Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Essais de Transcription-boucle-négociée l’Amplification isotherme (RT-lampe) pour Virus Zika et gènes domestiques dans l’Urine, sérum et des échantillons de moustiques réverse

doi: 10.3791/58436 Published: September 14, 2018

Summary

Ce protocole fournit une méthode efficace et peu coûteux pour détecter le virus Zika ou contrôler des cibles dans des échantillons d’urine et le sérum humains ou chez les moustiques par amplification isotherme boucle-négociée de transcription inverse (RT-lampe). Cette méthode ne nécessite pas d’ARN et peut se faire dans les 30 minutes.

Abstract

Infection par le virus Zika (ZIKV) peut être asymptomatique chez l’adulte, cependant, infection pendant la grossesse peut entraîner une fausse couche et de graves malformations neurologiques. Ce protocole vise à détecter rapidement les ZIKV dans des échantillons humains et de moustiques. L’étalon-or actuel pour la détection de ZIKV est la transcription inverse quantitative PCR (qRT-PCR) ; l’amplification isotherme boucle-négociée la transcription inverse (RT-lampe) peut permettre un test plus efficace et à moindre coût sans besoin de matériel coûteux. Dans cette étude, RT-lampe est utilisée pour la détection de ZIKV dans divers échantillons biologiques dans les 30 minutes, sans premier isoler l’ARN de l’échantillon. Cette technique est démontrée en utilisant ZIKV infectés par le sérum et l’urine de patients et infecté des échantillons de moustiques. L’acide ribonucléique ribosomique 18 s et l’actine sont utilisés comme témoins dans des échantillons humains et moustique, respectivement.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En 2015, Zika virus (ZIKV) attiré l’attention mondiale éminente comme une maladie infectieuse des préoccupations parce que l’infection pendant la grossesse était liée à la fausse couche, de mortinatalité, de graves neurologiques congénitales incluant une microcéphalie, ainsi qu’autres congénitale 1de malformations congénitales. Dans de rares cas, ZIKV a été associée avec le syndrome de Guillain-Barré. ZIKV est principalement transmis par les moustiques du genre Aedes ; Toutefois, il peut également se propager par contact sexuel1. Étant donné que l’infection avec ZIKV est asymptomatique chez la plupart des gens ou présente avec grippe-comme des symptômes bénins qui se chevauchent avec les symptômes de l’infection à d’autres arborviruses1, il y avait un besoin d’amélioration des méthodes de détection rapide et rentable de ZIKV pour dépister les personnes ainsi que les populations de moustiques locaux.

La transcription inverse quantitative PCR (qRT-PCR) est une méthode fiable pour la détection de ZIKV ; Cependant, cette technique nécessite de coûteux équipements spécialisés, un personnel formé et isolement d’ARN de l’échantillon d’intérêt. L’amplification isotherme boucle-négociée la transcription inverse (RT-lampe) est un procédé d’amplification d’acide nucléique one-step basé sur la technologie PCR qui exige seulement une température d’incubation en raison de l’utilisation d’une ADN polymérase thermophile avec fil Propriétés de déplacement. Cela contourne la nécessité d’un thermocycleur et diminue la longueur du temps nécessaire pour effectuer le test. Avantages supplémentaires de RT-lampe incluent sa grande spécificité et la sensibilité, la robustesse à un éventail de niveaux de pH et températures et résistance aux nombreux PCR inhibiteurs2. Il a un coût relativement faible et les réactifs sont stables à température ambiante. Compte tenu de ces caractéristiques, RT-lampe peut être déployé dans un laboratoire ou sur le terrain. À ce titre, les réactions de lampe ont été développées pour détecter un éventail d’agents pathogènes et d’autres types d’infection3,4,5. L’objectif du protocole RT-lampe décrit dans le présent document est de détecter les ZIKV sans isolement d’ARN dans les échantillons de sérum et l’urine humaines ainsi que dans un seul moustique infecté dans les 30 minutes par l’intermédiaire de RT-lampe. Cette méthode peut être utilisée pour remplacer qRT-PCR car c’est un outil de diagnostic sensible et rapid qui fonctionne rapidement et dans des cadres à l’extérieur du laboratoire.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Toutes les méthodes décrites ici ont été approuvés par l’Institutional Review Board (IRB) de la santé de Beaumont. Toutes les expériences ont été effectuées conformément aux règlements et aux lignes directrices pertinentes.

ATTENTION : Tous les matériels potentiellement infectieux doivent être manipulés selon les normes de niveau de biosécurité 2 y compris l’utilisation des équipements de protection individuelle. Des procédures qui peuvent produire des aérosols doivent être effectuées dans une armoire de sécurité biologique. En outre, les travaux avec les moustiques vivants doivent être effectués dans la communité arthropode niveau de confinement 1-3. Compte tenu de l’association de l’infection à ZIKV avec les anomalies congénitales, femmes enceintes, essaient de concevoir, ou les partenaires de ces femmes devraient considérablement minimiser leur exposition en laboratoire à ZIKV. Transport des échantillons ZIKV est classée catégorie B Substances biologiques conformément au ministère des transports matières dangereuses aux États-Unis (49 CFR, partie 171-180) et par conséquent d’expédition des échantillons devrait adhérer à ceux lignes directrices. Importation dans les échantillons biologiques aux États-Unis de ZIKV nécessite un centres pour Disease Control and Prevention (CDC) permis d’importation. Importation de n’importe quel arthropodes qui pourrait être utilisé comme un vecteur de transmission de ZIKV, même si elles ne sont pas infectés, exige un permis de l’United States Department of Agriculture (USDA). Cette information est à jour au moment de la publication. Recommandations à jour peuvent être trouvées à https://www.cdc.gov/zika/laboratories/lab-safety.html.

Remarque : Les réactions de RT-lampe sont sujettes à des taux plus élevés de fausses réactions positives, donc les précautions doivent être prises dans la planification expérimentale. Tous les set-up et l’exécution des réactions RT-lampe doivent utiliser des pipettes désignés et bouts filtrants. Idéalement, il faudrait un flux de travail latéral. Si possible, l’analyse et imagerie (Section 5) devraient avoir lieu dans une salle séparée et fermée pour éviter la contamination. Ouverture des tubes à essai contenant des produits RT-lampe doit être maintenue à un minimum.

1. préparation d’amorce RT-lampe

  1. Reconstituer chaque amorce RT-lampe lyophilisée dans l’eau de qualité moléculaire à une concentration finale de 100 µM (tableau 1). Vortex brièvement la solution d’apprêt pour assurer une solution homogène et tourner brièvement vers le bas de la solution à la vitesse maximale dans une centrifugeuse de dessus de table pour recueillir toutes les solution d’apprêt.
  2. Préparer un 10 x RT-lampe Primer Mix des amorces FIP, BIP, F3, B3, LF et LB en utilisant les volumes dans le tableau 2. Vortex brièvement la solution d’apprêt pour assurer une solution homogène et brièvement tourner vers le bas de la solution à la vitesse maximale dans une centrifugeuse de table afin d’éviter toute perte.
    Remarque : L’abécédaire de RT-lampe pour Ae. aegypti actine (AEDAE) ne contient-elle pas une amorce LB (amorces de boucle ne sont pas toujours nécessaires pour les réactions de RT-lampe). Dans ce cas, remplacer le volume d’amorce LB avec l’eau de qualité moléculaire.
  3. Stocker les amorces à-20 ° C entre les utilisations et éviter les cycles libres-décongélation.

2. préparation de l’échantillon

  1. Pour les échantillons d’urine humaine : Utiliser les urines fraîches, congelée urine ou urine en agent de conservation. Pour des échantillons frais ou congelés : immédiatement tourner vers le bas de l’échantillon après la collecte pendant 10 min à 700 get utiliser le surnageant pour analyse ou congeler à-80 ° C pour une utilisation future. Décongeler les échantillons congelés sur la glace avant utilisation.
  2. Pour les échantillons de sérum humain : Utilisez soit des échantillons de sérum frais ou congelés.
  3. Pour ZIKV infectés de lignées cellulaires: utiliser milieux conditionnés ou lysats cellulaires.
    NOTE : Acellulaire conditionné des médias de l’Ae. albopictus C6/36 cellules 8 jours après l’infection peut servir de témoins positifs pour les réactions de ZIKV RT-lampe.
  4. Pour les moustiques Ae. aegypti : utiliser deux carcasses de moustique entières fraîches ou congelées. Décongelez les moustiques congelés sur la glace. Préparer un lysat de moustique brut en plaçant un moustique individuel dans 100 µL d’une solution saline tamponnée au phosphate (PBS) et homogénéiser en écrasant le moustique 10 fois avec une pointe de pipette P10 (Figure 1). Brièvement, centrifuger le brut lysat pour granuler les débris. Utilisez le surnageant pour analyse de RT-lampe en aval.
    Remarque : Les témoins positifs peuvent être générés dans un laboratoire en infectant les moustiques femelles à l’aide de microinjection intrathoracique avec environ 103 génomes de virus dans un volume de 200 nL et récolte le moustique 5 jours après l’infection.

3. préparer le mélange réactionnel RT-lampe

  1. Préparer une réaction de mix master RT-feu sur la glace pour chaque amorce à utiliser à l’aide de guide du volume dans le tableau 3.
    Remarque : L’utilisation de thermolabile uracile DNA Glycosylase (UDG) aide à prévenir les faux positifs.
  2. Vortex brièvement pour s’assurer que tous les échantillons sont bien mélangés, puis tournez en bas brièvement pour prévenir la perte de volume.

4. RT-lampe test

  1. Pipette 23,0 µL du mélange maître RT-lampe par réaction dans un tube PCR de 200 µL. Ajouter 2.0 µL de l’échantillon (urine, sérum ou surnageant lysate brut moustique comme décrit à l’étape 2). Ceci amènera le volume total à 25,0 µL par réaction de RT-lampe. Pour le contrôle négatif, utiliser de l’eau moléculaire de catégorie. Inclure un contrôle positif.
    Remarque : Une PCR standard ou virus les stocks de surnageant de lignées cellulaires infectées peut être utilisé comme témoin positif.
    1. Facultatif : Inclure une réaction de contrôle de spécificité d’un arbovirus connexes tels que les virus de la dengue (DENV). Préparation des échantillons comme indiqué à l’étape 2, selon le type d’échantillon. Ajouter 2.0 µL du contrôle spécificité à 23,0 µL du mélange maître RT-lampe dans un tube PCR de 200 µL.
  2. Faire chauffer les échantillons à 61 ° C pendant 30 min à l’aide d’un bloc chauffant, bain-marie ou thermocycleur.
  3. Chaleur désactiver la polymérase par chauffage à 80 ° C pendant 10 min.

5. RT-lampe analyse

Remarque : Effectuer une analyse de RT-lampe dans un espace séparé et clos.

  1. Après l’incubation, accéder à des réactions de RT-lampe visuellement en recherchant la présence d’un changement de couleur.
    1. Diluer la fluorescence des acides nucléiques colorant 01:10 dans un tampon TAE (40 mM Tris, d’acide acétique 20 mM, EDTA 1 mM).
      ATTENTION : Toute tache acide nucléique se lie aux acides nucléiques et est par conséquent une substance cancérigène. Portez des gants lorsque vous manipulez.
    2. À 12 µL de la réaction de RT-lampe, ajouter 2 µL de dilution de colorant fluorescent des acides nucléiques.
      Remarque : Des réactions négatives seront orange en couleur et des réactions positives seront de couleur jaune/vert.
    3. En option : Prendre des photos des réactions RT-lampe sur un fond blanc à l’aide d’une caméra.
  2. Placer les échantillons sous 302 nm UV lumière pour confirmer la présence de produits RT-lampe par fluorescence. Prendre la photo du résultat à l’aide d’une caméra.
    Remarque : Les réactions positives RT-lampe aura une sortie fluorescente.
    ATTENTION : Porter des UV protection oculaire googles ou face bouclier lorsque vous travaillez avec la lumière UV.
  3. En option : Confirmer la présence de produits RT-lampe en effectuant l’électrophorèse sur gel sur les échantillons.
    1. Versez un gel d’agarose de 2 % dans un tampon x TAE 1 avec une tache acide nucléique pour la visualisation.
      ATTENTION : Toute tache acide nucléique se lie aux acides nucléiques et est par conséquent une substance cancérigène. Portez des gants lorsque vous manipulez.
    2. Ajouter 5 µL d’une échelle d’ADN dans la première voie pour comparer les poids moléculaires.
    3. Pour chaque réaction de RT-lampe, mélanger 13 µL du mélange réactionnel RT-lampe avec 2 µL d’ADN colorant de chargement. Charger le mélange 15 µL contenant l’ADN colorant de chargement.
    4. Exécutez le gel à 90 V pendant 90 min ou jusqu'à ce que les bandes sont séparées et l’image à 302 nm UV.
      Remarque : Les réactions positives RT-lampe aura un motif approfondi. Des réactions négatives de RT-lampe ne doivent contenir aucune bande.

6. Elimination des déchets

  1. Débarrassez-vous des réactions RT-lampe dans un sac scellé double. Ne pas stériliser car cela peut pulvériser les produits de RT-lampe, conduisant à des réactions faussement positives à l’avenir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Réactions de RT-lampe peuvent être analysées à l’aide de trois méthodes différentes. Tout d’abord, avec l’ajout d’un colorant fluorescent des acides nucléiques, des réactions positives sera jaune/vert en couleur où les réactions négatives apparaîtra orange en couleur à le œil nu. En second lieu, l’ajout du colorant fluorescent des acides nucléiques à réaction RT-lampe provoque un signal fluorescent lorsque les échantillons sont excités par la lumière UV. Réactions négatives n’aura pas un signal fluorescent détectable sur aucune fluorescence de fond qui peut-être être présent en petites quantités dans le contrôle négatif. Enfin, les réactions de RT-lampe peuvent être exécutées gel d’agarose. Des réactions positives de RT-lampe auront un marquage chromosomique, tandis que les réactions négatives n’auront aucuns bandes d’ADN. Exemples de cela en utilisant tous les trois de ces méthodes d’analyse sont illustrés dans la Figure 2 et 3. Aucun de ces échantillons a ARN isolé avant RT-lampe. La figure 1 illustre l’écrasement d’un moustique entier dans du PBS, qui est suffisant pour l’utilisation dans la réaction de RT-lampe. Dans la Figure 2, la spécificité de la réaction de ZIKV RT-lampe est démontrée : seul le contrôle moléculaire ZIKV, pas le contrôle moléculaire DENV ou contrôle négatif, a une réaction positive de la RT-lampe. Par ailleurs, ZIKV est détecté dans l’urine et le sérum d’un patient présentant une infection ZIKV connu, mais pas chez le patient de témoins asymptomatiques sans infection ZIKV (Figure 2A). Dans la Figure 2B, les échantillons sont testés pour humain 18 s ARNr utilisant RT-lampe. Seulement les échantillons de patients (urine ou sérum), mais pas les contrôles moléculaires ou le témoin négatif, sont positives pour 18 s rRNA. Par conséquent, 18 s ARNr RT-lampe peut être utilisé comme un contrôle de qualité pour les réactions de RT-lampe pour les échantillons de patients humains. Des échantillons de moustiques peuvent être testés de la même façon pour ZIKV ou le contrôle de la qualité RT-lampe, AEDAE (Figure 3). Dans cet exemple, le contrôle moléculaire positif pour ZIKV ainsi que le moustique infecté par ZIKV sont positifs pour le ZIKV. Le contrôle négatif, le contrôle moléculaire pour le ministère de l’environnement, le simulacre infecté moustique (mosquito micro avec les milieux de culture cellulaire ne contenant aucun virus), et le moustique DENV infecté sont tous négatifs pour ZIKV (Figure 3A). Cependant, tous les moustiques sont positifs pour l’AEDAE de RT-lampe (Figure 3B).

Lorsque cela est possible, tous les trois méthodes d’analyse devraient être utilisés pour confirmer une réaction positive ou négative parfois le signal fluorescent peut être faible et certaines personnes peuvent être daltonien, rendant le changement de couleur visuelle difficile à déterminer. Dans les cas où le témoin négatif est positif, l’ensemble des échantillons testés n’est pas valide tant que la contamination et donc de faux positifs ne peuvent être écartées. Dans les cas où le contrôle positif est négatif, l’ensemble des échantillons n’est pas valide car la réaction de RT-lampe ne peut pas avoir travaillé. Il s’agit d’une lecture qualitative, cependant, supérieurs copies du virus seront traduira par une augmentation des produits RT-lampe qui peut être apprécié par intensité de fluorescence, soit par l’intensité de l’ADN des bandes modèle par électrophorèse sur gel.

Figure 1
Figure 1 : Préparation du lysat de moustique brut. (A) Place un moustique dans 100 µL de PBS dans un tube de microcentrifuge. (B) à l’aide d’une pointe de pipette P10, écraser les moustiques contre les parois du tube 10 fois. (C) ce qui produit un lysat brut qui devrait filer vers le bas brièvement dans une centrifugeuse de dessus de table pour granuler les débris. Seulement le liquide surnageant doit être utilisé pour la réaction de RT-lampe. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : ZIKV et ARNr 18 s RT-lampe dans les échantillons d’urine et le sérum patients. Échantillons de sérum ou d’urine d’un patient témoins asymptomatiques (C01) ou le patient ZIKV infecté (Z01) ont été soumis à un ZIKV (A) ou des réactions de RT-lampe spécifiques de 18 s ARNr (B). Réactions de RT-lampe ont été visualisées après l’ajout d’un acide nucléique fluorescent teindre par fluorescence de le œil (du haut), vert (panneau central) ou un gel d’électrophorèse (panneau inférieur). Lane M: masse marqueur d’ADN ; NTC : Aucun contrôle de modèle (témoin négatif) ; ZIKV : Contrôle positif Standard de ZIKV PCR ; DENV : Contrôle positif DENV. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure. 

Figure 3
Figure 3 : ZIKV et AEDAE RT-lampe en Aegypti AE. . Seul Ae. aegypti infectés avec contrôle simulacre, ZIKV ou DENV ont été soumis à ZIKV (A) ou de réactions spécifiques de RT-lampe AEDAE (B). Réactions de RT-lampe ont été visualisées après l’ajout d’un acide nucléique fluorescent teindre par fluorescence de le œil (du haut), vert (panneau central) ou un gel d’électrophorèse (panneau inférieur). Lane M: masse marqueur d’ADN ; NTC : Aucun contrôle de modèle (témoin négatif) ; ZIKV : Contrôle positif Standard de ZIKV PCR ; DENV : Contrôle positif DENV. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure. 

Objectif Apprêt Séquence (5' - 3')
Homo sapien 18 s ARNr 18SrRNA-FIP *
18SrRNA-BIP *
18SrRNA-F3
18SrRNA-B3
18SrRNA-LF
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-BIP *
ZIKV-F3
ZIKV-B3
ZIKV-LF
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
AE. aegypti actine Ae21-FIP *
Ae21-BIP *
Ae21-LF
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* Des amorces doivent être épurées par rapide chromatographie liquide haute performance (CLHP). Pour tous les autres apprêts, conditions normales de dessalement suffisent.

Tableau 1 : Primer séquences pour des réactions de feu-RT. Séquences d’amorces sont initialement décrit dans la publication précédente6.

Volume (µL) Apprêt Concentration de stock (µM) Concentration finale (µM)
80 Apprêt intérieur avant (FIP) 100 16
80 Apprêt intérieur arrière (BIP) 100 16
10 Apprêt extérieur vers l’avant (F3) 100 2
10 Apprêt extérieur arrière (B3) 100 2
20 Boucle vers l’avant (LF) 100 4
20 Boucle vers l’arrière (LB) 100 4
280 eau de qualité moléculaire - -
500 Total

Tableau 2 : préparation de 10 x RT-lampe Primer Mix. L’amorce de RT-lampe pour Ae. aegypti actine ne contient-elle pas une amorce BF ; remplacer ce volume avec de l’eau.

1 x Volume (µL) Composant Finale conc. Pour 25 µL Volume
2.5 mémoire tampon Amplification isotherme 10 x 1 x
1.8 100 mM dU/A/T/C/GTP 1,4 mM
2.0 100 mM MgSO4 6 + 2 mM dans le tampon = 8 mM [intervalle de 4 à 10 mM]
2.5 10 x amorces FIP/BIP DE 1,6 ΜM, 0,2 ΜM F3/B3, 0,4 ΜM FL/BL
1.0 thermophile ADN polymérase avec déplacement de brin (8 000 U/mL) 8 U
0,5 La Transcriptase inverse (15 000 U/mL) 7.5 U
0,5 UDG (1 000 U/mL) 0,5 U
12.3 eau de qualité moléculaire -
23,0 Total

Tableau 3 : Préparation de RT-lampe Master Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le dosage de ZIKV RT-lampe décrit dans cette étude des œuvres à l’aide de fois l’homme et les moustiques échantillons6. La limite de détection était environ 1 génome équivalent6, qui devrait être suffisant puisque la charge virale typique d’un patient ZIKV infecté symptomatique est 103 à 106 UFP/mL7. En outre, cette méthode peut détecter des ZIKV dans les échantillons sans premier isolement RNA et sans amplification du virus en culture cellulaire. Cela diminue de manière significative le temps, coûts et risques pour la santé de ce test par rapport à qRT-PCR.

Des échantillons d’urine utilisés dans le rapport de volume indiqué dans le présent protocole devraient permettre des réactions de RT-lampe se produire sans un ARN. Alors qu’on pourrait théoriquement augmenter la quantité d’échantillon utilisée dans une réaction de RT-lampe, il fallait être prudent lorsque cet exemple est l’urine. L’urine contient plusieurs produits chimiques qui pourraient inhiber les réactions de PCR ; urée dans l’urine est connue pour dégrader les polymérases8 et utiliser un ratio d’urine/RT-lampe réaction trop élevé empêche la réaction de RT-lampe. Si une faible quantité de virus est prévue, il serait préférable d’effectuer un ARN à l’aide du kit spécifique pour l’urine. De même, le sérum peut contenir inhibiteurs de PCR qui inhibent RT-lampe sérum se heurte-t-elle à un volume plus élevé8.

Inclus dans le présent protocole est l’inclusion des contrôles de qualité pour des réactions de RT-lampe, semblable à un contrôle de chargement en western blot protocoles. Si un échantillon clinique est négatif pour le contrôle de qualité de RT-lampe, puis une réaction négative pour le ZIKV RT-lampe peut être un faux négatif, car l’échantillon peut contenir une quantité élevée d’inhibiteurs de PCR ou de faibles quantités d’ARN total. Il n’est pas nécessaire d’isoler l’ARN de l’échantillon avant l’analyse RT-lampe. Le représentant RT-lampe dans le présent protocole obtenus sans isolement d’ARN. Cependant, ARN peut améliorer la détection dans des échantillons avec la charge virale faible ou qui peut contenir des niveaux élevés d’inhibiteurs de PCR. À tous les types d’échantillon dont le sérum, un kit d’isolation d’ARN peut être utilisé en suivant le protocole suggéré par le fabricant. Pour les échantillons d’urine, un kit d’isolation d’ARN spécifique pour les échantillons d’urine doit être utilisé. Pour des échantillons de moustiques, il est recommandé à lyser les moustiques en exécutant le moustique dans 100 µL de PBS à travers une colonne déchiquetage pendant 2 min à vitesse maximale ou douncing avant d’ARN. L’ARN peut être élué dans 30 µL de tampon d’élution et conservé à-80 ° C jusqu'à l’utilisation.

Isolement d’ARN est ensuite proposé à enlever les inhibiteurs endogènes de la PCR et de concentrer l’ARN avant RT-lampe. Si le contrôle de qualité de RT-lampe est toujours négatif, qRT-PCR devrait être utilisé pour la détection de ZIKV.

Les amorces RT-lampe dans le présent protocole ont été confirmés pour travailler à une gamme de températures (57 à 65 ° C) et d’incubation fois (8-60 min), ainsi que l’utilisation non conventionnelle de chauffage sources (e.g., réchauffeur de ration sans flamme, bain-marie) hors norme conditions de laboratoire. Toutes les températures testées ont donné des résultats comparables. Basé sur la détection de changement de couleur visual seul, le moment optimal pour la détection des produits ZIKV RT-lampe a 30 min. Cependant, la détection par l’excitation lumineuse UV ou des patrons sur les gels de bandes étaient positifs avec aussi peu que 8 min de temps d’incubation totale. Certains protocoles de RT-lampe incluent DMSO, mais dans ce protocole, elle peut aboutir à l’inhibition de la réaction de RT-lampe. Utilisant une ADN polymérase thermophile qui peut être mises en place à la température ambiante peut présenter des avantages plus sauvage thermophile ADN polymérase, y compris les signaux d’amplification plus vite et avoir plus de stabilité à température ambiante9,10 . Le bromure d’éthidium peut être utilisé à la place pour la visualisation de l’acide nucléique dans les gels d’agarose à 2 %, cependant, les autres colorants fluorescents des acides nucléiques pour des gels d’agarose ont plus bas potentiel mutagène, ce qui les rend un choix plus sûr. Cependant, des précautions appropriées telles que le port des gants devraient encore être utilisées.

Une limitation de ce protocole est qu’il est qualitatif et pas une technique quantitative, cependant, la quantification relative peut se faire6. En outre, des amorces de RT-lampe sont hautement spécifiques et ont été conçus contre une séquence hautement conservée de la protéine non structuraux 5 de ZIKV qui est trouvé dans 16 souches et vérifié pour travailler dans au moins 5 souches6. Il est possible que des mutations vaste ZIKV à l’état sauvage ne peuvent pas être détectables par ces amorces dans le futur. Autres groupes ont également développé de nouvelles technologies pour la détection des ZIKV qui peut-être être d’intérêt11,12,13,14,15,16,17 .

En résumé, ce protocole fournit une méthode rapide, simple et rentable pour ZIKV dans une variété de types d’échantillons qui ne nécessite pas de matériel spécialisé. Cela fournit un nouvel outil de diagnostic pour la détection de ZIKV dans lequel les RNA n’a pas à être isolé avant la réaction de RT-lampe.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL et MBC ont la propriété intellectuelle sur les méthodes de diagnostic pour le virus Zika. Les autres auteurs n’ont aucun intérêt concurrentes.

Acknowledgments

Ce travail a été soutenu par la contribution philanthropique familiale Maureen et Ronald Hirsch et champ Institut des Neurosciences, Sainte Marie de Michigan. Les bailleurs de fonds n’avaient aucun rôle dans la conception de l’étude, la collecte de données et analyse, décision de publier ou préparation du manuscrit. Nous remercions également Mme Bernadette Zwaans et Elijah Ward pour leur examen critique du manuscrit.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
Essais de Transcription-boucle-négociée l’Amplification isotherme (RT-lampe) pour Virus Zika et gènes domestiques dans l’Urine, sérum et des échantillons de moustiques réverse
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter