Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Revertir el ensayo de amplificación isotérmica mediada por el lazo de transcripción (RT-LAMP) para el Virus Zika y Housekeeping Genes en muestras de mosquitos, suero y orina

doi: 10.3791/58436 Published: September 14, 2018

Summary

Este protocolo proporciona un método eficiente y de bajo costo para detectar virus Zika o controlar objetivos en muestras de suero y orina humanas o en mosquitos por amplificación isotérmica mediada lazo de transcripción inversa (RT-LAMP). Este método no requiere aislamiento de RNA y se puede hacer dentro de 30 minutos.

Abstract

Infección con el virus Zika (ZIKV) puede ser asintomática en adultos, sin embargo, la infección durante el embarazo puede causar aborto espontáneo y defectos congénitos neurológicos graves. El objetivo de este protocolo es detectar rápidamente ZIKV en muestras de humanos y mosquito. El actual estándar de oro para la detección de ZIKV es cuantitativa transcripción reversa PCR (qRT-PCR); amplificación isotérmica mediada lazo de transcripción inversa (RT-LAMP) puede permitir una prueba más eficiente y de bajo costo sin necesidad de equipo costoso. En este estudio, RT-lámpara se utiliza para la detección de ZIKV en diversas muestras biológicas dentro de 30 minutos, sin primero aislar el RNA de la muestra. Esta técnica se demostró usando ZIKV infectados en suero y orina de pacientes e infectados muestras de mosquitos. Ácido ribonucleico ribosomal de 18S y actina se utilizan como controles en muestras de humanos y mosquito, respectivamente.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En 2015, Zika virus (ZIKV) ganó atención mundial prominente como una enfermedad infecciosa de preocupación porque la infección durante el embarazo era ligada a aborto espontáneo, mortinato, graves defectos congénitos neurológicos incluyendo microcefalia, así como otros congénita defectos de nacimiento1. En casos raros, ZIKV se ha asociado con el síndrome de Guillain-Barré. ZIKV es principalmente transmitida por los mosquitos Aedes ; sin embargo, también se puede propagar a través del contacto sexual1. Dado que la infección con ZIKV es asintomática en la mayoría de la gente o presenta con suaves gripe-como síntomas que se solapan con los síntomas de la infección de otros arborviruses1, hubo una necesidad de mejorar los métodos para la detección rápida y rentable de ZIKV para personas, así como las poblaciones de mosquitos locales.

Cuantitativa transcripción reversa PCR (qRT-PCR) es un ensayo confiable para ZIKV; sin embargo, esta técnica requiere costosos equipos especializados, personal capacitado y aislamiento de RNA de la muestra de interés. Amplificación isotérmica loop-mediated de reversa de la transcripción (RT-LAMP) es un método de amplificación de ácido nucleico un solo paso basado en la tecnología PCR que sólo requiere una temperatura de incubación debido al uso de una polimerasa de la DNA termófila con filamento características de la dislocación. Esto evita la necesidad de un termociclador y disminuye la cantidad de tiempo necesario para completar el ensayo. Ventajas adicionales de RT-LAMP incluyen su alta especificidad y sensibilidad, robustez en una gama de niveles de pH y temperatura y resistencia a muchos de los inhibidores de la PCR2. Tiene un costo relativamente bajo y los reactivos son estables a temperatura ambiente. Dadas estas características, lámpara de RT se puede implementar en un laboratorio o en el campo. Así, las reacciones de la lámpara se han desarrollado para detectar una gama de agentes patógenos y otros tipos de infección3,4,5. El protocolo de RT-LAMP descrito en este documento pretende detectar ZIKV sin aislamiento de RNA en suero y orina muestras humanas así como en un solo mosquito infectado dentro de 30 minutos a través de RT-LAMP. Este método puede utilizarse para reemplazar la qRT-PCR es una herramienta de diagnóstico sensible y rápida que funciona rápidamente y en ambientes fuera del laboratorio.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos los métodos aquí descritos han sido aprobados por la Junta de revisión institucional (IRB) de salud de Beaumont. Todos los experimentos fueron realizados con arreglo a las normas y directrices pertinentes.

PRECAUCIÓN: Todos los materiales potencialmente infecciosos deben ser manipulados según las normas de bioseguridad nivel 2 incluyendo el uso de equipo de protección personal. Todos los procedimientos que pueden producir aerosoles deben realizarse en un gabinete de bioseguridad. Además, trabajo con mosquitos vivos debe realizarse en los centros de artrópodos contención nivel 1-3. Dado la Asociación de infección por ZIKV con anormalidades congénitas, las mujeres que estén embarazadas, intentando concebir, o los socios de estas mujeres deben minimizar significativamente su exposición del laboratorio a ZIKV. Transporte de muestras ZIKV se clasifica en los Estados Unidos como sustancias biológicas de categoría B según departamento de peligrosos materiales regulaciones del transporte (49 CFR parte 171-180) y por lo tanto, envío de muestras debe adherirse a los directrices. Importación en los Estados Unidos de ZIKV biológicas requiere un centros para el Control y prevención de enfermedades (CDC) permiso de importación. Importación de cualquier artrópodos que podría servir como un vector para la transmisión de ZIKV, incluso si no están infectados, requiere un permiso del Departamento de agricultura de Estados Unidos (USDA). Esta información está actualizada en el momento de publicación. Recomendaciones actualizadas pueden encontrarse en https://www.cdc.gov/zika/laboratories/lab-safety.html.

Nota: Las reacciones de RT-LAMP son propensas a mayores tasas de reacciones falsas positivas, por lo que se debe tener cuidado en la planificación experimental. Toda puesta en marcha y ejecución de las reacciones de RT-LAMP deben usar pipetas designados y extremidades de filtro. Idealmente, se debe establecer un flujo de trabajo lateral. Si es posible, análisis y proyección de imagen (sección 5) deben ocurrir en una sala cerrada para prevenir la contaminación. Apertura de tubos de ensayo que contengan productos de RT-LAMP debe mantenerse al mínimo.

1. RT-LAMP Primer preparación

  1. Reconstituir cada primer RT-LAMP liofilizado en agua grado molecular a una concentración final de 100 μm (tabla 1). Vortex brevemente la solución de imprimación para garantizar una solución homogénea y girar brevemente por la solución a la máxima velocidad en una centrífuga de mesa para recoger toda la solución la cartilla.
  2. Preparar un 10 x RT-LAMP Primer Mix de los iniciadores de la FIP, BIP, F3, B3, LF y LB con los volúmenes en la tabla 2. Vortex brevemente la solución de imprimación para garantizar una solución homogénea y girar brevemente por la solución a la máxima velocidad en una centrífuga de mesa para evitar cualquier pérdida.
    Nota: El primer RT-LAMP para Ae. aegypti actinia (AEDAE) no contiene una cartilla LB (cartillas de lazo no son siempre necesarios para las reacciones de RT-LAMP). En este caso, vuelva a colocar el volumen de la cartilla LB con agua grado molecular.
  3. Almacenar los cebadores a-20 ° C entre usos y evitar ciclos de descongelación libre.

2. preparación de la muestra

  1. Para las muestras de orina humana: Usar orina fresca, congelada orina u orina en conservante. Para la muestra fresca o congelada: inmediatamente girar por la muestra después de la recolección durante 10 min a 700 x gy utilizar el sobrenadante para el análisis o congelar a-80 ° C para su uso futuro. Descongelar las muestras congeladas en el hielo antes de usarlo.
  2. Para muestras de suero humano: Utilice cualquiera de los dos sueros frescos o congelados.
  3. Por ZIKV infectados líneas celulares: utilizar medios condicionados o lysates de la célula.
    Nota: Sin células acondicionado media de Ae. albopictus C6/36 células 8 días post-infección puede utilizarse como controles positivos para reacciones ZIKV RT-LAMP.
  4. Para los mosquitos Ae. aegypti : utilizar cualquiera de los dos cadáveres de mosquitos entero fresco o congelado. Descongelar los mosquitos congelados en el hielo. Prepare un mosquito crudo lisado colocando un mosquito individual en 100 μl de solución salina tamponada con fosfato (PBS) y homogeneizar por aplastamiento el mosquito 10 veces con una punta de pipeta P10 (figura 1). Centrifugar brevemente el lisado para que sedimenten los residuos del crudo. Usar el sobrenadante para el análisis de RT-LAMP aguas abajo.
    Nota: Controles positivos pueden generarse en un entorno de laboratorio por infectar a los mosquitos hembras mediante microinyección intratorácica con aproximadamente 103 equivalentes de genoma del virus en un volumen de 200 nL y cosecha el mosquito 5 días infección posterior.

3. prepare la mezcla maestra RT-LAMP

  1. Preparar una reacción de RT-LAMP mix master en hielo para cada cartilla a utilizar por medio de guía de volumen en la tabla 3.
    Nota: El uso de termolábiles Uracil ADN glicosilasa (UDG) ayuda a prevenir falsos positivos.
  2. Vortex brevemente para asegurar que todas las muestras estén bien mezcladas, luego girar por brevemente para evitar la pérdida de volumen.

4. RT-LAMP ensayo

  1. Pipeta 23,0 μL de la mezcla principal de RT-LAMP por reacción en un tubo PCR de 200 μl. Añada 2.0 μL de muestra (orina, suero o sobrenadante lisado crudo mosquitos como se describe en el paso 2). Esto traerá el volumen total a 25.0 μL por reacción de RT-LAMP. Para el control negativo, use agua de grado molecular. Incluir un control positivo.
    Nota: Una polimerización en cadena estándar o el virus de las poblaciones de sobrenadante de células infectadas pueden ser utilizado como control positivo.
    1. Opcional: Incluyen una reacción de control de la especificidad de un arbovirus relacionados como el virus del dengue (DENV). Preparar la muestra como se indica en el paso 2 según tipo de muestra. Añada 2.0 μL del control especificidad a 23.0 μL de la mezcla principal de RT-LAMP en un tubo PCR de 200 μl.
  2. Calentar las muestras a 61 ° C por 30 min con un bloque de calor, baño de agua o termociclador.
  3. Calor desactiva la polimerasa por calentamiento a 80 ° C durante 10 minutos.

5. RT-LAMP análisis

Nota: Realizar el análisis de RT-LAMP en un espacio independiente, cerrado.

  1. Después de la incubación, para acceder a las reacciones de RT-LAMP visualmente en busca de la presencia de un cambio de color.
    1. Diluir el ácido nucleico fluorescente tinte 1:10 en Tampón TAE (40 mM Tris, ácido acético de 20 mM, 1 mM EDTA).
      PRECAUCIÓN: Cualquier mancha de ácido nucleico se une a los ácidos nucleicos y por lo tanto es un agente carcinógeno. Use guantes cuando maneje.
    2. A 12 μl de la reacción de RT-LAMP, añadir 2 μl de dilución de colorante fluorescente de ácidos nucleicos.
      Nota: Las reacciones negativas es color anaranjado y reacciones positivas será amarillo-verde en color.
    3. Opcional: Tomar fotos de las reacciones de RT-lámpara sobre un fondo blanco con una cámara.
  2. Coloque las muestras en 302 nm UV luz para confirmar la presencia de productos de RT-lámpara de fluorescencia. Tomar fotografía del resultado del uso de una cámara.
    Nota: Las reacciones de RT-LAMP positivo tendrá una salida fluorescente.
    PRECAUCIÓN: Use protector de cara o gafas de protección ocular UV cuando se trabaja con luz UV.
  3. Opcional: Confirmar la presencia de productos de RT-LAMP al realizar la electroforesis en gel de las muestras.
    1. Vierta un gel de agarosa al 2% en 1 buffer de x TAE con una mancha de ácido nucleico para la visualización.
      PRECAUCIÓN: Cualquier mancha de ácido nucleico se une a los ácidos nucleicos y por lo tanto es un agente carcinógeno. Use guantes cuando maneje.
    2. Añadir 5 μl de una escalera de DNA en el primer carril para comparar los pesos moleculares.
    3. Para cada reacción de RT-LAMP, mezcla 13 μl de mezcla de reacción RT-LAMP con 2 μl de ADN carga del tinte. Carga de la mezcla de 15 μl que contiene el ADN carga del tinte.
    4. Correr el gel en 90 V durante 90 minutos o hasta que las bandas se separan y la imagen con la luz de UV de 302 nm.
      Nota: Las reacciones de RT-LAMP positiva tendrá un patrón escalonado. Las reacciones de RT-LAMP negativas no deben contener cualquier bandas.

6. eliminación de desechos

  1. Deshacerse de las reacciones de RT-LAMP en doble bolsas selladas. No autoclave como esto puede transformar los productos de RT-LAMP, conduciendo a falsas reacciones positivas en el futuro.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Las reacciones de RT-LAMP pueden analizarse utilizando tres métodos diferentes. En primer lugar, con la adición de un colorante fluorescente de ácidos nucleicos, reacciones positivas será color amarillo/verde que reacciones negativas aparece naranja en color a simple vista. En segundo lugar, la adición de colorante fluorescente de ácidos nucleicos a la reacción de RT-lámpara produce una señal fluorescente cuando las muestras son excitadas por la luz UV. Las reacciones negativas no tendrá una señal fluorescente detectable sobre cualquier fluorescencia de fondo que puede estar presente en pequeñas cantidades en el control negativo. Por último, las reacciones de RT-LAMP pueden funcionar hacia fuera en un gel de agarosa. Reacciones positivas del RT-lámpara tendrá un patrón de bandas, mientras que las reacciones negativas tendrá no hay bandas de ADN. Ejemplos de este uso de los tres de estos métodos de análisis se demuestran en la figura 2 y 3. Ninguna de estas muestras tenían ARN aislado antes de RT-LAMP. Figura 1 muestra el aplastamiento de un mosquito todo en PBS, que es suficiente para el uso en la reacción de RT-LAMP. En la figura 2, se demuestra la especificidad de la reacción de RT-LAMP ZIKV: sólo el control molecular ZIKV, no el control molecular de DENV o control negativo, tiene una positiva reacción de RT-LAMP. Además, ZIKV se detecta en la orina y el suero de un paciente con la infección ZIKV conocida, pero no en el paciente asintomático control sin infección por ZIKV (figura 2A). Figura 2B, las muestras se analizan para humanos 18s rRNA utilizando RT-LAMP. Sólo las muestras de los pacientes (orina o suero), pero no los controles moleculares o el control negativo, son positivas para el 18s rRNA. Por lo tanto, 18s rRNA RT-LAMP puede utilizarse como un control de calidad para las reacciones de RT-LAMP para las muestras de pacientes humanos. Mosquitos puede ser igualmente muestras por ZIKV o el RT-lámpara control de calidad, AEDAE (figura 3). En este ejemplo, el control molecular positivo por ZIKV como el mosquito infectado por ZIKV son positivas para ZIKV. El control negativo, el control molecular para DENV, la mofa de infectados mosquito (mosquito microinyectado con los medios de cultivo celular que contenga ningún virus) y el mosquito DENV infectado son todos negativos por ZIKV (figura 3A). Sin embargo, los mosquitos son positivos para AEDAE por RT-LAMP (figura 3B).

Cuando sea posible, los tres métodos analíticos deben utilizarse para confirmar una reacción positiva o negativa como a veces la señal fluorescente puede ser débil y algunos individuos pueden ser de color ciego, haciendo difícil determinar el cambio de color visual. En caso de que el control negativo positivo, el conjunto de muestras analizadas no es válido como contaminación y por lo tanto no se puede descartar falsos positivos. En casos donde el control positivo es negativo, el conjunto de muestras es válido como la reacción de RT-LAMP no puede haber trabajado. Se trata de una lectura cualitativa hacia fuera, sin embargo, resultará más copias del virus en un aumento en los productos de RT-LAMP que se aprecia por la intensidad fluorescente o por la intensidad del patrón de bandas de ADN por electroforesis en gel.

Figure 1
Figura 1 : Preparación de crudo mosquito lisado. (A) Coloque un mosquito en 100 μl de PBS en un tubo de microcentrífuga. (B) usando una punta de pipeta P10, aplastar los mosquitos contra los lados del tubo 10 veces. (C) esto produce un lisado crudo que debe ser hecho girar hacia abajo brevemente en una centrífuga de mesa para que sedimenten residuos. Debe utilizarse sólo el sobrenadante para la reacción de RT-LAMP. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : ZIKV y 18S rRNA RT-LAMP en muestras de suero y orina paciente. Muestras de orina o suero de un paciente asintomático control (C01) o ZIKV infectado paciente (Z01) fueron sometidas a un ZIKV (A) o reacciones de RT-LAMP específicas 18S rRNA (B). Las reacciones de RT-LAMP fueron visualizadas después de la adición de un ácido nucleico fluorescente tinte por fluorescencia de ojo (panel superior), verde (panel central), o gel de electroforesis (panel inferior). Carril M: marcador total de ADN; NTC: Ninguna plantilla control (control negativo); ZIKV: ZIKV PCR estándar positivo de control; DENV: Control positivo DENV. Haga clic aquí para ver una versión más grande de esta figura. 

Figure 3
Figura 3 : ZIKV y AEDAE RT-lámpara en AE. aegypti . Solo Ae. aegypti infectados con control simulado, ZIKV o DENV sufrieron ZIKV (A) o reacciones de RT-LAMP específicas AEDAE (B). Las reacciones de RT-LAMP fueron visualizadas después de la adición de un ácido nucleico fluorescente tinte por fluorescencia de ojo (panel superior), verde (panel central), o gel de electroforesis (panel inferior). Carril M: marcador total de ADN; NTC: Ninguna plantilla control (control negativo); ZIKV: ZIKV PCR estándar positivo de control; DENV: Control positivo DENV. Haga clic aquí para ver una versión más grande de esta figura. 

Blanco Cartilla de Secuencia (5' - 3')
Homo sapien 18S rRNA 18SrRNA-FIP *
18SrRNA-BIP *
18SrRNA-F3
18SrRNA-B3
18SrRNA-LF
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-BIP *
ZIKV-F3
ZIKV-B3
ZIKV-LF
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
AE. aegypti actina Ae21-FIP *
Ae21-BIP *
Ae21-LF
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* Cebadores deben ser purificados por cromatografía líquida rápida de alto rendimiento (HPLC). Para todas otras cartillas, condiciones estándar de la desalación son suficientes.

Tabla 1: secuencias de la cartilla para las reacciones de RT-LAMP. Secuencias de la cartilla son descritas originalmente en la publicación anterior6.

Volumen (μL) Cartilla de Concentración común (μm) Concentración final (μm)
80 Primer interno hacia adelante (FIP) 100 16
80 Primer interno hacia atrás (BIP) 100 16
10 Primer externo delantero (F3) 100 2
10 Primer externo hacia atrás (B3) 100 2
20 Lazo hacia adelante (LF) 100 4
20 Lazo hacia atrás (LB) 100 4
280 agua grado molecular - -
500 Total

Tabla 2: preparación de 10 x RT-LAMP Primer Mix. El primer RT-LAMP para Ae. aegypti actina no contiene una cartilla BF; reemplazar este volumen con agua.

1 x volumen (μL) Componente Concentrado final Para 25 μl volumen
2.5 10 x Buffer de amplificación isotérmica 1 x
1.8 100 mM dU/A/T/C/GTPs 1.4 mM
2.0 100 mM MgSO4 6 mM + 2 mM en buffer = 8 mM [4-10 mM gama]
2.5 Cartillas de x 10 1,6 ΜM FIP/BIP, 0,2 ΜM F3/B3, 0,4 ΜM FL/BL
1.0 termófila polimerasa de la DNA con la dislocación del filamento (8.000 U/mL) 8 U
0.5 De la transcriptasa reversa (15.000 U/mL) 7.5 U
0.5 UDG (1.000 U/mL) 0.5 U
12.3 agua grado molecular -
23.0 Total

Tabla 3: Preparación de RT-lámpara Master Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El ensayo de ZIKV RT-LAMP descrito en este papel los trabajos utilizando muestras de humanos y mosquitos6. El límite de detección fue de aproximadamente 1 genoma equivalente6, que debería ser suficiente ya que la carga viral típica de un paciente sintomático ZIKV infectado es de 103  PFU/mL6 107. Además, este método puede detectar ZIKV en muestras sin primer RNA aislamiento y sin amplificación del virus en cultivo celular. Esto reduce significativamente el tiempo, costo y riesgos para la salud de este ensayo en comparación con la qRT-PCR.

Las muestras de orina en la relación de volumen que se indican en este protocolo deben permitir que las reacciones de RT-LAMP que ocurra sin un aislamiento de RNA. Mientras que teóricamente uno podría aumentar la cantidad de muestra utilizada en una reacción de RT-LAMP, se debe tener cuidado cuando esta muestra es orina. La orina contiene múltiples sustancias químicas que pueden inhibir reacciones de PCR; urea en la orina se sabe para degradar polimerasas8 y usando una proporción orina/RT-LAMP reacción alta evitará la reacción de RT-LAMP. Si se espera una baja cantidad de virus, sería mejor realizar un aislamiento de RNA utilizando un kit específico para la orina. Del mismo modo, suero puede contener inhibidores de la polimerización en cadena que pueden inhibir la RT-LAMP cuando el suero se utiliza en un mayor volumen8.

Incluido en este protocolo es la inclusión de controles de calidad para las reacciones de RT-LAMP, similar a un control de carga en western blot protocolos. Si una muestra clínica es negativa para el RT-lámpara control de calidad, entonces una reacción negativa por ZIKV RT-LAMP puede ser un falso negativo la muestra contienen una alta cantidad de inhibidores de la PCR o cantidades bajas de ARN total. No es necesario aislar el RNA de la muestra antes del ensayo de RT-LAMP. Los resultados de RT-LAMP representante en este protocolo se obtuvieron sin aislamiento de RNA. Sin embargo, aislamiento de RNA puede mejorar la detección en muestras con carga baja de virus o que pueden contener niveles altos de inhibidores de PCR. Para más tipos de muestras, incluyendo suero, un kit de aislamiento de RNA puede utilizarse siguiendo el protocolo sugerido del fabricante. Para muestras de orina, debe utilizarse un kit de aislamiento de RNA específico para las muestras de orina. Para las muestras de mosquitos, se recomienda para lisar el mosquito ejecutando el mosquito en 100 μl de PBS a través de una columna de trituración durante 2 min a velocidad máxima o douncing antes de aislamiento de RNA. RNA se eluyó en 30 μl de tampón de elución y almacenado a-80 ° C hasta su uso.

Aislamiento de RNA entonces se sugiere eliminar los inhibidores endógenos de la PCR o concentrar el ARN antes de RT-LAMP. Si RT-lámpara control de calidad sigue siendo negativo, qRT-PCR debe utilizarse para la detección de ZIKV.

Los iniciadores de la RT-LAMP en este protocolo se han confirmado para trabajar en un rango de temperaturas (57 – 65 ° C) y la incubación veces (8-60 min), así como de uso no convencional de calefacción fuentes (e.g., calentador de raciones sin llama, baño de agua) fuera de norma condiciones de laboratorio. Todas las temperaturas probadas dieron resultados comparables. Basado en la detección de cambio de color visual solamente, el momento óptimo para la detección de productos ZIKV RT-LAMP fue 30 minutos. Sin embargo, la detección de bandas patrones en geles o excitación luz UV fueron positivos con tan sólo 8 minutos de tiempo de incubación en total. Algunos protocolos de RT-LAMP incluyen DMSO, pero en este protocolo, puede resultar en la inhibición de la reacción de RT-LAMP. Utilizando una polimerasa de la DNA termófila que se puede configurar a temperatura ambiente puede tener ventajas sobre el tipo salvaje termófila ADN polimerasa incluyendo más rápido de la amplificación de señales y aumentaron estabilidad a temperatura ambiente9,10 . Bromuro de etidio se puede utilizar para la visualización de ácidos nucleicos en geles de agarosa al 2%, sin embargo, otros colorantes fluorescente de ácidos nucleicos para geles de agarosa tienen menor potencial mutagénico, haciéndolos una opción más segura. Sin embargo, todavía se recomienda las precauciones de seguridad adecuadas como el uso de guantes.

Una limitación de este protocolo es que es cualitativo y no una técnica cuantitativa, sin embargo, la cuantificación relativa es posible6. Además, RT-LAMP cartillas son altamente específicas y fueron diseñados contra una secuencia altamente conservada de la proteína no estructural 5 de ZIKV que es encontrado en las 16 cepas y verificado en al menos 5 cepas6. Es posible que mutaciones extensas a ZIKV en la naturaleza pueden no ser detectables por estos iniciadores en el futuro. Otros grupos también han desarrollado nuevas tecnologías para la detección de ZIKV que puede ser de interés11,12,13,14,15,16,17 .

En Resumen, este protocolo proporciona un método rápido, simple y rentable para ZIKV en una variedad de tipos de muestras que no requieren equipo especializado. Esto proporciona una nueva herramienta de diagnóstico para la detección de ZIKV que RNA no debe ser aislado antes de la reacción de RT-LAMP.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL y MBC tienen propiedad intelectual sobre los métodos de diagnóstico de virus Zika. Los autores restantes tienen intereses que compiten.

Acknowledgments

Este trabajo fue apoyado por la contribución filantrópica familia Maureen y Ronald Hirsch y campo Instituto de Neurociencias, Santa María de Michigan. Los fundadores no tenían ningún papel en el diseño del estudio, recopilación de datos y análisis, publicación o preparación del manuscrito. También agradecemos a Dr. Bernadette Zwaans y Elijah Ward por su revisión crítica del manuscrito.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
Revertir el ensayo de amplificación isotérmica mediada por el lazo de transcripción (RT-LAMP) para el Virus Zika y Housekeeping Genes en muestras de mosquitos, suero y orina
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter