Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

반대로 Zika 바이러스 및 내부 관리 유전자 소변, 혈 청, 그리고 모기 샘플에 대 한 분석 결과 전사 루프 중재 하는 등온 증폭 (RT-램프)

doi: 10.3791/58436 Published: September 14, 2018

Summary

이 프로토콜 Zika 바이러스 탐지 또는 반전 녹음 방송 루프 중재 등온 증폭 (RT-램프)에 의해 대상 인간의 소변 및 혈 청 샘플 또는 모기를 제어 하는 효율적이 고 저렴 한 비용 메서드를 제공 합니다. 이 메서드는 RNA 격리는 필요 하지 않습니다 하 고 30 분 이내 할 수 있습니다.

Abstract

그러나 Zika 바이러스 (ZIKV) 감염 성인 무 증상 일 수 있다,, 임신 중 감염 유산 및 심각한 신경 기형이 발생할 수 있습니다. 이 프로토콜의 목표 신속 하 게 모두 인간과 모기 샘플에서 ZIKV를 검색 하는 것입니다. ZIKV 검출에 대 한 현재 금 표준 이다 양이 많은 반전 녹음 방송 PCR (qRT-PCR); 반전 녹음 방송 루프 중재 등온 증폭 (RT-램프)은 보다 효율적이 고 저렴 한 비용 테스트 고가의 장비에 대 한 필요 없이 수 있습니다. 본이 연구에서는 실시간 램프 첫 샘플에서 RNA를 분리 하지 않고 ZIKV 검출 다양 한 생물 학적 샘플 30 분 이내에 사용 됩니다. 이 기술은 ZIKV를 사용 하 여 환자 소변 및 혈 청, 감염 및 감염 모기 샘플 시연입니다. 18S ribosomal ribonucleic 산과 말라 각각 인간과 모기 샘플에서 컨트롤로 사용 됩니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

2015 년, Zika 바이러스 (ZIKV) 주목 저명한 글로벌 관심사의 전염 성 질환으로 임신 중에 감염 유산, 사 산, microcephaly, 뿐만 아니라 다른 선 천 성 신경 심각한 출생 결함에 연결 했다 때문에 출생 결함1. 드문 경우에, ZIKV Guillain-바레 증후군과 연결 되었습니다. ZIKV는 주로 Aedes 모기;로 전송 그러나, 그것은 또한 성적 접촉1통해 확산 하실 수 있습니다. ZIKV 감염 대부분의 사람에서 무 증상 또는 다른 arborviruses1의 감염의 증상과 겹치는 가벼운 감기 같은 증상으로 선물 한다, 그의 신속 하 고 비용 효율적인 검색을 위한 향상 된 방법 필요가 했다 사람 뿐만 아니라 현지 모기 인구를 화면에 ZIKV.

양이 많은 반전 녹음 방송 PCR (qRT-PCR)은 ZIKV 감지;에 대 한 신뢰성 분석 결과 그러나,이 기술은 고가의 특수 장비, 숙련 된 직원, 그리고 관심의 샘플에서 RNA 격리 해야합니다. 반전 녹음 방송 루프 중재 등온 증폭 (RT-램프)는만 가닥으로 thermophilic DNA 중 합 효소의 사용으로 인 한 부 화 온도 필요로 하는 PCR 기술에 따라 1 단계 핵 산 증폭 방법 변위 속성입니다. 이 thermocycler 니드 circumvents 고 분석 결과 완료 하는 데 필요한 시간을 줄입니다. RT-램프의 추가 장점 높은 특이성, 감도, 견고성 pH 수준 및 온도, 저항 많은 PCR 억제제2의 범위에 포함 됩니다. 그것은 상대적으로 저렴 한 비용 및 시 약은 실 온에서 안정. 이러한 특성을 감안할 때, RT-램프 배포할 수 있습니다 실험실에서 또는 분야에서. 등, 램프 반응 병원 체와 감염3,,45의 다른 종류의 범위를 검출 하기 위하여 개발 되었습니다. 이 문서에 설명 된 RT 램프 프로토콜의 목표는 인간의 혈 청 및 소변 샘플에도 RT 램프를 통해 30 분 이내 단일 감염 된 모기에서 RNA 격리 없이 ZIKV를 감지. 그것은 실험실 밖으로 신속 하 고 설정에서 작동 민감한, 신속한 진단 도구 qRT-PCR을 대체 하이 메서드를 사용할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

여기에 설명 된 모든 메서드는 버몬트 건강의 기관 검토 위원회 (IRB)에 의해 승인 되었습니다. 모든 실험 관련 지침 및 규정에 따라 수행 했다.

주의: 잠재적으로 전염 하는 모든 자료는 개인 보호 장비의 사용을 포함 하는 Biosafety 수준 2 기준에 따라 처리 되어야 합니다. 에 어로 졸을 생산 있습니다 어떤 절차 biosafety 내각에서 수행 되어야 합니다. 또한, 라이브 모기 사용 적절 한 절지동물 포함 수준 1-3 시설에서 수행 되어야 합니다. 선 천 성 이상에 ZIKV 감염의 협회를 감안할 때, 여성은 임신, 임신 하려고 또는이 여자의 파트너 크게 최소화 해야 ZIKV에 그들의 실험실 노출 합니다. ZIKV 샘플의 카테고리 B 생물학 물질에 따라 학과의 교통 위험 물질 규정으로 미국에서 분류 된다 (49 CFR 부 171-180)을 준수 해야 합니다 따라서 샘플 배송 지침입니다. 미국의 ZIKV biospecimens로 가져오기는 센터를 질병 통제 및 예방 (CDC) 가져오기 허용 필요 하다. ZIKV 전송 위한 벡터 그들이 감염 되는 경우에 필요는 미국 농 무부 (USDA)으로 역할을 수 있는 모든 절지동물의 수입을 허용 합니다. 이 정보는 현재 간행물의 때에. 최신 추천 https://www.cdc.gov/zika/laboratories/lab-safety.html에서 찾을 수 있습니다.

참고: RT 램프 반응 주의 실험을 계획 한다 그래서 거짓 긍정적인 반응의 경향이 있다. 모든 설정 및 실시간 램프 반응의 실행 사용 해야 지정 된 펫 필터 팁 합니다. 이상적으로, 측면 작업 흐름을 설립 합니다. 만약에 가능 하다 면, 분석 및 영상 (5) 오염을 방지 하기 위해 별도 밀폐 된 공간에서 수행 되어야 합니다. 테스트 튜브 RT 램프 제품을 포함 하 여 최소한으로 유지 되어야 한다.

1. 실시간-램프 뇌관 준비

  1. 100 µ M (표 1)의 최종 농도에 분자 학년 물에 각 동결 건조 된 RT 램프 뇌관 reconstitute 짧게 소용돌이 동종 솔루션을 보장 하 고 짧게 스핀 모든 뇌관 솔루션을 수집 하는 탁상용 원심 분리기에서 최대 속도로 솔루션 다운 뇌관 솔루션.
  2. 10 준비 RT 램프 뇌관 믹스 볼륨을 사용 하 여 표 2에 FIP, BIP, F3, b 3, LF, 및 파운드 뇌관의 x. 짧게 소용돌이 동종 솔루션을 보장 하 고 짧게 스핀 손실을 방지 하기 위해 테이블 상단 원심 분리기에서 최대 속도로 솔루션 다운 뇌관 솔루션.
    참고: Ae aegypti 걸 (AEDAE)에 대 한 설정 RT 램프 뇌관 파운드 뇌관을 포함 하지 않는 (루프 뇌관 필요 하지 않습니다 항상 실시간 램프 반응). 이 경우에, 분자 학년 물 파운드 뇌관 볼륨을 교체 합니다.
  3. -20 ° C 사용 하는 사이 뇌관을 저장 하 고 무료-해 동 주기를 피하십시오.

2. 샘플 준비

  1. 인간 소변 샘플: 방부 제에 신선한 소변, 냉동된 소변, 또는 소변을 사용 합니다. 신선 또는 냉동 샘플: 즉시 샘플 다운 700 x g, 10 분에 대 한 수집 후 고는 상쾌한 분석에 대 한 사용 하 여 또는 나중에 사용-80 ° C에서 동결. 사용 하기 전에 얼음에 냉동된 샘플 녹여
  2. 인간 혈 청 샘플: 신선 또는 냉동 혈 청 샘플 중 하나를 사용 합니다.
  3. ZIKV에 대 한 감염 세포: 조절된 미디어 또는 세포 lysates 사용.
    참고: 미디어 Ae에서 조절 세포-무료. albopictus C6/36 셀 8 일 감염 된 후 ZIKV RT-램프 반응에 대 한 긍정적인 컨트롤로 사용할 수 있습니다.
  4. Ae aegypti 모기: 전체 신선 또는 냉동 모기 시체 중 하나를 사용 하 여. 얼음에 냉동된 모기 녹여 인산 염 버퍼 식 염 수 (PBS)의 100 µ L에 개별 모기를 배치 하 여 원유 모기 lysate를 준비 하 고 10 번 P10 피펫으로 팁 (그림 1)과 모기를 분쇄 하 여 균질. 짧게 어떤 파편 든 지 작은 lysate 원유 원심. 상쾌한을 사용 하 여 다운스트림 RT 램프 분석에 대 한.
    참고: 긍정적인 컨트롤 생성 될 수 있습니다 실험실 설정에서 여성 모기 intrathoracic microinjection를 사용 하 여 약 103 게놈 해당 200의 볼륨에 바이러스의 감염에 의해 nL와 수확 모기 5 일 후 감염입니다.

3. 준비 RT 램프 마스터 믹스

  1. 표 3에 볼륨 가이드를 사용 하 여 사용 하도록 설정 하는 각 뇌관을 위한 얼음에 RT 램프 마스터 혼합 반응 준비.
    참고: 사용 thermolabile Uracil DNA Glycosylase (UDG)의 가양성 방지에 도움이 됩니다.
  2. 소용돌이 모든 샘플 잘 혼합, 되도록 짧게 다음 스핀 아래로 짧게 볼륨 손실을 방지 하기 위해.

4. RT-램프 분석 결과

  1. 피펫으로 23.0 µ L 당 200 µ L PCR 튜브에 반응 RT 램프 마스터 믹스의. 샘플 (소변, 혈 청, 또는 2 단계에서에서 설명한 대로 원유 모기 lysate 상쾌한)의 2.0 µ L를 추가 합니다. 이 RT 램프 반응 당 25.0 µ L을 총 볼륨을 가져올 것 이다. 부정적인 컨트롤에 대 한 분자 수준의 물을 사용 합니다. 긍정적인 통제를 포함 합니다.
    참고: PCR 표준 또는 바이러스 감염 된 세포의 상쾌한에서 주식 긍정적인 컨트롤로 사용할 수 있습니다.
    1. 선택 사항: 뎅기열 바이러스 (DENV) 관련된 arbovirus의 특이성 제어 반응 포함. 샘플 유형 2 단계에에서 설명 된 대로 샘플을 준비 합니다. 200 µ L PCR 튜브에 RT 램프 마스터 믹스의 23.0 µ L를 특이성 컨트롤의 2.0 µ L를 추가 합니다.
  2. 열 블록, 물 목욕, 또는 thermocycler를 사용 하 여 30 분 동안 61 ° C에서 샘플을 열.
  3. 십 분 동안 80 ° C에 난방으로는 중 합 효소 비활성화.

5. 실시간 램프 분석

참고: 별도, 밀폐 된 공간에서 실시간 램프 분석을 수행 합니다.

  1. 부 화 후 색상 변경의 존재에 대 한 보고 RT 램프 반응을 시각적으로 액세스.
    1. 태 (40 m m 20 m m 초 산, 트리 스 1 mM EDTA) 버퍼에 형광 핵 산 염색 1시 10분 희석.
      주의: 모든 핵 산 얼룩 핵 산 한다 따라서 발암 물질 이다. 처리 하는 경우 장갑을 착용 한다.
    2. RT-램프 반응의 12 µ L, 2 µ L 형광 핵 산 염료 희석의 추가.
      주: 부정적인 반응을 오렌지 컬러로 되며 긍정적인 반응을 노란색/녹색 색깔에 있을 것입니다.
    3. 선택 사항: 카메라를 사용 하 여 흰색 배경에 RT 램프 반응의 사진을 찍을.
  2. 302 nm 자외선 아래 샘플 빛 형광에 의해 RT 램프 제품의 존재를 확인을 배치 합니다. 카메라를 사용 하 여 결과의 그림을 가져가 라.
    참고: 긍정적인 RT-램프 반응 형광 출력을 해야한다.
    주의: UV 빛을 작업할 때 UV 보호 눈 구글 또는 얼굴 방패를 착용.
  3. 선택 사항: 샘플에 젤 전기 이동 법을 수행 하 여 RT-램프 제품의 존재를 확인 합니다.
    1. 시각화를 위한 핵 산 얼룩으로 1 x TAE 버퍼에는 2 %agarose 젤을 붓는 다.
      주의: 모든 핵 산 얼룩 핵 산 한다 따라서 발암 물질 이다. 처리 하는 경우 장갑을 착용 한다.
    2. 분자 무게를 비교 하 여 첫 번째 차선에 DNA 사다리의 5 µ L를 추가 합니다.
    3. 각 램프 RT 반응에 대 한 염료를 로드 하는 DNA의 2 µ L 13 µ L RT 램프 반응 혼합물의 혼합. 염료를 로드 하는 DNA를 포함 하는 15 µ L 혼합물을 로드 합니다.
    4. 302 nm 자외선과 90 V 90 분 또는 때까지 밴드 분리 젤과 이미지를 실행 합니다.
      참고: 긍정적인 RT-램프 반응 laddering 패턴을 있을 것 이다. 네거티브 RT 램프 반응에는 어떤 밴드 없어야 합니다.

6입니다. 처리

  1. 이중 밀폐 봉지에 RT 램프 반응의 처분. 할 하지 압력솥이 미래에 거짓 긍정적인 반응을 이끌어 RT 램프 제품 aerosolize 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RT-램프 반응 3 가지 방법을 사용 하 여 분석할 수 있습니다. 첫째, 형광 핵 산 염료의 추가 함께 긍정적인 반응이 됩니다 노란색/녹색 색상에 부정적인 반응을 오렌지 육안으로 색상에 나타납니다. 둘째, RT 램프 반응 형광 핵 산 염료의 추가에 결과 형광 신호 샘플 UV 빛에 의해 흥분. 부정적인 반응을 소량 부정적인 컨트롤에 있을 수 있는 모든 배경 형광에 감지 형광 신호를 없을 것 이다. 마지막으로, RT-램프 반응은 agarose 젤에 밖으로 실행할 수 있습니다. 반면 부정적인 반응 없는 DNA 악대 있을 것 이다 긍정적인 RT 램프 반응 밴딩 패턴, 있을 것 이다. 이러한 분석 방법의 모든 3를 사용 하 여이의 예는 그림 2 3에서 설명 했다. 이 샘플의 RNA RT 램프 이전 절연 했다. 그림 1 실시간 램프 반응에 사용 하기 위해 충분히 PBS에서 전체 모기의 분쇄 하는 방법을 보여 줍니다. 그림 2, ZIKV RT-램프 반응의 특이성은 설명 했다: ZIKV 분자 제어만 아니라 DENV 분자 제어 나 부정적인 제어는 긍정적인 RT 램프 반응. 또한, ZIKV ZIKV 감염 (그림 2A) 없이 무 증상 제어 환자 아니지만 소변 알려진 ZIKV 감염, 환자의 혈 청에서 검출 된다. 그림 2B, 인간의 18s를 위한 샘플 테스트 rRNA RT 램프를 사용 하 여. 환자 (소변 이나 혈 청), 하지만 하지 분자 컨트롤 또는 부정적인 컨트롤에서 샘플만은 18에 대 한 긍정적인 rRNA. 따라서, 18s rRNA RT 램프 인간 환자에서 샘플에 대 한 실시간 램프 반응에 대 한 품질 관리로 사용할 수 있습니다. 모기 샘플은 ZIKV 또는 AEDAE (그림 3) RT 램프 품질 관리에 대 한 마찬가지로 테스트할 수 있습니다. 이 예제에서 ZIKV로 ZIKV 감염 모기에 대 한 긍정적인 분자 제어는 ZIKV에 대 한 긍정적 이다. 부정적인 통제 DENV에 대 한 분자 제어, mock 감염 된 모기 (모기 바이러스를 포함 하는 셀 문화 미디어 microinjected), 및 DENV 감염 모기는 모두 ZIKV(그림 3)에 대 한 부정적. 그러나, 모든 모기는 RT-램프 (그림 3B)에 의해 AEDAE에 대 한 긍정적 이다.

가능한 경우, 모든 세 가지 분석 방법 때때로 형광 신호 약한 수와 일부 개인 시각적 색상 변경 결정을 어렵게 하는 색맹, 있을 수 있습니다 긍정적인 또는 부정적인 반응 확인 사용 되어야 한다. 부정적인 제어 긍정적인 경우에 테스트 샘플의 전체 세트는 오염으로 유효 하 고 따라서 가양성 배제할 수 없다. 긍정적인 통제 부정적인 경우에서 RT 램프 반응 일 한가지고 있습니다 샘플의 전체 집합이 유효 하지 않습니다. 그러나 이것은 밖으로 질적 읽기,, 바이러스의 높은 복사본 평가 될 수 있다 형광 강도 또는 패턴 밴딩 DNA의 강도 의해 젤 전기 이동 법에 의해 RT 램프 제품의 증가 귀 착될 것 이다.

Figure 1
그림 1 : 모기 원유 lysate의 준비. (A) 장소 microcentrifuge 튜브에 PBS의 100 µ L에 모기. (B)는 튜브의 측면에 대 한 모기 10 번 호감 P10 피펫으로 팁을 사용 하 여. (C)이 작은 파편을 탁상용 원심 분리기 짧게 내려 버리고 한다 원유 lysate를 생성 합니다. 만 상쾌한 RT 램프 반응을 위해 사용 되어야 한다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 : ZIKV와 18S rRNA RT-램프 환자 소변 및 혈 청 샘플에. 무 증상 제어 환자 (C01) 또는 ZIKV에 감염 된 환자 (Z01)에서 소변 이나 혈 청 샘플 ZIKV (A) 또는 18S rRNA (B) 특정 RT 램프 반응을 받게 했다. RT-램프 반응 후 형광 핵 산의 눈 (위 패널), 녹색 형광 (중간 패널)에 의해 염색 또는 젤 전기 이동 법 (하단 패널) 시각화 했다. 레인 m: DNA 대량 마커; NTC: 없음 템플릿 컨트롤 (부정적인); ZIKV: ZIKV PCR 표준 긍정적인 통제; DENV: DENV 긍정적인 제어 합니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오. 

Figure 3
그림 3 : ZIKV 및 AEDAE RT-램프 Ae aegypti . 단일 Ae aegypti 모의 제어, ZIKV, 또는 DENV 감염 ZIKV (A) 또는 AEDAE (B) 특정 RT 램프 반응을 받게 했다. RT-램프 반응 후 형광 핵 산의 눈 (위 패널), 녹색 형광 (중간 패널)에 의해 염색 또는 젤 전기 이동 법 (하단 패널) 시각화 했다. 레인 m: DNA 대량 마커; NTC: 없음 템플릿 컨트롤 (부정적인); ZIKV: ZIKV PCR 표준 긍정적인 통제; DENV: DENV 긍정적인 제어 합니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오. 

대상 뇌관 시퀀스 (5'-3')
호모 사피엔스 18S rRNA 18SrRNA-FIP *
18SrRNA-BIP *
18SrRNA-F3
18SrRNA-B3
18SrRNA LF
18SrRNA 파운드
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-BIP *
ZIKV-F3
ZIKV-B3
ZIKV LF
ZIKV 파운드
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
Ae입니다. aegypti 말라 Ae21-FIP *
Ae21-BIP *
Ae21 LF
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* 프라이 머 빠른 고성능 액체 크로마토그래피 (HPLC)에 의해 정화 한다. 다른 프라이 머에 대 한 표준 염 조건은 충분 합니다.

표 1: 뇌관 RT 램프 반응에 대 한 시퀀스. 뇌관 순서 원래 이전 간행물6에서 설명 합니다.

볼륨 (µ L) 뇌관 사진 농도 (µ M) 최종 농도 (µ M)
80 앞으로 내부 뇌관 (FIP) 100 16
80 뒤로 안 뇌관 (BIP) 100 16
10 앞으로 외부 뇌관 (F3) 100 2
10 뒤로 외부 뇌관 (B3) 100 2
20 앞으로 루프 (LF) 100 4
20 루프 뒤로 (파운드) 100 4
280 분자 학년 물 - -
500

표 2: RT 램프 뇌관 믹스 x 10의 준비. Ae. aegypti 걸 설정 RT 램프 뇌관 BF 뇌관; 포함 하지 않는다 물이이 볼륨을 바꿉니다.

1 x 볼륨 (µ L) 구성 요소 최종 하자마자 25 µ L 볼륨에 대 한
2.5 등온 증폭 버퍼 x 10 1 x
1.8 100 m m 뒤/A/T/C/GTPs 1.4 m m
2.0 100 mM MgSO4 6 + 2mm 버퍼에서 = 8 mM [4-10 m m 범위]
2.5 10 x 뇌관 1.6 Μ M FIP/BIP, 0.2 Μ M F 3/B3, 0.4 Μ M 층/BL
1.0 스트랜드 변위 (8000 U/mL)와 thermophilic DNA 중 합 효소 8 U
0.5 역전사 (15000 U/mL) 7.5 U
0.5 UDG (1000 U/mL) 0.5 U
12.3 분자 학년 물 -
23.0

표 3: RT 램프 마스터 믹스 준비 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ZIKV RT-램프 분석 결과 인간과 모기 샘플6을 사용 하 여이 종이 작품에 설명 된. 탐지의 한계는 약 1 게놈에 해당6, 증상 ZIKV 감염 환자의 일반적인 바이러스 부하 이기 때문에 10 충분 해야3  106 PFU/mL7. 또한,이 방법은 ZIKV 샘플 먼저 분리 RNA와 세포 배양에서 바이러스 증폭 없이 검색할 수 있습니다. 이 크게 시간, 비용, 및 qRT-PCR에 비해이 분석 결과의 건강 위험을 감소 합니다.

이 프로토콜에 표시 된 볼륨 비율에 사용 하는 소변 샘플 RNA 격리 없이 RT 램프 반응을 허용 해야 한다. 하나 이론적으로 실시간 램프 반응에 사용 하는 샘플의 양을 증가 수, 하는 동안 때이 샘플은 소변 치료 운동 해야. 소변은 PCR 반응;을 억제할 수 있는 여러 화학 물질을 포함 소변에 있는 우 레 아 polymerases8 저하 알려져 있으며 너무 높은 소변/RT-램프 반응 비율을 사용 하 여 실시간 램프 반응을 방지할 것 이다. 바이러스의 낮은 금액을 예상 하는 경우에 소변에 대 한 특정 키트를 사용 하 여 RNA 격리 수행 좋을 것 이다. 마찬가지로, 혈 청 혈 청 높은 볼륨8에서 사용 하는 경우 실시간 램프를 억제 수 있습니다 PCR 억제제를 포함할 수 있습니다.

이 프로토콜에 포함 서쪽 더 럽 히 프로토콜에서 로드 제어 유사 RT 램프 반응에 대 한 품질 컨트롤의 포함이 이다. 임상 샘플 RT 램프 품질 관리에 대 한 부정적인 경우에, 다음 ZIKV RT-램프에 대 한 부정적인 반응 수 있습니다 false 네거티브 샘플 PCR 억제제의 높은 금액 또는 총 RNA의 낮은 금액을 포함 수 있습니다. RT-램프 분석 결과 이전 샘플에서 RNA를 분리할 필요는 없습니다. 이 프로토콜에서 대표 RT 램프 결과 RNA 격리 없이 얻은 했다. 그러나, RNA 격리 낮은 바이러스 부하와 함께 샘플에서 탐지를 향상 시킬 수 있습니다 또는 PCR 억제제의 상부를 포함할 수 있는. 혈 청을 포함 한 대부분 샘플 종류에 대 한 RNA 격리 키트 제조 업체의 제안 된 프로토콜에 따라 사용할 수 있습니다. 소변 샘플에 대 한 소변 샘플에 대 한 특정 RNA 격리 키트를 사용 해야 합니다. 모기 샘플에 대 한 최대 속도 또는 RNA 격리 하기 전에 douncing에서 2 분 동안 분쇄 열 통해 PBS의 100 µ L에서 모기를 실행 하 여 모기를 lyse 하는 것이 좋습니다. RNA의 차입 버퍼 30 µ L에 eluted 고 사용까지-80 ° C에 저장.

RNA 격리 다음 생 PCR 억제제를 제거 하거나 RT 램프 이전 RNA를 집중 제안 했다. RT-램프 품질 관리 여전히 부정적인 경우 qRT-PCR ZIKV 탐지를 위해 사용 되어야 한다.

이 프로토콜에서 RT 램프 뇌관 (57-65 ° C) 온도 및 외피의 범위에서 작동 하도록 확인 되었습니다 (8-60 분), 시간 틀에 얽매이지 않는 사용 하 여 뿐만 아니라가 열 소스 (., 불꽃 배급 히터, 물 목욕) 표준 외부 실험실 조건입니다. 테스트 하는 모든 온도 비교 결과 했다. 혼자 영상 색상 변화에 의해 감지에 따라, ZIKV RT-램프 제품의 검색을 위한 최적의 시간 30 분 이었다. 그러나, UV 빛 여기 또는 젤에 패턴 밴딩 탐지 빠르면 8 분 총 보육 시간 긍정적인 했다. 일부 RT 램프 프로토콜 포함 DMSO, 하지만이 프로토콜에 그것 실시간-램프 반응의 억제 귀 착될 수 있다. 야생-타입 thermophilic DNA 중 합 효소 빠른 증폭 신호를 포함 한 장점이 있을 수 있습니다는 thermophilic DNA 중 합 효소 실 온에서 설정할 수 있는 사용 하 고 실내 온도9,10 안정성 증가 . 그러나 Ethidium 평범한 사람 핵 산 시각화 2 %agarose 젤에서 대신 사용할 수 있습니다, 그리고, 다른 형광 핵 산 염료는 agarose 젤에 대 한 낮은 돌연변이 잠재력 그들에 게 안전한 선택. 그러나, 장갑 착용 등 적절 한 안전 조치 여전히 사용 되어야 한다.

그러나이 프로토콜의 한계는 질적 및 양적 기술 하지 그것은,, 상대 부 량6할 수 있다 이다. 또한, RT-램프 뇌관 매우 구체적인 고 16 긴장에서 발견 하 고 적어도 5 종자6에서 작동 하도록 확인 하는 ZIKV의 nonstructural 단백질 5의 높은 보존된 시퀀스에 대 한 설계 되었습니다. 그는 야생에서 ZIKV에 광범위 한 변이 되지 않을 수 있습니다 이러한 뇌관에 의해 감지 미래에 가능 하다. 다른 그룹도 관심11,12,13,,1415,16,17의 될 수 있는 ZIKV의 검출을 위한 새로운 기술 개발 .

요약 하자면,이 프로토콜 샘플 종류의 특수 장비를 필요로 하지 않는 다양 한 ZIKV, 간단, 신속 하 고 비용 효율적인 방법을 제공 한다. 이 ZIKV 탐지는 RNA 필요가 없습니다 RT 램프 반응 하기 전에 격리에 대 한 새로운 진단 도구를 제공 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL과 MBC Zika 바이러스 진단 방법에 지적 재산이 있다. 나머지 작가 없습니다 경쟁 관심사 있다.

Acknowledgments

이 작품은 모 린과 로널드 허쉬 가족 자선 기여 및 필드 신경 과학 연구소, 세인트 메리의 미시간의 의해 지원 되었다. Funders 연구 설계, 데이터 수집 및 분석, 결정 게시 또는 원고의 준비에 전혀 역할을 했다. 우리 또한 그들의 중요 한 검토의 원고에 대 한 박사 집 엔 Zwaans와 엘리야 드를 감사합니다.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
반대로 Zika 바이러스 및 내부 관리 유전자 소변, 혈 청, 그리고 모기 샘플에 대 한 분석 결과 전사 루프 중재 하는 등온 증폭 (RT-램프)
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter