Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

İzotermal amplifikasyon (RT-lamba) transkripsiyon-Loop-aracılı tahlil Zika virüs ve Housekeeping genler idrar, Serum ve sivrisinek örnekleri için ters

doi: 10.3791/58436 Published: September 14, 2018

Summary

Bu iletişim kuralı Zika virüs tespit veya hedefleri insan serum ve idrar örnekleri veya sivrisinekler Ters transkripsiyon döngü-aracılı izotermal amplifikasyon tarafından (RT-lamba) denetlemek için verimli ve düşük maliyetli bir yöntem sağlar. Bu yöntem does değil istemek RNA izolasyon ve 30 dk içinde yapılabilir.

Abstract

Zika virüs (ZIKV) ile enfeksiyon yetişkinlerde asemptomatik olabilir, ancak, gebelik sırasında enfeksiyon çocuk düşürme ve ağır nörolojik Doğum kusurları yol açabilir. Bu iletişim kuralı, hızlı bir şekilde insan ve sivrisinek ZIKV algılamak için hedeftir. ZIKV algılama için geçerli altın standart olduğunu nicel Ters transkripsiyon PCR (qRT-PCR); Ters transkripsiyon döngü-aracılı izotermal amplifikasyon (RT-lamba) bir daha verimli ve düşük maliyetli pahalı ekipmanlara gerek kalmadan test etmek için izin verebilir. Bu çalışmada, RT-lamba ZIKV algılama 30 dk içinde çeşitli biyolojik örneklerde için ilk örnekten RNA izole olmadan kullanılır. Bu tekniği kullanarak ZIKV hasta idrar ve serum enfekte ve sivrisinek örnekleri enfekte gösterilmiştir. 18s ribozomal ribonükleik asit ve aktin insan ve sivrisinek örnekleri, denetimler olarak sırasıyla kullanılır.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Gebelik sırasında enfeksiyon bağlı için düşük, distres, microcephaly, hem de diğer konjenital dahil olmak üzere ağır nörolojik Doğum kusurları için 2015 yılında Zika virüs (ZIKV) önde gelen küresel dikkat endişe bulaşıcı bir hastalık olarak elde Doğum kusurları1. Nadir de olsa bazen ZIKV Guillain-Barré sendromu ile ilişkili olduğu düşünülmektedir. ZIKV öncelikle Aedes sivrisinekler tarafından iletilir; Ancak, bu da cinsel temas1ile yayılır. Verilen bu ZIKV enfeksiyonla insanların çoğu asemptomatik veya diğer arborviruses1enfeksiyon belirtileri olan üst üste hafif grip benzeri belirtiler sunar, hızlı ve düşük maliyetli algılanması için gelişmiş yöntemler için bir ihtiyaç vardı Hem insanlar hem de yerel sivrisinek nüfus ekran ZIKV.

Nicel Ters transkripsiyon PCR (qRT-PCR) ZIKV algılama için güvenilir bir tahlil olduğunu; Ancak, bu teknik pahalı özel ekipman, eğitimli personel ve örnek RNA izolasyonu ilgi gerektirir. Ters transkripsiyon döngü-aracılı izotermal amplifikasyon (RT-lamba) sadece bir kuluçka sıcaklık iplikçik ile termofilik DNA polimeraz kullanımı nedeniyle gerektirir PCR teknolojisi tabanlı bir tek adımlı nükleik asit amplifikasyon yöntemdir yer değiştirme özellikleri. Bu bir thermocycler ihtiyacını kaçınmanızı sağlar ve tahlil tamamlamak için gereken süreyi azaltır. RT-lamba ek avantajları şunlardır onun yüksek özgüllük ve hassasiyet, pH seviyeleri ve sıcaklıklar ve birçok PCR inhibitörleri2direnç bir mesafeden sağlamlık. Reaktifler oda sıcaklığında kararlı ve nispeten düşük maliyet vardır. Bu özellikleri göz önüne alındığında, RT-lamba bir laboratuvar veya alana dağıtılabilir. Bu nedenle, lamba tepkiler çeşitli patojenler ve diğer tür enfeksiyon3,4,5algılamak için geliştirilmiştir. Bu raporda açıklanan RT-lamba Protokolü amacı RNA izolasyon insan serum ve idrar örneklerinde de RT-lamba üzerinden 30 dk içinde tek bir virüslü sivrisinek gibi olmadan ZIKV tespit etmektir. Bu yöntem hızlı bir şekilde ve ayarları laboratuvar dışında çalışır bir duyarlı, hızlı tanı aracı olarak qRT-PCR değiştirmek için kullanılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tüm yöntem tanımlamak burada kurumsal İnceleme Kurulu (IRB) Beaumont sağlık tarafından onaylanmıştır. Tüm deneyler ilgili kurallara ve düzenlemelere uygun şekilde yapıldı.

Dikkat: Tüm potansiyel bulaşıcı malzemeler kişisel koruyucu ekipman kullanımı da dahil olmak üzere seviye 2 standartlarına göre ele alınmalıdır. Aerosol üretebilir tüm yordamlar bir Biyogüvenlik kabini yapılmalıdır. Ayrıca, çalışma canlı sivrisinek ile uygun eklem bacaklılar koruma düzey 1-3 tesisinde gerçekleştirilmelidir. Konjenital anormallikler ile ZIKV enfeksiyon Derneği göz önüne alındığında, gebe kalmaya çalışan hamile kadınlar veya bu kadınlar ortaklarının önemli ölçüde ZIKV laboratuvar maruz kaldıkları en aza indirmek gerekir. ZIKV örnekleri taşıma Amerika Birleşik Devletleri'nde Kategori B biyolojik maddeler uyarınca bölümü ulaşım tehlikeli malzemeler düzenlemeler olarak sınıflandırılmış (49 CFR bölüm 171-180) ve bu nedenle örnekleri sevkiyat için uygun yönergeleri. ZIKV Amerika Birleşik Devletleri biospecimens içe aktarma işlemi bir merkezleri hastalık kontrol ve önleme (CDC) ithalat izni gerektirir. Onlar bulaşmamış olsa bile, bir vektör ZIKV iletimi için bir ABD Tarım Bakanlığı (USDA) gerektirdiği hizmet verebilecek herhangi bir Artropodların ithalat izni. Bu bilgiler yayın sırasında geçerli olur. Güncel öneriler https://www.cdc.gov/zika/laboratories/lab-safety.html bulunabilir.

Not: deneysel planlamasında önlemler alınmalıdır böylece RT-lamba reaksiyonlar yanlış olumlu tepkiler, daha yüksek oranda yatkındır. Tüm kurulum ve RT-lamba reaksiyonlar yürütülmesini belirlenen Pipetler ve filtre ipuçları kullanmanız gerekir. İdeal olarak, bir yan iş akışı kurulmalıdır. Mümkünse, analiz ve (Bölüm 5) görüntüleme kontaminasyonu önlemek için ayrı bir kapalı odada gerçekleşmelidir. Test tüpleri RT-lamba ürünleri içeren açılışı minimumda tutulmalıdır.

1. RT-lamba astar hazırlama

  1. Her lyophilized RT-lamba astar moleküler sınıf su 100 µM (Tablo 1) son bir konsantrasyon için yeniden oluşturma. Kısaca astar çözüm homojen bir çözüm sağlamak ve kısaca çözüm tüm astar çözüm toplamak için bir masa üstü santrifüj maksimum hızda aşağı spin girdap.
  2. Hazırlamak bir 10 x RT-lamba Tablo 2' de birimleri kullanma FIP, BIP, F3, B3, Eğer ve LB astar astar karışımı. Kısaca astar çözüm homojen bir çözüm sağlamak ve kısa bir süre içinde herhangi bir kaybı önlemek için bir masa üstü santrifüj maksimum hızda çözüm aşağı spin girdap.
    Not: Ae. aegypti aktin (AEDAE) için ayarla RT-lamba astar LB astar içermiyor (döngü astar her zaman RT-lamba reaksiyonlar için gerekli değildir). Bu durumda, LB astar birim moleküler sınıf su ile değiştirin.
  3. Astar kullanır arasında-20 ° C'de depolayın ve ücretsiz-çözülme döngüsü önlemek.

2. numune hazırlama

  1. İnsan idrar numuneleri için: Taze idrar, donmuş idrar veya idrar koruyucu kullanın. Taze veya dondurulmuş örnek için: hemen koleksiyon için vasıl 700 x g, 10 dk sonra örnek spin ve süpernatant analizi için kullanın veya ileride kullanmak üzere-80 ° C'de dondurmak. Kullanmadan önce buzda donmuş numuneler çözülme.
  2. İnsan serum numuneleri için: Her iki taze veya dondurulmuş serum numuneleri kullanın.
  3. ZIKV için hücre hatları enfekte: klimalı ortamları veya hücre lysates kullanın.
    Not: Boş hücre Ae medyadan şartına. albopictus C6/36 hücreleri 8 gün sonrası enfeksiyon olumlu denetimleri ZIKV RT-lamba reaksiyonlar için kullanılabilir.
  4. Ae. aegypti sivrisinek için: ya da tamamen taze veya dondurulmuş sivrisinek leşleri kullanın. Buzda donmuş sivrisinekler çözülme. Ham sivrisinek lysate fosfat tamponlu tuz çözeltisi (PBS) 100 µL içinde bireysel bir sivrisinek koyarak hazırlamak ve 10 kez P10 damlalıklı ucu (Şekil 1) ile sivrisinek kırma tarafından homojenize. Kısa bir süre herhangi bir enkaz cips lysate ham santrifüj kapasitesi. Süpernatant aşağı akım RT-lamba çözümleme için kullanın.
    Not: Pozitif denetimleri bir laboratuvar ortamında dişi sivrisinekler yaklaşık 103 genom virüs 200 birimindeki karşılıkları ile intratorasik mikroenjeksiyon kullanarak bulaşmasını tarafından oluşturulabilir nL ve sivrisinek 5 gün hasat sonrası enfeksiyon.

3. hazırlayın RT-lamba Master Mix

  1. Buz bir RT-lamba ana mix tepki her astar Tablo 3' te toplu Kılavuzu kullanarak kullanılacak ayarlamak için hazır olun.
    Not: Kullanım thermolabile urasil DNA Glycosylase (UDG), yanlış pozitif önlemede yardımcı olur.
  2. Kısaca tüm örneklerini de karıştırılır sağlamak için girdap sonra spin aşağı kısaca güç kaybını önlemek için.

4. RT-lamba tahlil

  1. Damlalıklı 23.0 µL tepki 200 µL PCR tüp içine başına RT-lamba ana karışımı. 2.0 µL örneği (idrar, serum veya ham sivrisinek lysate süpernatant 2. adımda açıklandığı gibi) ekleyin. Buna 25,0 µL RT-lamba tepki başına toplam hacim getirecek. Negatif kontrol için moleküler sınıf su kullanın. Olumlu bir denetim içerir.
    Not: Bir PCR standart veya virüs stokları süpernatant enfekte hücre hatları üzerinden olumlu bir denetim olarak kullanılabilir.
    1. İsteğe bağlı: ilgili Abdovirüs dang virüs (DENV) gibi bir özgüllüğü denetim reaksiyon içerir. Örnek örnek türüne göre adım 2'de açıklandığı şekilde hazırlayın. Özgüllük denetiminin 2.0 µL 23.0 µL 200 µL PCR tüp içine RT-lamba ana karışımı ekleyin.
  2. Örnekleri için ısı blok, su banyosu veya thermocycler kullanarak 30 dk 61 ° C'de ısı.
  3. Isı devre dışı bırakmak ve polimeraz ile 80 ° C arasında 10 dk Isıtma tarafından.

5. RT-lamba Analizi

Not: Ayrı, kapalı alanda RT-lamba çözümlemesi gerçekleştirin.

  1. Kuluçka sonra RT-lamba reaksiyonlar görsel olarak bir renk değişikliği varlığı için bakarak erişin.
    1. Floresan nükleik asit boya 1:10 TAE (40 mM Tris, 20 mM asetik asit, 1 mM EDTA) arabelleği sulandırmak.
      Dikkat: Herhangi bir nükleik asit leke nükleik asitler için bağlar ve bu nedenle bir kanserojen. İşlerken eldiven.
    2. İçin 12 µL RT-lamba tepki floresan nükleik asit boya seyreltme 2 µL ekleyin.
      Not: Olumsuz tepkiler turuncu renkte olacak ve olumlu tepkiler sarı/yeşil renkte olacak.
    3. İsteğe bağlı: bir kamera ile beyaz bir arka plan üzerinde RT-lamba reaksiyonlar fotoğraf çekmek.
  2. 302 nm UV altında örnekleri floresans tarafından RT-lamba ürünleri varlığını doğrulamak ışık yerleştirin. Bir kamera ile sonuç resmini çek.
    Not: Pozitif RT-lamba reaksiyonlar floresan bir çıkış olacak.
    Dikkat: UV koruyucu göz googles ya da yüz kalkan UV ışığı ile çalışırken giyiyorum.
  3. İsteğe bağlı: RT-lamba ürün örnekleri üzerinde jel elektroforez gerçekleştirerek onaylayın.
    1. 1 x TAE arabellek görüntüleme için bir nükleik asit leke ile % 2 özel jel dökmek.
      Dikkat: Herhangi bir nükleik asit leke nükleik asitler için bağlar ve bu nedenle bir kanserojen. İşlerken eldiven.
    2. Bir DNA merdivenin 5 µL moleküler ağırlık karşılaştırmak için ilk şeritte ekleyin.
    3. Her RT-lamba tepki için RT-lamba tepki karışımı 13 µL boya yükleme DNA 2 µL ile karıştırın. Boya yükleme DNA içeren 15 µL karışımı yerleştirin.
    4. Jel 90 V 90 dk ya kadar bantları ayrılır ve görüntü 302 nm UV ışık ile çalıştırın.
      Not: Pozitif RT-lamba reaksiyonlar laddering bir model olacaktır. Olumsuz RT-lamba tepkiler hiç grup içermemesi gerekir.

6. elden çıkarma

  1. RT-lamba reaksiyonlar çift mühürlü torbalar içinde atın. Bu yanlış pozitif tepkiler gelecekte önde gelen RT-lamba ürünleri yaymakolduğunu değil otoklav yap.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RT-lamba reaksiyonlar üç farklı yöntem kullanılarak çözümlenebilir. İlk olarak, bir floresan nükleik asit boya eklenmesiyle, olumlu tepkiler olumsuz tepkiler turuncu renkli çıplak gözle görüneceği yeri sarı/yeşil renkte olacaktır. İkinci olarak, floresan nükleik asit boya RT-lamba tepki için ek floresan sinyal oluşur örnekleri UV ışığıyla heyecanlı mısın. Olumsuz tepkiler algılanabilir bir floresan sinyal negatif kontrol küçük miktarlarda mevcut olabilir herhangi bir arka plan floresans üzerinde yoktur. Son olarak, RT-lamba tepkiler üzerinde bir özel jel çalıştırılabilir. Olumlu olumsuz tepkiler hiçbir DNA bantları var ise RT-lamba reaksiyonlar bantlama deseni olacak. Bu üçü de bu analiz yöntemleri kullanma örnekleri Şekil 2 ve 3' de gösterildiği. Bu örneklerin hiçbiri RNA RT-lamba önce izole vardı. PBS, bütün bir sivrisinek kırma RT-lamba tepki kullanımda yeterli olduğu Şekil 1 gösterir. Şekil 2' de, özgüllük ZIKV RT-lamba tepki gösterdi: sadece ZIKV moleküler kontrol değil DENV moleküler denetim veya negatif kontrol, olumlu bir RT-lamba tepki vardır. Ayrıca, ZIKV bilinen ZIKV enfeksiyonu olan bir hasta serum ve idrar ama ZIKV enfeksiyonu (Şekil 2A) olmadan asemptomatik denetim hastada değil algılanır. Şekil 2' deB, örnekleri için insan 18s test edilir rRNA RT-lamba kullanarak. Sadece hasta (idrar veya serum), fakat moleküler denetimleri veya negatif kontrol örneklerinden 18s için olumludur rRNA. Bu nedenle, 18s rRNA RT-avize örnekleri için RT-lamba tepkiler insan hastalar için bir kalite kontrol kullanılabilir. Sivrisinek örnekleri benzer şekilde ZIKV veya RT-lamba kalite kontrol, AEDAE (Şekil 3) için test edilebilir. Bu örnekte, ZIKV hem de ZIKV ile enfekte sivrisinek için olumlu moleküler kontrol ZIKV için olumlu. Negatif kontrol DENV moleküler kumandasında, sahte sivrisinek (hayır virüs içeren hücre kültür medya ile microinjected sivrisinek) enfekte ve enfekte DENV sivrisinek ZIKV (Şekil 3A) Hepsi negatif. Ancak, tüm sivrisinek AEDAE RT-lamba (Şekil 3B) tarafından için olumludur.

Mümkün olduğunda, olumlu ya da olumsuz bir tepki olarak bazen floresan Sinyal zayıf olabilir ve bazı kişilerin renk körü, görsel renk değişikliği yapmadan belirlemek zor olabilir onaylamak için tüm üç analitik yöntemleri kullanılmalıdır. Negatif kontrol pozitif olduğu durumlarda test örnekleri kümesinin tamamını kirlenme geçersiz ve bu nedenle yanlış pozitif kullanılabileceği belirlenmemiştir. RT-lamba tepki çalışmamış gibi olumlu denetim negatif nerede durumlarda örnekleri kümesinin tamamını geçerli değil. Bu dışarı nitel bir okuma, ancak, daha yüksek virüs kopyalarını floresan yoğunluğu veya desen bantlama DNA yoğunluğunu jel elektroforez tarafından takdir edilebilir RT-lamba ürünleri artışa neden olur.

Figure 1
Resim 1 : Sivrisinek ham lysate hazırlanması. (A)yer PBS 100 µL bir microcentrifuge tüp içine bir sivrisinek. (B) 10 kat ezmek sivrisinek tüp tarafına bir P10 damlalıklı ucu kullanarak. (C) bu aşağı kısaca enkaz cips için bir masa üstü santrifüje bükülmüş bir ham lysate üretir. Sadece süpernatant RT-lamba tepki için kullanılmalıdır. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : ZIKV ve 18S rRNA RT-LAMBADA hasta serum ve idrar numuneleri. Bir asemptomatik denetim hasta (C01) veya enfekte ZIKV (Z01) idrar ya da serum örnekleri 18S rRNA (B) belirli RT-lamba reaksiyonlar ya da bir ZIKV(a)tabi tutuldu. Floresan bir nükleik asit ilavesi göz (üst paneli), yeşil floresan (orta Masası) tarafından boya veya jel elektroforez (alt paneli) sonra RT-lamba reaksiyonlar görüntülenir. Lane M: DNA yığın işaretçisi; NTC: Hiçbir şablon kontrolü (negatif kontrol); ZIKV: ZIKV PCR standart pozitif kontrol; DENV: DENV olumlu denetim. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız. 

Figure 3
Şekil 3 : ZIKV ve AEDAE RT-LAMBADA Aegypti AE. . Tek Ae. aegypti sahte denetim, ZIKV veya DENV ile enfekte tabi ZIKV(a)veya AEDAE (B) belirli RT-lamba reaksiyonlar. Floresan bir nükleik asit ilavesi göz (üst paneli), yeşil floresan (orta Masası) tarafından boya veya jel elektroforez (alt paneli) sonra RT-lamba reaksiyonlar görüntülenir. Lane M: DNA yığın işaretçisi; NTC: Hiçbir şablon kontrolü (negatif kontrol); ZIKV: ZIKV PCR standart pozitif kontrol; DENV: DENV olumlu denetim. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız. 

Hedef Astar Sıra (5' - 3')
Homo sapien 18S rRNA 18SrRNA-FIP *
18SrRNA-sesli uyarı *
18SrRNA-F3
18SrRNA-B3
18SrRNA-Eğer
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-SESLİ UYARI *
ZIKV-F3
ZIKV-B3
ZIKV-EĞER
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
AE. aegypti aktin Ae21-FIP *
Ae21-sesli uyarı *
Ae21-Eğer
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* Astar hızlı yüksek performanslı sıvı kromatografi tarafından (HPLC) saf. Diğer astarlar için standart koşullar desalting yeterlidir.

Tablo 1: Primer RT-lamba reaksiyonlar için sequences. Astar dizileri aslında önceki yayın6içinde açıklanmıştır.

Birim (µL) Astar Hisse senedi toplama (µM) Son konsantrasyonu (µM)
80 İleriye doğru iç astar (FIP) 100 16
80 Geriye dönük iç astar (BIP) 100 16
10 İleriye doğru dış astar (F3) 100 2
10 Geriye dönük dış astar (B3) 100 2
20 Döngü ileri (LF) 100 4
20 Geriye doğru (LB) döngü 100 4
280 Moleküler sınıf su - -
500 Toplam

Tablo 2: 10 x RT-lamba astar Mix hazırlanması. Ae. aegypti aktin için ayarla RT-lamba astar bir BF astar içermiyor; Bu birim su ile değiştirin.

1 x birim (µL) Bileşen Son konsantrasyonlu 25 µL birim için
2.5 10 x Isothermic amplifikasyon arabellek 1 x
1.8 100 mM dU/A/T/C/GTPs 1.4 mM
2.0 100 mM MgSO4 6 mM + 2 mM tampon 8 mM [4-10 mM aralığı] =
2.5 10 x astar 1.6 ΜM FIP/BIP, 0.2 ΜM F3/B3, 0.4 ΜM FL/BL
1.0 strand deplasman (8.000 U/mL) ile termofilik DNA polimeraz 8 U
0,5 Ters transkriptaz (15.000 U/mL) 7.5 U
0,5 UDG (1000 U/mL) 0,5 U
12,3 Moleküler sınıf su -
23.0 Toplam

Tablo 3: RT-lamba Master Mix hazırlanması.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu kağıt işler insan ve sivrisinek örnekleri6kullanarak açıklanan ZIKV RT-lamba tahlil. Semptomatik enfekte ZIKV hastanın normal viral yük 10 olduğundan yeterli olacaktır yaklaşık 1 genom eşdeğer6, algılama sınırı olduğunu3 ' e 106 PFU/mL7. Ayrıca, bu yöntem ilk izole RNA ve hücre kültüründe virüsü amplifikasyon olmadan örneklerdeki ZIKV algılayabilir. Bu önemli ölçüde zaman, maliyet ve sağlık riskleri qRT-PCR için karşılaştırıldığında bu testin azalır.

Bu protokol için belirtilen birim oranında kullanılan idrar numuneleri RT-lamba reaksiyonlar bir RNA izolasyon gerçekleşmesi izin vermelidir. Bir teorik olarak örnek bir RT-lamba tepki olarak kullanılan miktarını artırmak iken, bu örnek idrar olduğunda bakım edilmelidir. İdrar PCR reaksiyonları inhibe birden fazla kimyasallar içerir; idrarda üre polimerazlar8 aşağılamak için bilinir ve çok yüksek bir idrar/RT-lamba reaksiyon oranı kullanmak RT-lamba tepki engel olur. Virüs düşük miktarda bekleniyor, idrar için belirli bir seti kullanarak bir RNA yalıtım gerçekleştirmek daha iyi olur. Benzer şekilde, serum serum bir daha yüksek birim8' de kullanıldığında bu RT-lamba inhibe PCR inhibitörleri içerebilir.

Bu protokol için RT-lamba tepkiler, akin to western Blot iletişim kurallarını yükleme denetimde kalite denetimleri dahil içerir. O zaman bir klinik örnek RT-lamba kalite kontrol için sıfırdan küçükse, örnek PCR inhibitörleri yüksek miktarda veya toplam RNA düşük miktarda içerebilir olarak olumsuz tepki ZIKV RT-lamba için yanlış negatif olabilir. RT-lamba tahlil önceki örnekten RNA yalıtmak gerekli değildir. Bu iletişim kuralı temsilcisi RT-lamba sonuçlarında RNA izolasyon elde edilmiştir. Ancak, RNA izolasyon örneklerinde düşük virüs yükü ile algılama artırabilir veya PCR inhibitörleri yüksek düzeyde içeren. Üreticinin önerilen protokol sonrası bir RNA izolasyon kit serum dahil olmak üzere birçok örnek türü için kullanabilirsiniz. İdrar numuneleri için bir RNA izolasyon kit idrar numuneleri için belirli kullanılmalıdır. Sivrisinek örnekleri için sivrisinek üzerinden maksimum hız veya douncing önce RNA izolasyon 2 min için shredding sütun PBS 100 µL içinde sivrisinek çalıştırarak lyse tavsiye edilir. RNA elüsyon arabellek 30 µL içinde eluted ve-80 ° C'de kadar kullanmak depolanır.

RNA izolasyon sonra endojen PCR inhibitörleri kaldırmak veya RNA RT-lamba önce konsantre için önerilmektedir. RT-lamba kalite kontrol hala negatifse qRT-PCR ZIKV algılama için kullanılmalıdır.

RT-lamba astar bu protokolündeki sıcaklıklar (57 – 65 ° C) ve kuluçka bir mesafeden çalışmaya doğruladı (8-60 dk), alışılmamış kullanarak yanı sıra kaynakları Isıtma (Örn., flameless rasyon ısıtıcı, su banyosu) standart dışında laboratuvar koşulları. Test tüm sıcaklıklar karşılaştırılabilir sonuçlar vermiştir. Algılamayı görsel renk değişikliği tek başına dayanarak, ZIKV RT-lamba ürünleri tespiti için en uygun zaman 30 dk oldu. Ancak, UV ışık uyarma veya jeller üzerinde desenler bantlama tarafından algılamayı kadar az 8 min Toplam kuluçka süresi ile olumlu idi. Bazı RT-lamba protokoller DMSO içerir, ancak bu protokol için RT-lamba tepki inhibisyonu neden olabilir. Oda sıcaklığında ayarlanabilir termofilik bir DNA polimeraz kullanarak vahşi tipi termofilik DNA polimeraz daha hızlı amplifikasyon sinyalleri dahil olmak üzere üzerinde avantajları olabilir ve daha istikrarlı oda sıcaklığında9,10 . Etidyum bromür bunun yerine % 2 özel jelleri nükleik asit görüntüleme için kullanılabilir, ancak, özel jeller için Diğer Floresan nükleik asit boyar maddeler onları daha güvenli bir şekilde yapmak daha düşük mutajenik potansiyeli vardır. Ancak, uygun güvenlik önlemlerini eldiven giymiş gibi hala kullanılmalıdır.

Bir bu protokol kısıtlamasıdır bir nitel ve nicel bir teknik olduğunu, ancak, göreli miktar6yapılabilir. Ayrıca, RT-lamba astar çok özel ve 16 suşları içinde bulunan ve en az 5 suşları6' çalışmak için onaylı ZIKV mekansal protein 5 son derece korunmuş bir dizi karşı tasarlanmıştır. Vahşi ZIKV için kapsamlı mutasyonlar gelecekte bu astar tarafından tespit olmayabileceğini mümkündür. Diğer gruplar da faiz11,12,13,14,15,16,17-ebilmek var olmak ZIKV tespiti için yeni teknolojiler geliştirdi .

Özet olarak, bu iletişim kuralı için özel ekipman gerektirmez örnek türleri çeşitli ZIKV hızlı, basit ve düşük maliyetli bir yöntem sağlar. Bu hangi RNA RT-lamba reaksiyon önce izole zorunda değildir ZIKV algılama için yeni bir tanı aracı sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL ve MBC Zika virüs tanı yöntemleri üzerinde fikri mülkiyet hakkına sahiptir. Kalan yazarların hiçbir rakip çıkarları vardır.

Acknowledgments

Bu eser Maureen ve Ronald Hirsch aile hayırsever katkısı ve alan Nöroloji Enstitüsü, St Mary's Michigan tarafından desteklenmiştir. Fon çalışma tasarım, veri toplama ve analizi, yayımlamaya karar veya el yazması hazırlanması herhangi bir rolü yoktu. Biz de Dr Bernadette Zwaans ve Elijah Ward el yazması onların eleştiri için teşekkür ederim.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
İzotermal amplifikasyon (RT-lamba) transkripsiyon-Loop-aracılı tahlil Zika virüs ve Housekeeping genler idrar, Serum ve sivrisinek örnekleri için ters
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter