolize RT-lampe produkter, hvilket fører til falsk positive reaktioner i fremtiden.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RT-lampe reaktioner kan analyseres ved hjælp af tre forskellige metoder. Først, med tilsætning af en fluorescerende nukleinsyre farvestof, positive reaktioner vil være gul/grøn farve hvor negative reaktioner vises orange farve med det blotte øje. Andet, tilsætning af fluorescerende nukleinsyre farvestof til RT-lampe reaktion resulterer i et fluorescerende signal når prøverne er ophidset af UV-lys. Negative reaktioner vil ikke have en påviselig fluorescerende signal over enhver baggrund fluorescens, der kan være til stede i små mængder i den negative kontrol. Endelig, RT-lampe reaktioner kan køres på et agarosegel. Positive RT-lampe reaktioner vil have en banding mønster, mens negative reaktioner vil have ingen DNA bands. Eksempler på denne brug af alle tre af disse analysemetoder, der er vist i figur 2 og 3. Ingen af disse prøver havde RNA isoleret før RT-lampe. Figur 1 viser knusning af en hel myg i PBS, som er tilstrækkelige til brug i RT-lampe reaktion. I figur 2, specificiteten af ZIKV RT-lampe reaktion fremgår: kun ZIKV molekylære kontrol, ikke DENV molekylære kontrol eller negativ kontrol, har en positiv RT-lampe reaktion. Desuden er ZIKV registreret i både urin og serum fra dyr af en patient med kendt ZIKV infektion, men ikke i asymptomatisk kontrol patienten uden ZIKV infektion (fig. 2A). I figur 2B, prøverne er testet for menneskelige 18s rRNA ved hjælp af RT-lampe. Kun prøverne fra patienter (urin eller serum), men ikke den molekylære kontrol eller den negative kontrol, er positive for 18s rRNA. Derfor 18s rRNA RT-LAMPEN kan bruges som en kvalitetskontrol til RT-lampe reaktioner prøverne fra menneskelige patienter. Myg prøver kan testes på samme måde for ZIKV eller RT-lampe kvalitetskontrol, AEDAE (figur 3). I dette eksempel er den positive molekylære kontrol for ZIKV samt myg inficeret med ZIKV er positive for ZIKV. Den negative kontrol, den molekylære kontrol for DENV, mock inficerede myg (myg microinjected med celle kultur medier indeholdende ingen virus), og DENV inficeret myg er alle negative for ZIKV (fig. 3A). Men alle myg er positivt for AEDAE af RT-lampe (fig. 3B).

Når det er muligt, bør alle tre analytiske metoder bruges til at bekræfte en positiv eller negativ reaktion, som undertiden den fluorescerende signal kan være svage og nogle personer kan være farveblinde, hvilket gør visual farveændringen vanskeligt at afgøre. I tilfælde, hvor den negative kontrol er positiv, hele sættet af testede prøver er ugyldigt som forurening og derfor falske positiver kan ikke udelukkes. I tilfælde, hvor den positive kontrol er negativ, er hele det sæt af prøver ugyldigt som RT-lampe reaktion ikke kan har fungeret. Dette er en kvalitativ læse ud, dog højere kopier af virus vil resultere i en stigning i RT-lampe produkter, som kan blive værdsat af fluorescerende intensitet eller intensiteten af DNA banding mønster af gelelektroforese.

Figure 1
Figur 1 : Forberedelse af myg rå lysate. (A) Placer en myg i 100 µL af PBS i et microcentrifuge rør. (B) ved hjælp af en P10 afpipetteres tip, knuse myg mod siderne af røret 10 gange. (C) Dette giver en rå lysate, der bør være spundet ned kort i en bordplade centrifuge til pellet debris. Supernatant, som kun bør anvendes til RT-lampe reaktion. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : ZIKV og 18S rRNA RT-lampe i urin og serum patientprøver. Urin eller serum prøver fra en asymptomatisk kontrol patienten (C01) eller ZIKV inficeret patient (Z01) blev udsat for en ZIKV (A) eller 18S rRNA (B) særlige RT-lampe reaktioner. RT-lampe reaktioner blev visualiseret efter tilsætning af en fluorescerende nukleinsyre farvning af øjet (øverste panel), grønne fluorescens (midterste panel), eller gel elektroforese (nederste panel). Lane M: DNA masse markør; NTC: Ingen skabelon kontrol (negativ kontrol); ZIKV: ZIKV PCR Standard positiv kontrol; DENV: DENV positive kontrol. Venligst klik her for at se en større version af dette tal. 

Figure 3
Figur 3 : ZIKV og AEDAE RT-LAMPEN i AE. aegypti . Enkelt Ae. aegypti inficeret med mock kontrol, ZIKV eller DENV blev udsat for ZIKV (A) eller AEDAE (B) særlige RT-lampe reaktioner. RT-lampe reaktioner blev visualiseret efter tilsætning af en fluorescerende nukleinsyre farvning af øjet (øverste panel), grønne fluorescens (midterste panel), eller gel elektroforese (nederste panel). Lane M: DNA masse markør; NTC: Ingen skabelon kontrol (negativ kontrol); ZIKV: ZIKV PCR Standard positiv kontrol; DENV: DENV positive kontrol. Venligst klik her for at se en større version af dette tal. 

Target Primer Rækkefølge (5' - 3')
Homo sapien 18S rRNA 18SrRNA-FIP *
18SrRNA-BIP *
18SrRNA-F3
18SrRNA-B3
18SrRNA-LF
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-BIP *
ZIKV-F3
ZIKV-B3
ZIKV-LF
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
AE. aegypti actin Ae21-FIP *
Ae21-BIP *
Ae21-LF
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* Primere bør renses af hurtigt og højtydende væskekromatografi (HPLC). For alle andre primere er udvanding standardbetingelser tilstrækkelig.

Tabel 1: Primer sekvenser for RT-lampe reaktioner. Primer sekvenser er oprindelig beskrevet i tidligere publikation6.

Volumen (µL) Primer Stock koncentration (µM) Endelig koncentration (µM)
80 Forreste inderste Primer (FIP) 100 16
80 Baglæns indre Primer (BIP) 100 16
10 Sende ydre Primer (F3) 100 2
10 Baglæns udvendige Primer (B3) 100 2
20 Løkke frem (LF) 100 4
20 Loop bagud (LB) 100 4
280 vand af Molekylær renhed - -
500 I alt

Tabel 2: forberedelse af 10 x RT-lampe Primer Mix. RT-lampe primer til Ae. aegypti actin indeholder ikke en BF primer; erstatte denne diskenhed med vand.

1 x Volume (µL) Komponent Endelige koncentreret For 25 µL volumen
2.5 10 x isotermiske forstærkning Buffer 1 x
1.8 100 mM dU/A/T/C/GTPs 1,4 mM
2.0 100 mM MgSO4 6 mM + 2 mM i buffer = 8 mM [4-10 mM rækkevidde]
2.5 10 x primere 1.6 ΜM FIP/BIP, 0,2 ΜM F3/B3, 0,4 ΜM FL/BL
1,0 termofil DNA polymerase med strand deplacement (8.000 U/mL) 8 U
0,5 Reverse transkriptase (15.000 U/mL) 7.5 U
0,5 UDG (1.000 U/mL) 0,5 U
12.3 vand af Molekylær renhed -
23,0 I alt

Tabel 3: Forberedelse af RT-lampe Master Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ZIKV RT-lampe analysen beskrives i dette papir værker ved hjælp af både menneskelige og myg prøver6. Detektionsgrænsen var ca 1 genom tilsvarende6, som bør være tilstrækkeligt, da den typiske viral belastning af en symptomatisk ZIKV inficeret patient er 103 til 106 PFU/mL7. Derudover kan denne metode registrerer ZIKV i prøver uden første isolere RNA og uden virus forstærkning i cellekultur. Dette mindsker betydeligt tid, omkostninger og sundhedsrisici af denne analyse i forhold til qRT-PCR.

Urinprøver anvendes på volumen forholdet i denne protokol anførte bør tillade RT-lampe reaktioner opstår uden en RNA isolering. Mens man kunne teoretisk øge mængden af anvendte i en RT-lampe reaktion prøve, bør der udvises forsigtighed når denne prøve er urin. Urin indeholder flere kemikalier, der kunne hæmme PCR reaktioner; urea i urinen er kendt for at forringe polymeraser8 og bruge en urin/RT-lampe reaktion forhold, der er for højt vil forhindre RT-lampe reaktion. Hvis et lavt beløb af virus er forventet, ville det være bedre til at udføre en RNA isolering ved hjælp af et kit specifikt for urin. Serum kan ligeledes indeholde PCR-hæmmere, som kan hæmme RT-LAMPEN når serum anvendes på en højere bind8.

Inkluderet i denne protokol er medtagelsen af kvalitetskontrol for RT-lampe reaktioner, beslægtet med en loading kontrol i western blotting protokoller. Hvis en klinisk prøve er negative for kvalitetskontrol RT-lampe, kan så en negativ reaktion til ZIKV RT-lampe være et falsk negativt som prøven kan indeholde en stor mængde af PCR hæmmere eller lavt beløb af total RNA. Det er ikke nødvendigt at isolere RNA fra prøven før RT-lampe assay. De repræsentative RT-lampe resultater i denne protokol blev opnået uden RNA isolering. Dog RNA isolering kan forbedre påvisning i prøver med lav virus belastning, eller som kan indeholde høje niveauer af PCR-hæmmere. For de fleste prøve typer herunder serum, kan en RNA isolering kit bruges efter producentens foreslog protokol. Af urinprøver, bør en RNA isolering kit specifikke for urinprøver anvendes. Det anbefales for myg prøver, at lyse myg ved at køre myg i 100 µL af PBS gennem en makulering kolonne for 2 min. ved maksimal hastighed eller douncing før RNA isolering. RNA kan elueret i 30 µL af eluering buffer og opbevares ved-80 ° C indtil brug.

RNA isolering er derefter foreslog at fjerne de endogene PCR-hæmmere eller koncentrere RNA før RT-lampe. Hvis RT-lampe kvalitetskontrol er stadig negative, bør derefter qRT-PCR anvendes til registrering af ZIKV.

RT-lampe primere i denne protokol er blevet bekræftet til at arbejde på en række temperaturer (57-65 ° C) og inkubation times (8-60 min), samt ved hjælp af utraditionelle varme kilder (fx., flammeloes ration heater, vandbad) udenfor standard laboratorieforhold. Alle de temperaturer, der er testet gav sammenlignelige resultater. Baseret på påvisning af visuelle farveændring alene, var det optimale tidspunkt for påvisning af ZIKV RT-lampe produkter 30 min. Påvisning af UV lys excitation eller banding mønstre på geler var dog positiv med så lidt som fra 8 min samlede inkubationstiden. Nogle RT-lampe protokoller omfatter DMSO, men i denne protokol, kan det resultere i hæmning af RT-lampe reaktion. Ved hjælp af en termofile DNA-polymerase, der kan sættes op ved stuetemperatur kan have fordele over vildtype termofile DNA polymerase herunder hurtigere forstærkning signaler og har øget stabilitet ved stuetemperatur9,10 . Ethidiumbromid kan bruges i stedet for nukleinsyre visualisering i 2% agarosegelitris, men andre fluorescerende nukleinsyre farvestoffer til agarosegelitris har lavere mutagene egenskaber gør dem en sikrere valg. Passende sikkerhedsforanstaltninger såsom iført handsker bør dog stadig anvendes.

En begrænsning af denne protokol er at det er en kvalitativ og ikke en kvantitativ teknik, men relative kvantificering kan ske6. Derudover RT-lampe primere er meget specifikke og var designet mod en yderst velbevarede sekvens af strukturmaessige protein 5 af ZIKV, der er fundet i 16 stammer og verificeret for at arbejde i mindst 5 stammer6. Det er muligt, at omfattende mutationer til ZIKV i naturen ikke må kunne påvises ved disse primere i fremtiden. Andre grupper har også udviklet nye teknologier til påvisning af ZIKV, der kan være af interesse11,12,13,14,15,16,17 .

I Resumé giver denne protokol en hurtig, enkel og omkostningseffektiv metode til ZIKV i en række prøve typer, som ikke kræver specialiseret udstyr. Dette giver en ny diagnostisk redskab for ZIKV opdagelse, hvor RNA ikke har at være isoleret før RT-lampe reaktion.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL og MBC har intellektuel ejendomsret på Zika virus diagnose metoder. De resterende forfattere har ingen konkurrerende interesser.

Acknowledgments

Dette arbejde blev støttet af Maureen og Ronald Hirsch familie filantropiske bidrag og felt neurovidenskab Institute, St. Marys i Michigan. Finansieringskilderne spillede ingen rolle i undersøgelse design, dataindsamling og analyse, beslutningen om at offentliggøre eller forberedelse af manuskriptet. Vi takker også Dr. Bernadette Zwaans og Elijah Ward for deres kritiske gennemgang af håndskriftet.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
Reverse transkription-Loop-medieret isotermisk forstærkning (RT-lampe) Assay for Zika Virus og husholdning gener i urin, Serum og myg prøver
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter