Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Обратный Assay транскрипции петля опосредованной изотермической амплификация (RT-лампа) для Зика вирус и уборки генов в моче, сыворотки и пробы москитная

doi: 10.3791/58436 Published: September 14, 2018

Summary

Этот протокол обеспечивает эффективный и недорогой способ обнаружить вирус Зика или контролировать цели в образцах мочи и сыворотки или комаров, обратная транскрипция цикла опосредованной изотермической амплификация (RT-лампа). Этот метод не требует РНК изоляции и может быть сделано в течение 30 мин.

Abstract

Заражение вирусом Зика (ZIKV) может быть бессимптомным у взрослых, однако, инфекции во время беременности может привести к выкидышу и тяжелых неврологических врожденных дефектов. Цель настоящего Протокола заключается в быстро обнаружить ZIKV в образцах человека и комаров. Текущий золотой стандарт для обнаружения ZIKV является количественная обратная транскрипция ПЦР (qRT ПЦР); Обратная транскрипция цикла опосредованной изотермической амплификация (RT-лампа) может позволить для более эффективных и недорогостоящих тестирования без необходимости дорогостоящего оборудования. В этом исследовании RT-лампа используется для обнаружения ZIKV в различных биологических образцов в течение 30 мин, без первой изолировать РНК из образца. Этот метод показан с помощью ZIKV инфицированных пациентов мочи и сыворотки и инфицированных комаров образцы. 18s рибосомных рибонуклеиновой кислоты и актина используются в качестве элементов в образцах человека и комаров, соответственно.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

В 2015 году Зика вирус (ZIKV) получил видные глобального внимания как инфекционное заболевание озабоченность, поскольку инфекции во время беременности был связан с выкидыш, мертворождение, тяжелые неврологические врожденных дефектов, включая микроцефалия, а также другие врожденные врожденные дефекты1. В редких случаях ZIKV был связан с синдром Гийена-Барре. ZIKV преимущественно передается комарами Aedes ; Однако он также может распространяться через половой контакт1. Учитывая, что инфекции с ZIKV протекает бессимптомно у большинства людей или подарки с мягким гриппоподобные симптомы, которые совпадают с симптомами инфекции других arborviruses1, существует необходимость совершенствования методов для быстрого и экономически обнаружения ZIKV на экран как людей, так и местных комаров населения.

Количественная обратная транскрипция ПЦР (qRT ПЦР) является надежным методом для обнаружения ZIKV; Однако этот метод требует дорогостоящее специализированное оборудование, квалифицированного персонала и изоляции РНК из образца интерес. Обратная транскрипция цикла опосредованной изотермической амплификация (RT-лампа) является одношаговый метод амплификации нуклеиновых кислот, основанный на технологии PCR, которая требует только одной температуры инкубации за счет использовании теплолюбивых ДНК-полимеразы с нити Перемещение свойств. Это обходит необходимость Термоциклер и уменьшает продолжительность времени, необходимого для завершения анализа. Дополнительные преимущества RT-Лампа высокая специфичность и чувствительность, надежность в диапазоне рН и температуры и сопротивление многих ПЦР ингибиторы2. Он имеет сравнительно низкую стоимость и реагенты стабильны при комнатной температуре. Учитывая эти характеристики, RT-лампа может быть развернут в лаборатории или в поле. Таким образом лампа реакции были разработаны для обнаружить широкий спектр патогенов и других видов инфекции3,4,5. Цель протокола RT-лампа, описанных в данном документе является обнаружить ZIKV без изоляции РНК в человеческой сыворотки и мочи образцов, а также как единый инфицированных комаров в течение 30 мин через RT-лампа. Этот метод может использоваться для замены qRT-PCR как это чувствительной, быстрое диагностический инструмент, который работает быстро и в настройках вне лаборатории.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Все методы, описанные здесь были одобрены организационного обзора (КИБ) Beaumont здоровья. Все эксперименты проводились в соответствии с соответствующих руководящих принципов и правил.

Предупреждение: Все потенциально инфекционные материалы должны обрабатываться согласно стандартам 2-го уровня биобезопасности, включая использование средств индивидуальной защиты. Любые процедуры, которые могут производить аэрозоля должны выполняться в биобезопасности кабинета. Кроме того работа с живой комаров должны выполняться в соответствующее медицинское учреждение членистоногих сдерживания уровня 1-3. Учитывая ассоциации ZIKV инфекции с врожденными аномалиями, беременные женщины, пытающаяся зачать, или партнеров этих женщин должны значительно минимизации их лаборатории ZIKV. Транспортировка образцов ZIKV классифицируется в Соединенных Штатах как биологические вещества категории B в соответствии с Департамента перевозки опасных материалов правил (49 CFR часть 171-180) и поэтому доставка образцов следует придерживаться тех руководящие принципы. Импорт в Соединенные Штаты Америки ZIKV biospecimens требует центров для борьбы с болезнями и профилактике болезней (ЦББ) разрешение на импорт. Импорт любых членистоногих, которые могли бы служить в качестве вектора для ZIKV передачи, даже если они не инфицированы, требуется разрешение министерства сельского хозяйства США (USDA). Эта информация является текущим на момент публикации. Современные рекомендации можно найти на https://www.cdc.gov/zika/laboratories/lab-safety.html.

Примечание: RT-лампа реакции склонны к более высокий уровень ложных положительных реакций, поэтому меры предосторожности должны быть приняты в экспериментальной планирования. Все настройки и выполнения RT-лампа реакций следует использовать назначенный пипетки и фильтр советы. В идеале следует установить боковые рабочего потока. Если возможно анализа и обработки изображений (раздел 5) должно происходить в отдельном закрытом помещении для предотвращения загрязнения. Открытия пробирки, содержащие RT-лампа продукты должны быть сведены к минимуму.

1. RT-лампа грунтовка подготовка

  1. Воссоздать каждый лиофилизированные RT-лампа грунт в воде молекулярные класса до конечной концентрации 100 мкм (Таблица 1). Кратко вихрь грунтовочный раствор для обеспечения однородного раствора и кратко вращаться вниз решение на максимальной скорости в центрифугу столешницы для сбора всех грунтовочный раствор.
  2. Подготовка 10 x RT-лампа грунтовка смесь FIP, BIP, F3, B3, LF и LB грунтовки с помощью томов в таблице 2. Кратко вихрь грунтовочный раствор обеспечить однородный раствор, и кратко вращаться вниз решение на максимальной скорости в центрифугу столешницы, чтобы избежать любой потери.
    Примечание: RT-лампа грунтовка для А.е. aegypti актина (AEDAE) не содержат LB грунтовка (петля праймеры не всегда необходимые для реакции RT-лампа). В этом случае замените объем грунтовка LB с молекулярного уровня воды.
  3. Хранить грунты при-20 ° C между использованиями и избежать циклов оттаивания бесплатно.

2. Пробоподготовка

  1. Для образцов мочи человека: Использование свежей мочи, замороженные моча или моча в консервант. Для свежего или замороженного образца: немедленно спин вниз образца после сбора за 10 мин на 700 x gи использовать супернатант для анализа или заморозить при температуре-80 ° C для использования в будущем. Оттепель замороженных образцов на льду перед использованием.
  2. Для образцов сыворотки крови человека: Используйте образцы либо свежие или замороженные сыворотки.
  3. Для ZIKV инфицированных клеток линии: использовать кондиционерами СМИ или lysates клетки.
    Примечание: Бесплатный сотовый кондиционером СМИ из А.е. albopictus C6/36 клетки 8 дней после инфицирования может использоваться как позитивные элементы управления для ZIKV RT-лампа реакций.
  4. Для А.е. aegypti комаров: использовать либо весь свежий или замороженный комаров туши. Оттепель замороженных комаров на льду. Подготовка сырой комаров lysate, поместив в 100 мкл фосфат амортизированное saline (PBS) отдельных Москито и гомогенизации путем дробления комаров 10 раз с кончиком пипетки P10 (рис. 1). Кратко центрифуга сырой lysate Пелле любой мусор. Используйте супернатант течению RT-лампа анализа.
    Примечание: Позитивные элементы управления могут быть получены в лабораторных условиях путем заражения женщин комаров с помощью внутригрудного микроинъекции с приблизительно 103 эквиваленты генома вируса в объеме 200 nL и уборки комаров 5 дней послеоперационные инфекции.

3. Подготовка мастер RT-лампа микс

  1. Подготовка мастер смесь реакции RT-лампа на льду для каждого праймера, набор для использования с помощью руководство тома в таблице 3.
    Примечание: Использование термолабильных урацила ДНК Glycosylase (UDG) помогает в предотвращении ложных срабатываний.
  2. Вихревой кратко, чтобы обеспечить, что все образцы хорошо смешиваются, то спина вниз кратко для предотвращения потери объема.

4. RT-лампа Assay

  1. Накапайте 23,0 мкл RT-лампа мастер смесь реакции в ПЦР-пробирку 200 мкл. 2,0 мкл пример (моча, сыворотки или сырой комаров lysate супернатанта как описано в шаге 2). Это позволит довести общий объем 25,0 мкл в реакции RT-лампа. Для отрицательного контроля использования молекулярного уровня воды. Включают позитивные элементы управления.
    Примечание: ПЦР стандарт или вирус запасов от супернатант зараженных клеточных линий может использоваться как позитивный элемент управления.
    1. Дополнительно: Включают специфику управления реакции соответствующих арбовирусных например вирус денге (DENV). Подготовка образца, как указано в шаге 2 согласно образец типа. Мкл 2.0 Специфика управления в 23.0 мкл RT-лампа мастер смеси в ПЦР-пробирку 200 мкл.
  2. Тепло образцы на 61 ° C в течение 30 мин, с использованием теплового блока, водяная баня или Термоциклер.
  3. Тепла деактивировать полимеразы путем нагрева до 80 ° C в течение 10 мин.

5. RT-лампа анализ

Примечание: Анализ RT-лампа в отдельный, замкнутые пространства.

  1. После инкубации доступ к реакции RT-лампа визуально, посмотрев на наличие изменения цвета.
    1. Разбавьте 1:10 краска люминесцентные нуклеиновых кислот в буфер TAE (40 мм трис, 20 мм уксусная кислота, ЭДТА 1 мм).
      Предупреждение: Любой пятен нуклеиновой кислоты связывает нуклеиновых кислот и таким образом является канцерогеном. Надевайте перчатки при обработке.
    2. Для 12 мкл реакции RT-лампы 2 мкл разбавления краска люминесцентные нуклеиновых кислот.
      Примечание: Негативные реакции будет оранжевый цвет и позитивные реакций будет жёлто/зелёного цвета.
    3. Дополнительно: Сфотографировать RT-лампа реакций на белом фоне с помощью камеры.
  2. Поместите образцы под 302 Нм УФ света подтвердить присутствие продуктов RT-лампы флуоресценции. Сделайте снимок с помощью камеры результата.
    Примечание: Реакции положительные RT-лампа будет иметь флуоресцентный выход.
    Предупреждение: Носить UV защитные глаз googles или лица щит при работе с ультрафиолетовым светом.
  3. Дополнительно: Подтверждают наличие товаров RT-лампа, выполняя электрофорез геля на образцах.
    1. Вливают 2% гель агарозы 1 x TAE буфер с нуклеиновой кислоты пятно для визуализации.
      Предупреждение: Любой пятен нуклеиновой кислоты связывает нуклеиновых кислот и таким образом является канцерогеном. Надевайте перчатки при обработке.
    2. 5 мкл лестница ДНК, в первой полосе для сравнения молекулярным весом.
    3. Для каждой реакции RT-лампа смесь 13 мкл реакционной смеси RT-лампа с 2 мкл ДНК загрузки красителя. Загрузите 15 мкл смесь, содержащую ДНК, Загрузка красителя.
    4. Запустите геля на 90 V 90 мин, или до тех пор, пока полосы отделены и изображения с 302 Нм УФ света.
      Примечание: Реакции положительные RT-лампа будет иметь разрыв шаблона. Негативной реакции RT-лампа не должен содержать каких-либо групп.

6. Утилизация

  1. Распоряжаться RT-лампа реакций в двойной герметичные мешки. Сделать не автоклава, как это может aerosolize RT-лампа продукции, приводит к ложных положительных реакций в будущем.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RT-лампа реакции могут быть проанализированы с использованием трех различных методов. Во-первых с добавлением краски флуоресцентные нуклеиновых кислот, позитивные реакций будет желтый/зеленый цвет где негативной реакции будут отображаться оранжевый цвет невооруженным глазом. Во-вторых добавлением красителя флуоресцентные нуклеиновых кислот реакции RT-лампа приводит к флуоресцентного сигнала, когда образцы в восторге от ультрафиолета. Негативной реакции не будет обнаружить флуоресцентного сигнала над любой фон флуоресценции, которые могут присутствовать в небольших количествах в отрицательный контроль. И наконец реакции RT-лампа может выполняться на геле агарозы. Положительные реакции RT-лампа будет иметь шаблон диапазонов, тогда как негативная реакция будет иметь без полос ДНК. Примеры использования этого все три этих методов анализа демонстрируются на рисунках 2 и 3. Ни один из этих образцов были изолированы до RT-лампа РНК. Рисунок 1 демонстрирует дробления всей комаров в PBS, который является достаточным для использования в реакции RT-лампа. В Рисунок 2, показана специфичность реакции ZIKV RT-лампа: только молекулярный контроль ZIKV, не DENV молекулярные управления или отрицательные, имеет положительные реакции RT-лампа. Кроме того ZIKV обнаруживается в моче и сыворотке пациента с известными ZIKV инфекции, но не в бессимптомной управления пациента без ZIKV инфекции (рисA). В рисунке 2B, образцы тестируются для человека 18s рРНК, используя RT-лампа. Только образцы из пациентов (мочи или сыворотки), но не молекулярных элементов управления или отрицательный контроль, являются позитивными для 18s рРНК. Таким образом, 18s рРНК RT-лампа может использоваться как элемент управления качества для реакции RT-лампа для образцов от человека пациентов. Пробы москитная можно аналогичным образом испытаны для ZIKV или RT-лампа контроля качества, AEDAE (рис. 3). В этом примере положительный молекулярный контроль для ZIKV, а также комаров, инфицированных ZIKV являются позитивными для ZIKV. Отрицательный контроль, молекулярные управления для DENV, макет инфицированных комаров (комаров, microinjected с медиа культуры клеток, содержащий вирус не), и DENV инфицированных комаров все негативные для ZIKV (рис. 3А). Однако все комары являются позитивными для AEDAE RT-лампа (рис. 3B).

Когда это возможно, все три аналитические методы должны использоваться для подтверждения положительные или отрицательные реакции, как иногда флуоресцентного сигнала может быть слабой и некоторые лица могут быть дальтоника, делая изменения визуального цвета трудно определить. В тех случаях, когда отрицательный контроль положительный весь набор образцов является недействительным, как загрязнение, и поэтому нельзя исключать ложных срабатываний. В тех случаях, когда положительный контроль отрицательный весь набор образцов является недопустимым, как реакции RT-лампа может не работали. Это качественный зачитал, однако, больше копий вируса приведет к увеличению продукции RT-лампы, которые могут быть оценены по интенсивности флуоресценции или интенсивности ДНК, диапазонов шаблон электрофорезом геля.

Figure 1
Рисунок 1 : Подготовка комаров сырой lysate. (A) место комаров в 100 мкл PBS в пробки microcentrifuge. (B) с помощью кончика пипетки P10, раздавить Москито против стороны трубки 10 раз. (C) это производит lysate сырой, который должен вращаться вниз кратко в центрифугу столешницы для пеллет мусора. Для реакции RT-лампа должны использоваться только супернатант. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : ZIKV и 18S рРНК RT-лампа в пациентов образцов мочи и сыворотки. Образцы мочи или сыворотки от бессимптомного управления пациента (C01) или ZIKV инфицированных пациентов (Z01) были подвергнуты ZIKV (A) или 18S рРНК (B) специфические реакции RT-лампа. RT-лампа реакции были визуализирована после добавления флуоресцентные нуклеиновой кислоты красить глаза (Верхняя панель), зеленая флуоресценция (средняя группа), или гель-электрофореза (Нижняя панель). Лейн M: ДНК массового маркер; НПС: Нет шаблона (контроль негативные); ZIKV: ZIKV PCR стандартной положительный контроль; DENV: DENV положительный контроль. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры. 

Figure 3
Рисунок 3 : ZIKV и AEDAE RT-лампа в А.е. aegypti . Одноместный А.е. aegypti инфицированных макет элемента управления, ZIKV или DENV были подвергнуты ZIKV (A) или AEDAE (B) специфические реакции RT-лампа. RT-лампа реакции были визуализирована после добавления флуоресцентные нуклеиновой кислоты красить глаза (Верхняя панель), зеленая флуоресценция (средняя группа), или гель-электрофореза (Нижняя панель). Лейн M: ДНК массового маркер; НПС: Нет шаблона (контроль негативные); ZIKV: ZIKV PCR стандартной положительный контроль; DENV: DENV положительный контроль. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры. 

Цель Грунтовка Последовательность (5' - 3')
Homo sapien 18S рРНК 18SrRNA-FIP *
18SrRNA-BIP *
18SrRNA-F3
18SrRNA-B3
18SrRNA-LF
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-BIP *
ZIKV-F3
ZIKV-B3
ZIKV-LF
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
AE. aegypti актина Ae21-FIP *
Ae21-BIP *
Ae21-LF
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* Грунтовки должны быть очищены сами по быстрый высокопроизводительный жидкостной хроматографии (ВЭЖХ). Для всех других грунтовки стандартные опреснительной условия являются достаточными.

Таблица 1: грунтовка последовательностей для RT-лампа реакций. Первоначально грунтовка последовательности описаны в предыдущей публикации6.

Объем (мкл) Грунтовка Концентрация запасов (мкм) Конечная концентрация (мкм)
80 Прямой внутренний грунт (МФП) 100 16
80 Грунтовка обратной внутреннюю (BIP) 100 16
10 Форвард Внешняя грунтовка (F3) 100 2
10 Обратная Внешняя грунтовка (B3) 100 2
20 Цикл вперед (LF) 100 4
20 Петля обратной (LB) 100 4
280 молекулярного уровня воды - -
500 Итого

Таблица 2: подготовка 10 x RT-лампа грунтовка Mix. RT-лампа грунтовка для А.е. aegypti актина не содержат BF грунт; Замените этот объем воды.

1 x объем (мкл) Компонент Окончательный высококонцентрированные Для 25 мкл тома
2.5 10 x буфер изотермический амплификации 1 x
1.8 100 мм dU/A/T/C/GTPs 1,4 мм
2,0 100 мм MgSO4 6 + 2 мм в буфере = 8 мм [4-10 мм диапазон]
2.5 10 x праймеры 1.6 МКМ МФП/BIP, 0,2 МКМ F3/B3, 0,4 МКМ FL/BL
1.0 теплолюбивые ДНК-полимеразы водоизмещением Стрэнд (8000 ед/мл) 8 U
0.5 Обратной транскриптазы (15 000 ед/мл) 7.5 U
0.5 UDG (1000 ед/мл) 0,5 U
12.3 молекулярного уровня воды -
23,0 Итого

Таблица 3: Подготовка RT-лампа Мастер микс.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Пробирная ZIKV RT-лампа, описанные в этой бумаге работ с использованием как человека, так и комаров образцы6. Предел обнаружения был примерно 1 генома эквивалент6, которое должно быть достаточно, поскольку типичная вирусная нагрузка симптоматическим ZIKV инфицированных пациента составляет 103 - 106 ОРП/мл7. Кроме того этот метод может обнаружить ZIKV в образцах без первой изолировать РНК и усиления вируса в культуре клеток. Это значительно уменьшает время, стоимость и риски для здоровья этот assay, по сравнению с qRT-PCR.

Мочи, используемые при соотношении объема, указанных в настоящем протоколе должен позволить RT-лампа реакции происходят без изоляции РНК. Хотя один теоретически может увеличить количество образцов, используемых в реакции RT-лампа, следует проявлять осторожность, когда этот образец мочи. Моча содержит несколько химических веществ, которые могут препятствовать ПЦР-реакции; мочевины в моче, как известно, снижают полимеразы8 и с использованием коэффициента реакции мочи/RT-лампа, что является слишком высокой предотвратит реакции RT-лампа. Если ожидается низкое количество вируса, было бы лучше выполнять РНК изоляции с помощью конкретного комплекта для мочи. Аналогичным образом сыворотки может содержать ПЦР ингибиторов, которые могут препятствовать RT-лампа, когда сыворотка используется на высокий объем8.

Включены в этот протокол является включение контроля качества для реакции RT-лампа, сродни контроль погрузки в западных blotting протоколы. Если отрицательный для RT-лампа контроля качества клинических образцов, негативная реакция на ZIKV RT-лампа может быть ложноотрицательные как образец может содержать большое количество PCR ингибиторов или низкой суммы всего РНК. Это не необходимо изолировать РНК из образца до RT-лампа assay. Представитель RT-лампа результаты в этом протоколе были получены без изоляции РНК. Однако РНК изоляции может улучшить обнаружение в образцах с низкой вирусной нагрузкой или которые могут содержать высокий уровень ПЦР ингибиторов. Для большинства типов образца, включая сыворотки комплект изоляции РНК может использоваться после производителя предлагаемый протокол. Для мочи следует использовать набор изоляции РНК, специфических для мочи. Для пробы москитная рекомендуется лизируют комаров, запустив комаров в 100 мкл PBS через столбец измельчения для 2 минут при максимальной скорости или douncing перед РНК изоляции. РНК могут быть этого eluted в 30 мкл буфера и хранятся при температуре-80 ° C до использования.

РНК изоляции затем предложил удалить эндогенные ингибиторы ПЦР или концентрации РНК до RT-лампа. Если RT-лампа контроля качества по-прежнему отрицательно, qRT ПЦР должны использоваться для обнаружения ZIKV.

RT-лампа грунтовки в этом протоколе были подтверждены для работы в диапазоне температур (57 – 65 ° C) и инкубации раз (8-60 мин), а также с использованием нетрадиционных источников Отопление (например., нагреватель беспламенного рацион, водяная баня) за пределами стандарт лабораторных условиях. Все испытаны температуры дал сопоставимые результаты. Основываясь на обнаружение изменения визуального цвета только, оптимальное время для обнаружения ZIKV RT-лампа продукции был 30 мин. Однако обнаружение УФ света возбуждения или диапазонов узоры на гели были положительными с как 8 мин всего инкубации время. Некоторые протоколы RT-лампа включают ДМСО, но в этом протоколе, может привести к ингибированию реакции RT-лампа. Использовании теплолюбивых ДНК-полимеразы, которая может быть настроена при комнатной температуре могут иметь преимущества перед одичал тип теплолюбивая ДНК-полимеразы, включая быстрее усиления сигналов и увеличили стабильность при комнатной температуре9,10 . Бромид ethidium вместо него может использоваться для визуализации нуклеиновых кислот в гелях агарозы 2%, однако, другие флуоресцентные нуклеиновой кислоты красители для гелей агарозы ниже мутагенному потенциалу, делая их безопасным выбором. Однако по-прежнему должны использоваться соответствующие предосторожности например носить перчатки.

Ограничение этого протокола заключается в том, что это качественный и количественный метод, однако, относительно количественной оценки может быть сделано6. Кроме того RT-лампа грунты очень специфичны и были разработаны против весьма сохраняется последовательность неструктурных белка 5 ZIKV, который найден в 16 штаммов и проверены для работы в по крайней мере 5 штаммов6. Вполне возможно, что обширные мутации в ZIKV в дикой природе не может быть обнаруживаемых этими грунтовки в будущем. Другие группы также разработали новые технологии для обнаружения ZIKV, которое могут представлять интерес11,12,13,14,,1516,17 .

Таким образом этот протокол обеспечивает быстрый, простой и экономически эффективным методом для ZIKV в различных типов образцов, которая не требует специализированного оборудования. Это обеспечивает новый диагностический инструмент для обнаружения ZIKV, в которой РНК не должны быть изолированы до реакции RT-лампа.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Лель и МБК имеют интеллектуальной собственности на Зика методов диагностики вируса. Остальные авторы имеют не конкурирующие интересы.

Acknowledgments

Эта работа была поддержана Морин и Рональд Хирш семейный благотворительный вклад и области нейронаук институт, Святой Марии штата Мичиган. Спонсоры имел никакой роли в дизайн исследования, сбор данных и анализ, решение опубликовать или подготовка рукописи. Мы также благодарим д-р Бернадетт Zwaans и Илия Уорд за их критического обзора рукописи.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
Обратный Assay транскрипции петля опосредованной изотермической амплификация (RT-лампа) для Зика вирус и уборки генов в моче, сыворотки и пробы москитная
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter