Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Reverse Transkription-Loop-vermittelten Isothermen Verstärkung (RT-Lampe) Assay für Zika-Virus und Housekeeping-Gene in Urin, Serum und Moskito-Proben

doi: 10.3791/58436 Published: September 14, 2018

Summary

Dieses Protokoll bietet eine effiziente und kostengünstige Methode zum Zika Virus erkennen oder steuern Ziele im menschlichen Urin und Serum-Proben oder Mücken durch reverse Transkription Schleife-vermittelten Isothermen Amplifikation (RT-Lampe). Diese Methode erfordert keine RNA isoliert und kann innerhalb von 30 Minuten erfolgen.

Abstract

Infektion mit Zika-Virus (ZIKV) kann bei Erwachsenen asymptomatisch sein, jedoch Infektion während der Schwangerschaft kann zu fehl- und schwere neurologische Geburtsschäden führen. Das Ziel dieses Protokolls ist es, ZIKV in Menschen- und Moskito Proben schnell zu erkennen. Der derzeitige Goldstandard für ZIKV Erkennung ist quantitative reverse Transkription PCR (qRT-PCR); reversen Transkription Schleife-vermittelten Isothermen Verstärkung (RT-Lampe) kann für eine effiziente und kostengünstige Prüfung ohne die Notwendigkeit für teure Ausrüstung. In dieser Studie dient RT-Lampe ZIKV-Erkennung in verschiedenen biologischen Proben innerhalb von 30 min ohne erste Isolierung der RNS aus der Probe. Diese Technik wird gezeigt, mit ZIKV infizierten Patienten Urin und Serum und infizierten Mücke Proben. 18 s ribosomalen Ribonukleinsäure und Aktin werden als Steuerelemente in Menschen- und Moskito Proben verwendet.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Im Jahr 2015 sammelte Zika-Virus (ZIKV) Prominente weltweite Aufmerksamkeit als eine Infektionskrankheit von Sorge denn Infektion während der Schwangerschaft mit fehl-, Totgeburt, schwere neurologische Geburtsschäden einschließlich Mikrozephalie sowie andere angeborene verbunden war Geburtsschäden1. In seltenen Fällen wurde ZIKV mit Guillain-Barré-Syndrom. ZIKV ist in erster Linie von Aedes -Mücken übertragen; Es kann jedoch auch durch sexuellen Kontakt1verteilt werden. Angesichts der Tatsache, dass die Infektion mit ZIKV bei den meisten Menschen asymptomatisch ist oder präsentiert mit milden grippeähnlichen Symptomen, die sich überschneiden mit den Symptomen einer Infektion von anderen Arborviruses1, gab es eine Notwendigkeit für bessere Methoden zur schnellen und kostengünstigen Nachweis von ZIKV sowohl Menschen als auch lokale Moskito-Populationen auf den Bildschirm.

Quantitative reverse Transkription PCR (qRT-PCR) ist ein zuverlässiger Test zur ZIKV Erkennung; Diese Technik erfordert jedoch teure Spezialausrüstung, geschultes Personal und RNA-Isolierung aus der Stichprobe von Interesse. Reversen Transkription Schleife-vermittelten Isothermen Verstärkung (RT-Lampe) ist eine einstufige Nukleinsäure-Amplifikation Methode basiert auf PCR-Technologie, die nur eine Inkubationstemperatur durch den Einsatz einer thermophilen DNA-Polymerase mit Strang erfordert Verschiebung-Eigenschaften. Dies umgeht die Notwendigkeit für ein Thermocycler und verringert die Länge der Zeit benötigt, um den Test abzuschließen. Weitere Vorteile des RT-Lampe sind seine hohe Spezifität und Sensitivität, Robustheit bei einer Reihe von pH-Werten und Temperaturen und Resistenz gegen viele PCR-Inhibitoren2. Es hat einen relativ niedrigen Kosten und Reagenzien sind bei Raumtemperatur stabil. Angesichts dieser Merkmale, kann RT-Lampe in einem Labor oder im Feld eingesetzt werden. Als solche sind Lampe Reaktionen entwickelt worden, um eine Reihe von Krankheitserregern und anderen Arten von Infektion3,4,5zu erkennen. Das Ziel des RT-Lampe-Protokolls, die in diesem Dokument beschriebenen ist, ZIKV ohne RNA Isolierung im menschlichen Serum und Urin Proben sowie einen einzigen infizierten Mücke innerhalb von 30 min durch RT-Lampe zu erkennen. Diese Methode kann verwendet werden, um qRT-PCR zu ersetzen, wie es ist eine sensible, schnelle Diagnose-Tool, die schnell und in den Einstellungen außerhalb des Labors arbeitet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle hier beschriebene Methoden sind durch institutionelle Review Board (IRB) der Beaumont Gesundheit genehmigt worden. Alle Versuche wurden im Einklang mit geltenden Richtlinien und Vorschriften durchgeführt.

Achtung: Alle potentiell infektiöse Materialien sollten nach Biosafety Level 2 Standards einschließlich der Verwendung von persönlicher Schutzausrüstung gehandhabt werden. Alle Prozeduren erzeugen Aerosol sollte in ein Kabinett Biosafety durchgeführt werden. Darüber hinaus sollten arbeiten mit live Mücken in der entsprechenden Gliederfüßer Containment Level 1-3-Anlage durchgeführt werden. Da der Verband der ZIKV Infektion mit angeborenen Fehlbildungen, sollten Frauen, die schwanger sind, versuchen zu begreifen und die Partner dieser Frauen deutlich ihre Labor ZIKV minimieren. Transport von ZIKV Proben ist in den Vereinigten Staaten als Kategorie B biologische Substanzen entsprechend Abteilung der gefährlichen Materialien Transportvorschriften eingestuft (49 CFR Teil 171-180) und daher Versand Proben sollte auf diejenigen halten Richtlinien. Import in die Vereinigten Staaten von ZIKV bioproben erfordert ein Center für Disease Control and Prevention (CDC) Einfuhr zu ermöglichen. Import von jedem Arthropoden, die als ein Vektor für ZIKV Übertragung, auch wenn sie nicht infiziert sind, eine Genehmigung des United States Department of Agriculture (USDA erfordert) dienen könnte. Diese Informationen sind zum Zeitpunkt der Veröffentlichung aktuell. Aktuelle Empfehlungen finden Sie unter https://www.cdc.gov/zika/laboratories/lab-safety.html.

Hinweis: RT-Lampe Reaktionen sind anfällig für höhere Rate der falsch positiven Reaktionen, so dass bei der experimentellen Planung Vorsichtsmaßnahmen. Alle Set-up und Durchführung der RT-Lampe Reaktionen sollten benannten Pipetten und Filtertips verwenden. Im Idealfall sollte ein seitliche Arbeitsablauf festgelegt werden. Wenn möglich, sollte in einem separaten geschlossenen Raum um Kontaminationen zu vermeiden Analyse und imaging (Abschnitt 5) auftreten. Eröffnung der Reagenzgläser mit RT-Lampe Produkte sollten auf ein Minimum gehalten werden.

(1) RT-Lampe Primer Vorbereitung

  1. Bereiten Sie jedes lyophilisierter RT-Lampe Grundierung in molekularen Grade Wasser, eine Endkonzentration von 100 µM (Tabelle 1). Kurz Wirbel die Grundierung Lösung gewährleisten eine homogene Lösung und kurz spin-down die Lösung mit maximaler Geschwindigkeit in einer Table-Top-Zentrifuge, alle Primer Lösung zu sammeln.
  2. Bereiten Sie eine 10 x RT-Lampe Primer Mix der FIP, BIP, F3, B3, LF und LB Primer mit den Bänden in Tabelle 2. Kurz Wirbel die Grundierung-Lösung für eine homogene Lösung zu gewährleisten, und kurz spin-down die Lösung mit maximaler Geschwindigkeit in einer Table-Top-Zentrifuge, Verluste zu vermeiden.
    Hinweis: Die RT-Lampe Grundierung set für Ae. Aegypti Aktin (AEDAE) enthält keine LB Primer (Schleife Grundierungen sind nicht immer notwendig für RT-Lampe Reaktionen). In diesem Fall ersetzen Sie die LB Grundierung Datenträger mit molekularen Grade Wasser.
  3. Speichern Sie die Primer bei-20 ° C zwischen den verschiedenen Zwecken zu und vermeiden Sie frei-tau-wechseln.

2. die Probenvorbereitung

  1. Für menschlichen Urinproben: Verwenden Sie frische Urin, gefrorenen Urin oder Urin in Konservierungsmittel. Für frische oder tiefgefrorene Probe: sofort spin-down der Probe nach der Sammlung für 10 min bei 700 X g, und den überstand für die Analyse verwenden oder bei-80 ° C zur späteren Verwendung einfrieren. Gefrorene Proben auf Eis vor dem Gebrauch Auftauen.
  2. Für menschliches Serumproben: Verwenden Sie entweder frische oder tiefgefrorene Serumproben.
  3. Für ZIKV infiziert Zelllinien: konditionierten Medien oder Zelle Lysates verwenden.
    Hinweis: Bedingt zellfreien Medien von Ae. Albopictus C6/36 Zellen 8 Tage nach der Infektion können für ZIKV RT-Lampe Reaktionen als Positivkontrollen verwendet werden.
  4. Für Ae. Aegypti Moskitos: verwenden Sie entweder ganz frisch oder gefroren Moskito-Kadaver. Gefrorene Mücken auf Eis Auftauen. Bereiten Sie eine grobe Mücke lysate indem man eine einzelne Mücke in 100 µL der Phosphat-gepufferte Kochsalzlösung (PBS) und homogenisieren durch Zerkleinern der Mücke 10mal mit P10 pipettieren Spitze (Abbildung 1). Kurz Zentrifugieren Sie lysate zu jeglichen Schmutz Pellets Rohöl. Verwenden Sie den überstand für die nachgelagerten RT-Lampe Analyse.
    Hinweis: Positivkontrollen können im Labor durch weibliche Stechmücken mit intrathorakalen Mikroinjektion mit ca. 103 Genom Entsprechungen des Virus in einem Volumen von 200 Infektion erzeugt werden nL und Ernte die Mücke 5 Tage nach der Infektion.

3. bereiten Sie RT-Lampe Master Mix

  1. Bereiten Sie eine RT-LAMP-master-Mix-Reaktion auf Eis für jede Grundierung mit Volumen-Führer in Tabelle 3eingesetzt werden soll.
    Hinweis: Die Verwendung von thermolabilen Uracil DNA Glycosylase (UDG) hilft bei der Fehlalarme zu verhindern.
  2. Vortex kurz um sicherzustellen, dass alle Proben gut vermischt sind, dann spin-down kurz Volumenverlust zu verhindern.

(4) RT-Lampe-Assay

  1. Pipettieren 23,0 µL RT-Lampe master-Mix pro Reaktion in ein 200 µL PCR-Röhrchen. Fügen Sie 2.0 µL der Probe (Urin, Serum oder grobe Moskito lysate überstand wie in Schritt2 beschrieben hinzu). Dies bringt das Gesamtvolumen zu 25,0 µL pro RT-LAMP-Reaktion. Verwenden Sie für die negativ-Kontrolle Molekulare Grade Wasser. Gehören Sie einer positiven Kontrolle.
    Hinweis: Eine PCR Standard oder Virus-Aktien aus überstand der infizierten Zelle Linien können als Positivkontrolle verwendet werden.
    1. Optional: Sind ein Besonderheit Kontrollreaktion von einem verwandten Arboviren wie Dengue-Fieber-Virus (DENV). Bereiten Sie die Probe, wie in Schritt2 beschrieben, je nach Probentyp. 23.0 µL RT-Lampe master-Mix in ein 200 µL PCR Rohr 2.0 µL des Spezifität Steuerelements hinzufügen.
  2. Erwärmen Sie die Proben bei 61 ° C für 30 min mit einem Heizblock, Wasserbad oder Thermocycler.
  3. Hitze ausschalten die Polymerase durch Erhitzen auf 80 ° C für 10 Minuten.

(5) RT-Lampe Analyse

Hinweis: Führen Sie RT-Lampe Analyse in einem separaten, abgeschlossenen Raum.

  1. Zugreifen Sie nach der Inkubation RT-Lampe Reaktionen visuell durch das Vorhandensein einer Farbänderung suchen.
    1. Verdünnen Sie die fluoreszierende Nukleinsäure-Farbstoff 01:10 in TAE (40 mM Tris, Essigsäure 20 mM, 1 mM EDTA)-Puffer.
      Achtung: Nukleinsäure-Fleck bindet an Nukleinsäuren und ist daher ein Karzinogen. Tragen Sie Handschuhe beim Umgang mit.
    2. Fügen Sie 12 µL RT-LAMP-Reaktion hinzu 2 µL der fluoreszierenden Nukleinsäure-Farbstoff Verdünnung.
      Hinweis: Negative Reaktionen werden Orange Farbe und positive Reaktionen werden gelb/grün in der Farbe.
    3. Optional: Machen Sie Fotos von RT-Lampe Reaktionen auf weißem Hintergrund mit einer Kamera.
  2. Legen Sie die Proben unter 302 nm UV-Licht, das Vorhandensein von RT-Lampe Produkte durch Fluoreszenz zu bestätigen. Fotografieren Sie das Ergebnis mit Hilfe einer Kamera.
    Hinweis: Positive RT-Lampe Reaktionen werden einen fluoreszierenden Ausgang haben.
    Achtung: Tragen Sie UV schützende Auge Googles oder Gesicht Schild mit UV-Licht arbeiten.
  3. Optional: Bestätigen Sie das Vorhandensein von RT-Lampe Produkte durch Gelelektrophorese auf den Proben durchführen.
    1. Gießen Sie eine 2 % Agarose-Gel in 1 X TAE-Puffer mit einer Nukleinsäure-beize für die Visualisierung.
      Achtung: Nukleinsäure-Fleck bindet an Nukleinsäuren und ist daher ein Karzinogen. Tragen Sie Handschuhe beim Umgang mit.
    2. Fügen Sie 5 µL einer DNA-Leiter in der ersten Spur, die Molmassen zu vergleichen.
    3. Mischen Sie für jede Reaktion RT-Lampe 13 µL RT-Lampe Reaktionsmischung mit 2 µL DNA loading Dye. Laden Sie die 15 µL Gemisch mit der DNA Farbstoff beladen.
    4. Führen Sie das Gel bei 90 V für 90 Minuten oder bis die Bänder getrennt sind und Bild mit 302 nm UV-Licht.
      Hinweis: Positive RT-Lampe Reaktionen werden eine laddering Muster haben. Negative Reaktionen der RT-Lampe sollte keine Bands enthalten.

6. Entsorgung

  1. RT-Lampe Reaktionen in doppelt versiegelte Beutel entsorgen. Tun Sie nicht Autoklaven, wie dies die RT-Lampe Produkte, was zu falsch positiven Reaktionen in der Zukunft aerosolisieren kann.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RT-Lampe Reaktionen können mit drei verschiedenen Methoden analysiert werden. Zunächst mit dem Zusatz eines fluoreszierenden Nukleinsäure-Farbstoffs werden positive Reaktionen gelb/grün in der Farbe negative Reaktionen erscheinen wo Orange in der Farbe mit dem bloßen Auge. Zweitens führt die Zugabe von fluoreszierenden Nukleinsäure-Farbstoff, RT-LAMP-Reaktion ein Fluoreszenzsignal wenn die Proben mit UV-Licht angeregt werden. Negative Reaktionen haben keinen nachweisbaren Fluoreszenzsignal über jede Hintergrundfluoreszenz, die in geringen Mengen in die Negativkontrolle möglicherweise. Zu guter Letzt können RT-Lampe Reaktionen auf ein Agarosegel heraus ausgeführt werden. Positive Reaktionen der RT-Lampe werden ein bandenmuster haben, während negative Reaktionen keine DNA-Bänder haben werden. Beispiele für diese mit allen drei dieser Analyse-Methoden sind in Abbildung 2 und 3gezeigt. Keiner dieser Proben hatte RNA isoliert vor RT-Lampe. Abbildung 1 veranschaulicht die Zerkleinerung eines ganzen Moskitos mit PBS-Puffer, die ausreicht, für den Einsatz in der RT-LAMP-Reaktion. In Abbildung 2zeigt die Spezifität der Reaktion ZIKV RT-Lampe: nur die ZIKV molekularen Steuerung, nicht die DENV molekularen Steuerung oder negative Kontrolle, hat eine positive Reaktion der RT-Lampe. Darüber hinaus wird die ZIKV im Urin und Serum eines Patienten mit einer bekannten ZIKV Infektion, aber nicht in den asymptomatischen Kontrolle Patienten ohne ZIKV Infektion (Abb. 2A) erkannt. In Abbildung 2B, sind die Proben getestet für menschliche 18 s rRNA mit RT-Lampe. Nur die Proben von Patienten (Urin oder Serum), aber nicht die molekularen Steuerung oder der negativen Kontrolle sind positiv für 18 s rRNA. Daher 18 s rRNA RT-Lampe kann als eine Qualitätskontrolle für RT-Lampe Reaktionen für die Proben von menschlichen Patienten verwendet werden. Moskito-Proben können ebenso für ZIKV oder RT-Lampe Qualitätskontrolle, AEDAE (Abbildung 3) geprüft werden. In diesem Beispiel die molekularen Positivkontrolle für ZIKV sowie die Mücke mit ZIKV infiziert sind positiv für ZIKV. Die negativ-Kontrolle, die molekularen Steuerung für DENV, das Mock infizierten Mücke (Mücke mikroinjiziert mit Zellkulturmedien, kein Virus enthalten), und DENV infizierten Mücke sind alle negativ für ZIKV(Abbildung 3). Die Mücken sind jedoch positiv für AEDAE von RT-Lampe (Abbildung 3B).

Wenn möglich, sollte alle drei analytische Methoden verwendet werden, um eine positive oder negative Reaktion zu bestätigen, da manchmal das Fluoreszenzsignal schwach sein kann und einige Personen möglicherweise farbenblind, erschwert die visuelle Farbwechsel zu bestimmen. In Fällen, wo die Negativkontrolle positiv ist, die Gesamtheit der untersuchten Proben ist ungültig als Verunreinigung und daher nicht Fehlalarme auszuschließen. In Fällen wo die Positivkontrolle negativ ist, ist die Gesamtheit der Proben ungültig, da die RT-LAMP-Reaktion nicht gearbeitet haben. Dies ist eine qualitative auslesen, höhere Kopien des Virus führt jedoch zu einer Zunahme der RT-Lampe Produkte, die durch Fluoreszenz Intensität oder die Intensität der DNA Muster Streifenbildung durch Gelelektrophorese geschätzt werden kann.

Figure 1
Abbildung 1 : Vorbereitung von Mücken Rohöl lysate. (A) Ort eine Mücke in 100 µL PBS in einem Microcentrifuge Schlauch. (B) mit einer P10 pipettieren Spitze, crush die Mücke gegen die Seiten der Röhre 10 mal. (C) ergibt sich eine grobe lysate, die unten kurz in einer Table-Top-Zentrifuge zu Schutt Pellets gesponnen werden sollte. Nur der Überstand sollte für RT-LAMP-Reaktion verwendet werden. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 : ZIKV und 18 s rRNA RT-Lampe in Urin und Serum Patientenstichproben. Urin oder Serum Proben aus einer asymptomatischen Kontrolle Patient (C01) oder ZIKV infizierten Patienten (Z01) waren ein ZIKV (A) oder 18 s rRNA (B) RT-Lampe Reaktionen ausgesetzt. RT-Lampe Reaktionen wurden nach die Zugabe von einem fluoreszierenden Nukleinsäure Färben von Auge (obere Leiste), grüne Fluoreszenz (Mitte Platte) oder gel-Elektrophorese (Bodenplatte) visualisiert. Lane M: DNA Massensymbol; NTC: Keine Vorlage Kontrolle (Negativkontrolle); ZIKV: ZIKV PCR Standard Positivkontrolle; DENV: DENV Positivkontrolle. Bitte klicken Sie hier für eine größere Version dieser Figur. 

Figure 3
Abbildung 3 : ZIKV und AEDAE RT-Lampe in Aegypti AE. . ZIKV (A) oder AEDAE (B) RT-Lampe Reaktionen wurden einzelne Ae. Aegypti infiziert mit mock-Steuerelement, ZIKV oder DENV unterworfen. RT-Lampe Reaktionen wurden nach die Zugabe von einem fluoreszierenden Nukleinsäure Färben von Auge (obere Leiste), grüne Fluoreszenz (Mitte Platte) oder gel-Elektrophorese (Bodenplatte) visualisiert. Lane M: DNA Massensymbol; NTC: Keine Vorlage Kontrolle (Negativkontrolle); ZIKV: ZIKV PCR Standard Positivkontrolle; DENV: DENV Positivkontrolle. Bitte klicken Sie hier für eine größere Version dieser Figur. 

Ziel Grundierung Sequenz (5' - 3')
Homo sapiens 18 s rRNA 18SrRNA-FIP *
18SrRNA-BIP *
18SrRNA-F3
18SrRNA-B3
18SrRNA-LF
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-BIP *
ZIKV-F3
ZIKV-B3
ZIKV-LF
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
AE. Aegypti Aktin Ae21-FIP *
Ae21-BIP *
Ae21-LF
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* Primer sollte durch schnelle Hochleistungs-Flüssigkeitschromatographie (HPLC) gereinigt werden. Für alle anderen Primer reichen Entsalzung Standardbedingungen.

Tabelle 1: Primer-Sequenzen für RT-Lampe Reaktionen. Primer-Sequenzen sind ursprünglich in früheren Veröffentlichung6beschrieben.

Volumen (µL) Grundierung Lager-Konzentration (µM) Endkonzentration (µM)
80 Vorderen inneren Primers (FIP) 100 16
80 Rückwärts inneren Primers (BIP) 100 16
10 Vorderen äußeren Primers (F3) 100 2
10 Rückwärts äußeren Primers (B3) 100 2
20 Schleife nach vorne (LF) 100 4
20 Schleife rückwärts (LB) 100 4
280 molekularen Klasse Wasser - -
500 Insgesamt

Tabelle 2: Vorbereitung der 10 x RT-Lampe Primer Mix. Die RT-Lampe Grundierung set für Ae. Aegypti Aktin enthält keine BF Grundierung; Ersetzen Sie dieses Volumen mit Wasser.

1 X Volumen (µL) Komponente Endgültige Konz. Für 25 µL Volumen
2.5 10 x Isothermen Verstärkung Puffer 1 x
1.8 100 mM dU/A/T/C/GTPs 1,4 mM
2.0 100 mM MgSO4 6 mM + 2 mM Puffer = 8 mM [4-10 mM-Bereich]
2.5 10 X Primer 1.6 ΜM FIP/BIP, 0,2 ΜM F3/B3, 0,4 ΜM FL/BL
1.0 Thermophile DNA-Polymerase mit Strang Hubraum (8.000 U/mL) 8 U
0,5 Reverse Transkriptase (15.000 U/mL) 7.5 U
0,5 UDG (1.000 U/mL) 0,5 U
12.3 molekularen Klasse Wasser -
23,0 Insgesamt

Tabelle 3: Vorbereitung der RT-Lampe Master Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die ZIKV RT-Lampe-Assay in diesem Papierarbeiten mit Menschen- und Moskito Proben6beschrieben. Der Nachweisgrenze wurde ca. 1 Genom entspricht6, was ausreichen sollte, da die typische Viruslast eines symptomatischen ZIKV infizierten Patienten 103 bis 106 PFU/mL7. Darüber hinaus kann diese Methode ZIKV in Proben ohne erste isolierende RNA und ohne Verstärkung der Virus in der Zellkultur erkennen. Dies verringert deutlich die Zeit, die Kosten und die gesundheitlichen Risiken des Assays im Vergleich zur qRT-PCR.

Urinproben auf das Volumenverhältnis angegeben in diesem Protokoll verwendet sollte RT-Lampe Reaktionen auftreten, ohne eine RNA-Isolation ermöglichen. Während man die Menge der Probe in eine RT-LAMP-Reaktion verwendet theoretisch erhöhen könnte, sollte Sorgfalt ausgeübt werden, wenn dieses Beispiel Urin ist. Urin enthält mehrere Chemikalien, die PCR-Reaktionen hemmen könnte; Harnstoff im Urin ist bekanntermaßen Polymerasen8 erniedrigen und mit Urin/RT-LAMP-Reaktion das Verhältnis, die zu hoch ist wird die RT-LAMP-Reaktion verhindern. Wenn eine geringe Menge des Virus zu rechnen ist, wäre es besser, eine RNA-Isolierung mit einem Kit-spezifisch für Urin durchzuführen. In ähnlicher Weise kann Serum PCR-Hemmer enthalten, die RT-Lampe hemmen kann, wenn Serum in einem höheren Volumen8verwendet wird.

Dieses Protokoll beinhaltet die Einbeziehung von Qualitätskontrollen für RT-Lampe Reaktionen, ähnlich wie ein Steuerelement laden im westlichen befleckenden Protokolle. Wenn eine klinischen Probe negativ für die Qualitätskontrolle von RT-Lampe ist, kann eine negative Reaktion für die ZIKV RT-Lampe ein falsch-negativ sein, da die Probe ein hohes Maß an PCR-Inhibitoren oder geringe Mengen von Gesamt-RNS enthalten kann. Es ist nicht notwendig, RNA von der Probe vor der RT-Lampe-Assay zu isolieren. Die repräsentativen Ergebnisse der RT-Lampe in diesem Protokoll wurden ohne RNA Isolierung erhalten. Jedoch RNA Isolierung kann die Erkennung in Proben mit niedriger Viruslast verbessern oder hohe Konzentrationen von PCR-Inhibitoren enthalten kann. Für die meisten Probentypen einschließlich Serum kann eine RNA-Isolierung-Kit nach Empfohlene Protokoll des Herstellers verwendet werden. Für Urinproben sollte eine RNA-Isolierung-Kit speziell für Urinproben verwendet werden. Für Moskito Proben empfiehlt es sich, die Mücke lyse durch die Mücke in 100 µL PBS durch Schreddern Säule für 2 min bei maximaler Geschwindigkeit oder Douncing vor RNA Isolierung ausgeführt. RNA werden in 30 µL Elution Puffer eluiert und bis zur Verwendung bei-80 ° C gelagert.

RNA-Isolierung ist dann vorgeschlagen, die endogenen PCR-Inhibitoren zu entfernen oder die RNA vor RT-Lampe zu konzentrieren. Wenn die RT-Lampe Qualitätskontrolle noch negativ ist, sollte qRT-PCR zur Detektion von ZIKV verwendet werden.

Die RT-Lampe-Primer in diesem Protokoll bestätigt arbeiten an einer Strecke der Temperaturen (57 – 65 ° C) und Inkubation Zeiten (8-60 min), als auch mit unkonventionellen Wärmequellen (z. B.., flammenlose Ration Heizung, Wasserbad) außen Standard Laborbedingungen. Alle Temperaturen getestet hat vergleichbare Ergebnisse. Der optimale Zeitpunkt für den Nachweis von ZIKV RT-Lampe Produkte war basierend auf dem Nachweis von visuelle Farbwechsel allein, 30 min. Die Erkennung von UV Licht Erregung oder Streifen Muster auf Gele waren jedoch positiv mit weniger als 8 min insgesamt Inkubationszeit. Einige Protokolle RT-Lampe DMSO, unter anderem in diesem Protokoll kann es in der Hemmung des RT-LAMP-Reaktion führen. Mit eine thermophile DNA-Polymerase, die bei Raumtemperatur einrichten können möglicherweise Vorteile gegenüber Wildtyp thermophile DNA-Polymerase einschließlich schneller Verstärkung Signale und haben erhöhte Stabilität bei Raumtemperatur9,10 . Interkalation Bromid kann stattdessen für Nukleinsäure-Visualisierung in 2 % Agarose-Gele verwendet werden, jedoch andere fluoreszierende Nukleinsäure-Farbstoffe für Agarose-Gele haben niedrigeres mutagenes Potenzial, so dass sie eine sicherere Wahl. Allerdings sollte noch entsprechende Sicherheitsmaßnahmen wie das Tragen von Handschuhen verwendet werden.

Eine Einschränkung dieses Protokolls ist, dass es eine qualitative und keine quantitative Verfahren, jedoch relative Quantifizierung6möglich ist. Darüber hinaus RT-Lampe Primer sind hochspezifisch und wurden gegen eine hoch konservierten Sequenz des Elementoptionen Proteins 5 des ZIKV, das in 16 Stämme gefunden und verifiziert in mindestens 5 Stämme6Arbeiten entwickelt. Es ist möglich, dass umfangreiche Mutationen, ZIKV in freier Wildbahn möglicherweise nicht nachweisbar durch diese Primer in der Zukunft. Andere Gruppen haben auch neue Technologien zur Detektion von ZIKV entwickelt, die möglicherweise von Interesse11,12,13,14,15,16,17 .

Dieses Protokoll bietet eine schnelle, einfache und kostengünstige Methode für ZIKV in einer Vielzahl von Probenarten, die keine speziellen Ausrüstung erforderlich ist. Dies bietet ein neue Diagnose-Tool für die ZIKV-Erkennung in der RNA nicht vor die RT-LAMP-Reaktion isoliert werden muss.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL und MBC haben geistiges Eigentum auf Zika Virus Diagnosemethoden. Die übrigen Autoren haben keinen Interessenkonflikt.

Acknowledgments

Diese Arbeit wurde von Maureen und Ronald Hirsch Familie philanthropischen Beitrag und Neurowissenschaften Feldinstitut, St. Maria von Michigan unterstützt. Die Geldgeber hatten keine Rolle beim Studiendesign, Datenerhebung und Analyse, Entscheidung, zu veröffentlichen oder der Manuskripterstellung. Wir danken auch Dr. Bernadette Zwaans und Elijah Ward für ihre kritische Durchsicht des Manuskripts.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
Reverse Transkription-Loop-vermittelten Isothermen Verstärkung (RT-Lampe) Assay für Zika-Virus und Housekeeping-Gene in Urin, Serum und Moskito-Proben
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter