Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Immunisation des alpaga (Lama pacos) avec les antigènes protéiques et de la Production d’anticorps spécifiques de l’antigène unique

doi: 10.3791/58471 Published: January 26, 2019

Summary

Une méthode pour la production d’anticorps à domaine unique d’alpagas, vaccination, prélèvement sanguin, isolement de cellules B, et sélection est décrite.

Abstract

Dans ce manuscrit, une méthode pour la vaccination d’alpaca et de l’utilisation de méthodes de biologie moléculaire à produire des anticorps spécifiques de l’antigène unique domaine est décrit et a démontré. Camélidés, tels que les alpagas et de lamas, sont devenus une ressource précieuse pour la recherche biomédicale car ils produisent un nouveau type d’anticorps seule chaîne lourde, qui peut être utilisé pour produire des anticorps à domaine unique. Parce que le système immunitaire est très flexible, anticorps à domaine unique est possible à de nombreux antigènes protéiques différentes et même différentes conformations de l’antigène, avec un très haut degré de spécificité. Ces fonctionnalités, entre autres, faire des anticorps à domaine unique un outil précieux pour la recherche biomédicale. Une méthode pour la production d’anticorps à domaine unique d’alpagas est rapportée. Un protocole de vaccination, prélèvement sanguin et l’isolement de cellules B est décrite. Les lymphocytes B sont utilisés pour la construction d’une bibliothèque immunisée, qui sert à la sélection des anticorps à domaine unique spécifique via panoramique. Anticorps putatif spécifique domaine unique obtenus via panoramique sont confirmées par le menu déroulant, ELISA, ou gel-décalage. Les anticorps de domaine unique qui en résulte permet alors soit directement, soit dans le cadre d’un réactif machiné. Les utilisations de l’anticorps à domaine unique et de domaine unique axée sur les anticorps Régents incluent des applications structurelles, biochimiques, cellulaires, in vivo et thérapeutiques. Anticorps à domaine unique peuvent être produits en grande quantité, comme des protéines recombinantes dans des systèmes d’expression procaryote, purifié et utilisés directement ou peut être conçue pour contenir des marqueurs spécifiques ou l’étiquette peut être utilisé comme reporters dans les études cellulaires ou diagnostics.

Introduction

Alpagas et autres membres de la famille des camélidés, sont devenus une source populaire pour la production d’anticorps pour la recherche biomédicale1,2,3. Camélidés ont un système immunitaire unique en ce qu’ils produisent les anticorps normaux ainsi que lourde chaîne anticorps seuls qui permettent la production d’anticorps de domaine unique beaucoup plus petites, tout en conservant une spécificité élevée et haute affinité. Ainsi, camélidés anticorps fournissent un réactif polyvalent utile pour une variété d’usages. Une méthode pour immuniser alpaga et de produire des anticorps à domaine unique à une variété d’antigènes protéiques est décrite ici. Ces anticorps peuvent être produites en camélidés grâce à un procédé relativement simple qui ne nécessite que la vaccination par l’intermédiaire de petites injections de la protéine cible (antigène) et un tirage au sort de sang4. Par la suite, construction de la bibliothèque, M13 phage display5 et panoramique contre l' antigène recombinant6 sert à isoler et à produire des anticorps à domaine unique avec les caractéristiques souhaitées. Parce que le processus tire parti de la puissance de la technologie d’affichage bactériophage, cinq ou plusieurs antigènes peuvent être utilisés simultanément par animal, réduisant ainsi le nombre d’animaux utilisés et des coûts connexes.

Typiques chez les mammifères anticorps ou immunoglobulines sont de grosses molécules consistant en deux types de chaînes (2 chaînes légères et 2 chaînes lourdes), qui sont reliés entre eux par l’intermédiaire de liaisons disulfide. Ces anticorps sont relativement grandes, présentant des poids moléculaires de ~ 140-190 kDa pour IgG le plus abondant de l’homme, souris, chèvres et lapins. En raison de leurs multiples sous-unités, poids moléculaire élevé et ponts disulfures, immunoglobulines peuvent être assez difficiles à produire en grandes quantités, rendant leur coût élevé. Dans les années 1990, on a découvert que les camélidés, qui comprend des chameaux, lamas et alpagas font, en plus de l’immunoglobuline de type mammifère typique, une nouvelle forme d’immunoglobuline qui est plus simple en structure, possédant des chaînes lourdes seulement7. Ces anticorps camelid uniques possèdent la même capacité de lier spécifiquement avec une haute affinité des substances étrangères mais sont seulement composés d’une protéine chaîne8. En outre, camélidés anticorps peuvent être expérimentalement tronqués à un fragment d’unité la VHH encore plus petit, également appelé un domaine unique anticorps9. En raison de leur petite taille, anticorps à domaine unique sont utiles pour un large éventail d’applications de la recherche biomédicale et sont disponibles à partir d’une variété de sources académiques et commerciaux1,10. Une exception semble être éponger occidental car seul domaine anticorps sont plus souvent dirigés contre les épitopes dépendant de conformation, qui sont généralement perdues dans les conditions de dénaturation utilisées dans les transferts Western.

Puisqu’ils sont constitués d’une seule chaîne polypeptidique, anticorps spécifique de domaine unique peuvent être sélectionnés et facilement produites en grandes quantités sous forme de protéines recombinantes dans les bactéries. Anticorps à domaine unique peuvent également être génétiquement modifiées afin qu’il contienne des marqueurs spécifiques ou l’étiquette peut être utilisé comme « groupes de journaliste » pour le diagnostic des maladies,11. Cette facilité de manipulation couplée à leur souplesse d’utilisation rend anticorps à domaine unique une ressource importante pour les chercheurs dans les universités et ailleurs.

Comme partie d’un National Institutes of Health prise en charge de base, les méthodes existantes ont été adaptés pour produire des anticorps à domaine unique des alpagas3,4. Les alpagas ont des avantages significatifs dans les deux facilité de manipulation par rapport à plus grands camélidés membres de la famille ainsi que l’accessibilité. Les alpagas sont largement élevés pour la viande et les fibres et ainsi peuvent être obtenus au niveau régional auprès des agriculteurs locaux alpaga, qui peuvent être identifiées par le biais de leurs sites Web ou associations éleveur Etat. Il existe deux races d’alpagas, Suri et Huacaya. Huacaya sont plus fréquente et ont été utilisées pour ce protocole, mais le protocole est généralement applicable aux deux races et aussi plus largement applicables aux autres camélidés.

Protocol

Toutes les procédures avec les alpagas ont été réalisés conformément aux protocoles (2627-2017 et 2018-2925) approuvés par l’Université du Kentucky institutionnels et animalier utilisation Comité (IACUC).

1. production d’anticorps spécifiques de l’antigène Alpaca

  1. Gestion d’alpaga et considérations générales
    1. Obtenir l’approbation institutionnelle et/ou réglementaire appropriée.
    2. Obtenir des alpagas adultes, moins de 10 ans avec un corps condition score d’au moins 3,0 (échelle 1-5)12. Parce qu’ils sont les animaux du troupeau, la maison un minimum de deux mais de préférence trois animaux ensemble.
      Remarque : Les mâles sont recommandés car, en général, ils ont un tempérament plus uniforme et plus faciles à travailler avec.
    3. Vérifier l’état de santé des animaux à travers un examen vétérinaire, y compris l’examen du régime alimentaire, le logement, la vaccination et le parasite contrôle programmes13. Veiller à ce que les animaux sont à jour avec les vaccins appropriés à la région géographique locale fondée sur les recommandations professionnelles de vétérinaires. Élaborer un programme de contrôle d’ecto - et endoparasite en consultation avec un vétérinaire fondée sur un examen de l’histoire du troupeau d’origine et les conditions locales spécifiques,13.
    4. S’acclimater pendant au moins une semaine, y compris la formation de licol et l’exposition à la retenue.
    5. Prélever un échantillon de sang de 4 mL pour obtenir le sérum destiné à un contrôle avant la vaccination (voir étape 1.4). Geler les sérums et les conserver à-20 ° C en aliquotes de 0,5 mL.
      Remarque : En ce temps, sang supplémentaire peut être prise pour une analyse complète des globules (CBC) surveiller l’état de santé initial des animaux.
  2. Préparation de l’antigène
    1. Préparer les antigènes de protéines purifiées dans une solution saline tamponnée au phosphate (PBS) ou une solution saline tamponnée HEPES (HBS) et se concentrer à ≥ 1 mg/mL. Il faut environ 3 mg de protéine pour le protocole complet, y compris la vaccination, panoramique et confirmation de clones.
      Remarque : Anticorps de camélidés affichent grande spécificité et sélectivité contre les antigènes protéiques mais ne sont généralement pas bien adaptés pour des protéines non structurés ou antigènes peptidiques qui sont généralement non structurées.
    2. Pureté de l’antigène, avec une pureté > 90 % désiré. Utiliser une méthode d’analyse tels que SDS-PAGE.
      Mise en garde : Contamination importante avec d’autres protéines peut conduire à des problèmes lors de la sélection où les anticorps à domaine unique peuvent être isolés de contaminants plutôt que de la protéine cible.
    3. Préparer des aliquotes congelés d’antigène qui contient un total de 100 µg d’antigène. 50 µL d’une préparation de 2 mg/mL est idéal. 100 µL de 1 mg/mL est la solution de protéines plus diluée appropriée pour la vaccination. Par ailleurs, si l’antigène ne peuvent pas subir de gel/dégel et est considérée comme stable à long terme de solution, il peut être conservé à 4 ° C.
      Remarque : Afin d’assurer que l’antigène peut subir un cycle de gel/dégel, test qu'une quantité de 20 µL de l’antigène devrait être distribuée dans une mince paroi tube PCR et snap congelés dans l’azote liquide. Décongeler le tube, d’exécuter la centrifugation à haute vitesse et vérifier la récupération quantitative en comparant l’absorption d’UV/VIS avant et après la congélation ou en exécutant un gel SDS-PAGE. Si c’est possible, l’antigène doit également être testé pour le maintien de l’activité biologique. Si le cycle de gel dégel est réussi, l’antigène restant est clin d’oeil gelé dans 100 µL d’extraits et conservés à-80 ° C. S’il y a des problèmes avec le cycle de gel/dégel, le protocole peut être répété avec l’ajout de jusqu'à 20 % de glycérol.
  3. Vaccination
    1. Mélanger jusqu'à cinq antigènes, 200 µg chaque, avec adjuvant dans un volume final d’entre 300 à 1 000 µL. L’adjuvant devrait constituer ≥50 % du volume final utilisant l’eau comme le diluant.
      Remarque : Si le tampon est nécessaire, utilisez HEPES, MOPS ou la glycine. Un pH compris entre 5 et 6 s’est souvent avéré pour être plus favorable que strictement neutre. Évitez les ions polyvalents tels que le phosphate ou le citrate, car ils peuvent provoquer la coagulation.
    2. Couper les cheveux de l’alpaga avec une tondeuse électrique, en forme de croissant de lune le long de son cou épaule à épaule pour exposer les régions adjacentes aux proue des ganglions de la base.
    3. L’alpaga en tenant par le cou, injecter lentement l’antigène sous la peau le long de la base du cou près des proue ganglions lymphatiques à l’aide d’une aiguille de 22 G. Effectuer cinq injections de ~ 200 µL (ou moins) ~ 5 cm de distance.
      Remarque : Les animaux devraient être freinée par un deuxième membre du personnel pendant les injections. Injection et saignements alpagas appelle à la prudence car elles sont sujettes aux coups de pied, pas juste par derrière, mais sur le côté. Avoir les animaux proches entre eux, dans un groupe, lors de la procédure est optimale. Étant donné qu’ils sont les animaux du troupeau, ils sont plus calmes dans un groupe et moins vigoureux retenue est nécessaire pendant les procédures.
    4. Surveiller les animaux pour ~ 20 min après injection des signes d’anaphylaxie (voir étape 1.6). Moniteur pour inflammation localisée sur les sites d’injection hebdomadaire, qui ne devrait pas lors de l’utilisation de l’adjuvant recommandé. Veiller à ce que la fuite de sang du site d’injection n’est pas excessive.
    5. Effectuer cinq injections boosting ultérieures par semaine à l’aide de 100µg de chaque antigène dans le mélange. Tondre les cheveux sur les sites d’injection peut être exigée par semaine selon la saison. En automne et en hiver, les cheveux de l’animal peut se développer rapidement.
  4. Sang d’encre
    1. Clip et désinfecter le site de collection avec des tampons d’alcool.
    2. Retenir l’animal doucement avec le cou qui s’est tenue debout et droite.
      Remarque : Les animaux peuvent être immobilisés manuellement comme montré dans la vidéo. Si disponible, utiliser une goulotte d’alpaga pour retenir les alpagas lors de saignements et des injections peuvent faciliter la manutention. Pour utiliser une goulotte d’alpaga, licou alpagas sont dirigés dans la goulotte et sobre avec barres de cou et bracelets avec blocages. Versions de la goulotte d’alpaga sont disponibles auprès de fournisseurs commerciaux.
    3. En utilisant la projection ventrale de l’apophyse transverse des vertèbres comme un point de repère, occlure la veine en appliquant une pression juste médiale du processus ventrale.
      Remarque : Il n’y a aucun sillon jugulaire distincte en alpaga adulte. Les veines jugulaires sont protégés par les saillies ventrales des processus transverses vertébrales. Cette peau épaisse (p. ex., 1 cm d’épaisseur « disputent plaque » le 1/3 moyen du cou chez les mâles) et la musculature de la nuque, il est difficile de visualiser ou de palper la veine jugulaire lui-même. Par la suite, l’utilisation des points de repère vertébrales est les indicateurs très utiles pour emplacement jugulaire.
    4. Insérer l’aiguille à un angle de 45° légèrement médial (~ largeur de doigt) pour la projection vers le centre de la nuque. Manipuler l’aiguille jusqu'à ce que le sang coule.
      Remarque : La veine jugulaire et l’artère carotide sont rapprochées. Le sang veineux peut être tout à fait rouge en couleur mais est encore plus sombre que le sang artériel. Suite à la collection, la pression doit être appliquée au site de 0,5 à 1 min (ou plus longtemps si la carotide est accessible) jusqu'à ce que l’hémostase est assurée.
    5. Dessiner 4 à 10 mL de sang aux fins d’analyses. Utiliser un 1,5 pouce, aiguille 20 G généralement en conjonction avec une seringue de taille appropriée ou le tube de prélèvement de sang. Utiliser les tubes haut K2EDTA de lavande pour recueillir le sang lors de l’épuration des lymphocytes. Utiliser des tubes de séparation de sérum albums or (BD) lors de la collecte du sang pour la production de sérum.
    6. Attirer 50-100 mL de sang à des fins de production. Utiliser une extension de perfusion supplémentaire de 12 pouces serti d’une perfusion de 19-20 G ailé « papillon ».
      Remarque : Une configuration set extension permet un assistant remplir plusieurs tubes de prélèvement sanguin, ce qui permet du venipuncturist de se concentrer sur la stabilisation de l’aiguille de la collection. L’addition de l’ensemble de perfusion peut accueillir un mouvement potentiel de l’animal (3-5 min procédure) et donne une distance de travail confortable pour les opérateurs.
  5. Immunitaire de surveillance
    1. Trois ou quatre jours après les 3rd et 5ème injections, effectuer une purge de petit test de chaque animal pour obtenir sérums pour le test. Congeler et stocker les sérums en aliquotes de 0,5 mL. Obtenir des échantillons de sang supplémentaire dans le même temps de surveiller la santé de l’animal, tel que discuté ci-dessus.
    2. Confirmer la présence d’anticorps spécifiques de l’antigène par ELISA utilisant les sérums prélevés test saignements aux points de temps préalablement immunisée, trois semaines et cinq semaines. Il est préférable de prendre une purge finale tandis que le titre des anticorps augmente toujours.
    3. Générer des plaques d’affinité antigène à l’aide de la surfaces traitées plaques de 96 puits. Diluer à 0,1 µg de l’antigène dans un tampon de carbonate de sodium 100 mM, pH 9,0. Ajouter 100 µL de la solution dans chaque puits et incuber une nuit à 4 ° C. Les dix dilutions de chaque antigène sont testées en double exemplaire. Un contrôle à blanc est bien préparé qui est recouvert d’un tampon de carbonate seulement.
    4. Après l’incubation durant la nuit, inverser la plaque pour retirer le contenu des puits et laver trois fois avec 0,1 mL de PBS, 0,1 % de Tween 20 (PBS-T).
    5. Bloquer les puits en ajoutant 0,1 mL de BSA (5 mg/mL) en PBS-T et en incubant la plaque pendant 1 h à température ambiante.
    6. Laver les plaques trois fois avec PBS-T en pipettant également, la solution de lavage dans le puits puis supprimer la solution de lavage par l’inversion de la plaque.
    7. Préparer des dilutions en série double de 0,3 mL chacun des sérums préalablement immunisés et immunitaires dans le tampon PBS-T en utilisant une dilution de départ de 1/100 et jusqu’au 1/102, 400.
    8. Ajouter 100 µL de chaque dilution dans les puits et laisser pour incuber pendant 2 h à température ambiante.
    9. Retirez le sérum de chaque puits et laver avec 0,2 mL de PBS-T trois fois.
    10. Incuber à chacun bien avec 0,1 mL d’anticorps de type IgG anti-Lama chèvre HRP conjugué à une dilution de 1/20 000 pendant 1 h.
      Remarque : L’immuno-réaction mesurée inclut à la fois classiques ainsi que des anticorps seules chaîne lourde, qui sont présents dans des proportions approximativement égales en circulation3,14.
    11. Enlever la solution de l’anticorps et laver chaque puits avec 0,2 mL de PBS-T trois fois.
    12. Ajouter 100 µL de substrat chromogène de PEROXY dans le puits et incuber à température ambiante jusqu'à ce que l’intensité des deux points culminants concentration ont devenir saturé, qui dure entre 5-10 min.
    13. Ajouter 100 µL d’acide sulfurique 0,1 M à chaque puits pour arrêter la réaction.
    14. Mesurer l’absorbance de chaque puits à 450 nm en utilisant un lecteur de plaque.
    15. Reporter l’absorbance comme une concentration de fonction.
  6. Complications potentielles et de surveillance alpaga
    1. S’assurer que l’alpaga approprié suivi tout au long de la procédure.
      Remarque : Les procédures ne devraient pas causer des effets indésirables importants. Santé et bien-être des animaux doivent être surveillées quotidiennement par le personnel de l’élevage et/ou la recherche pendant alimentation et d’abreuvement. Tout animal avec unalleviated morbidité naturelle spontanée ou induite expérimentalement devrait être soumise à l’évaluation par les services vétérinaires avec traitements fournis le cas échéant, jusqu'à l’euthanasie humaine, si nécessaire.
      Des conséquences préjudiciables possibles associés à la phlébotomie sont des saignements, ecchymoses et hématomes. Les animaux doivent être surveillés pour 20 min poste sang tirage chercher les signes d’hémorragie. Une pression supplémentaire sur les sites doit être utilisée. Si le saignement ne s’arrête pas, un vétérinaire doit être contacté.
      Autres conséquences indésirables associés à des injections et des saignements incluent l’inflammation et la formation de granulome. Formation de granulome ne devrait pas et n’a pas été observée à l’Université du Kentucky. Injection site inflammation (rougeur ou enflure) pourrait se produire et doit être portée à l’attention d’un vétérinaire. La purge de production représente un volume de sang potentiellement important, et les animaux doivent être surveillés pour s’assurer qu’ils sont stables et actif après la collecte de sang.
      Anaphylaxie et réponses pyrogènes sont les deux conséquences préjudiciables graves plus probables, mais sont très rarement observés. Si elle devait se produire, anaphylaxie produirait peu de temps après l’injection de l’antigène et se manifester par une augmentation de la température rectale, faiblesse, vomissements, problèmes respiratoires, ou de diarrhée. La température rectale peut être surveillée après chaque injection, afin de déceler toute augmentation de la température corporelle. Si ceux-ci sont reconnus, prévenir un vétérinaire immédiatement pour une consultation. En outre, une trousse d’urgence « Crash » (p. ex., épinéphrine, corticoïdes et antihistaminiques) préparé en consultation avec un vétérinaire devrait être disponible pour traiter les animaux suspectés d’avoir un effet indésirable.

2. purification des Lymphocytes à domaine unique anticorps bibliothèque Construction

  1. Recueillir 50 mL de sang trois à cinq jours après la dernière injection (voir étape 1.4).
    Remarque : Un traitement rapide du sang et l’isolement de l’ARN sont importants obtenir une bibliothèque convenable taille15,3, qui est très important pour la réussite du panoramique.
  2. Diluer 15 mL de sang prélevé avec 5 mL de PBS.
  3. Utiliser un tube de séparation de lymphocytes pour isoler des lymphocytes du sang périphérique (LSP) par centrifugation en gradient de densité selon les suggestions de produits manufacturés.
    Mise en garde : Instructions du fabricant indiquent que jusqu'à 25 mL de sang peuvent être utilisés, mais cela peut saturer le système et éviter l’obtention d’une préparation propre lymphocytaire.
  4. Ajouter 5 mL de PBS prérefroidies à 4 ° C à PBL.
  5. Tournez pendant 20 min à 800 x g à 4 ° C.
  6. Laver deux fois en ajoutant 5 mL de PBS prérefroidies à 4 ° C à PBL suivie à la centrifugation pendant 20 min à 800 x g à 4 ° C.
  7. Isoler l’ARN total en utilisant un système de spin-colonne basée, selon les instructions du fabricant. Homogénéiser les cellules en vertexing dans un tampon approprié et application à un système de déchiquetage de biopolymère. Utilisez un nombre approprié de mini ou maxi-colonnes qui dépend de la cellule d’entrée.
  8. Synthèse de cDNA utilisant transcriptase inverse en combinant 10 µg d’ARN avec un mélange de 0,1 µg d’Oligo (dT) 12-18 amorces.
  9. Générer une bibliothèque de bactériophage à l’aide de méthodes reconnues4. Cela implique le clonage avec des enzymes de restriction dans le phage display vecteur pMES4 suivie de l’expression de l’insert fusionné au gène III du phage filamenteux pour la production de la solution du phage.

3. simple domaine anticorps panoramique

  1. Produire l’antigène affinité plaques sur la surface traitement plaques à 96 puits. Diluer 0,25 µg de l’antigène dans un tampon de carbonate de sodium 100 mM, pH 9,0. Ajouter 100 µL de cette solution dans chaque puits et incuber une nuit à 4 ° C. Enduire les deux puits par antigène. Préparer un contrôle à blanc bien qui est recouvert d’un tampon de carbonate seulement.
    Remarque : Plaques peuvent être produites et stockées pendant une semaine à 4 ° C si plusieurs cycles de sélection seront effectuées. En outre, cette méthode utilise absorption directe ne nécessitant pas de marquage tandis que d’autres méthodes utilisent biotinylation ou autres types de stratégies d’étiquetage.
  2. Incuber les plaques jusqu’au lendemain. Inverser pour supprimer le contenu des puits et laver trois fois avec 0,1 mL de PBS-T.
  3. Bloquer les puits en ajoutant 0,1 mL de BSA (20 mg/mL) dans du PBS et incuber la plaque pendant 2 h à température ambiante.
  4. Laver les plaques trois fois avec PBS-T suivie par trois fois avec du PBS. Antigènes peuvent également être étiquetés et utilisés dans les systèmes de capture comme, par exemple, les systèmes de streptavidine/biotine de façon covalente.
  5. Prétraitez la solution phage (100 µL) avec 100 µL de BSA 40 mg/mL dans du PBS sur une plate-forme vibrante à température ambiante pendant 30 min.
  6. Ajouter la solution de phage à l’antigène enduit puits et incuber à une agitation modérée pendant 2 h à température ambiante. Utilisez plusieurs puits afin d’assurer un total de 1011 phage pour chaque antigène.
  7. Jeter le phage indépendant par inversion et puis laver les puits cinq fois avec 200 µL de PBS-T suivie cinq fois avec du PBS.
  8. Éluer le phage lié en ajoutant 0,1 mL de trypsine de 0,25 mg/mL dans du PBS et incuber pendant 30 min à température ambiante sur la plate-forme vibrante à 700 tr/min.
  9. Transvaser la solution dans un flacon contenant 5 µL de solution de hydrochloride(AEBSF) 4 mg/mL 4-benzènesulfonyle fluorure pour étancher l’activité de la trypsine.
  10. La croissance de TG1 phage affichage cellules compétentes à 37 ° C sous agitation jusqu'à OD600 = 0,5.
  11. Ajouter 50 µL de phage éluée dans 3 mL de cellules TG1.
  12. Incuber à 37 ° C sans agitation pendant 30 min.
  13. Ajouter 7 mL de LB milieux enrichis avec de l’ampicilline 100 µg/mL, 2 % de glucose.
  14. Agiter pendant une nuit à 37 ° C.
    Remarque : Pour obtenir les plus divers anticorps de domaine unique, clones peuvent être séquencés, mis à l’essai pour les propriétés souhaitées et utilisés après un tour de panoramique. Pour obtenir la plus haute affinité anticorps à domaine unique, deux séries de panoramique doivent être utilisées.
  15. Plaque de la bactérie après qu’une nuit croissance sur gélose LB additionné de l’ampicilline 100 µg/mL, 2 % de glucose. Plusieurs dilutions successives devront être testés, commençant par deux dilutions, plaquant 100 µL de 1/10 000 et 1/100 000 des dilutions.
  16. Incuber la plaque pendant une nuit à 37 ° C.
  17. Prélever les colonies et l’inoculer les puits d’une plaque de 96 puits stérile contenant 100 µL de 2XYT avec 100 ampicilline µg/mL, 2 % de glucose, glycérol 10 % v/v / puits.
  18. Incuber une nuit à 37 ° C sans agitation.
  19. Le lendemain, agiter à 170 tr/min à 37 ° C pendant 60 min.
  20. Retirer 2 µL de médias dans des tubes PCR. Le reste de la solution peut être laissé dans l’assiette et stocké à 4 ° C pendant 1 à 2 jours ou congelé et stocké à-80 ° C pour une utilisation ultérieure.
  21. Effectuer la réaction de PCR utilisant des amorces appropriées pour le vecteur utilisé. Pour pMES4, dépistage de la PCR de clones positifs utilise des amorces qui entourent le site multiple de clonage est CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC et GGTGGTGTGAGGAGACGGTGACCTG. Utiliser les cyclistes des conditions appropriées pour la polymérase utilisée, une température de recuit de 57 ° C et 30 cycles.
  22. Analyser la réaction PCR en exécutant un gel d’agarose de 1 % (p/v). Les colonies qui sont positifs ont seul domaine anticorps gène insertions de ~ 500 BP. veiller à ce que les clones positifs sont 20 à 50 % de l’échantillon.
    Remarque : Cette méthode fournit un moyen de clone de sélection et analyse qui peut être effectuée dans la plupart des laboratoires de recherche. Sinon, séquençage de prochaine génération peut être appliqué et fournit de grands ensembles de données qui permettent l’analyse statistique et comparative,16.
  23. Ensemencer les clones positifs de la plaque douce tubes contenant 7 mL de LB avec de l’ampicilline 100 µg/mL.
  24. Grandir avec la secousse pendant une nuit à 37 ° C.
  25. Effectuer un miniprep sur la culture pour obtenir l’ADN de plasmide.
  26. La séquence des clones positifs en utilisant la norme séquençage apprêt pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC).
  27. Effectuer une analyse computationnelle sur des séquences d’anticorps domaine unique qui en résulte. S’assurer qu’il n’y a aucun codons stop ou cadre se déplace.
  28. Classer les séquences résultantes de similarité et de diversité. Les séquences qui sont identifiés à plusieurs reprises sont plus susceptibles d’être des séquences de liaison de haute affinité, particulièrement après deux tours de sélection.
  29. Exprimer l’anticorps seul domaine utilisant une souche dérivée BL21 expression du bobine e. Induire l’expression grâce à l’ajout d’IPTG, de plus en plus du jour au lendemain à 22 ° C.
  30. Purifier l’anticorps seul domaine à l’aide de la chromatographie d’affinité métallique immobilisée (IMAC).
  31. Valider la liaison d’anticorps/antigène domaine unique à un dosage d’interaction directe comme l’électrophorèse sur gel de menu déroulant, natif ou ELISA.
  32. Vérifier la performance des anticorps spécifiques à l’application de domaine unique, comme vous le souhaitez pour l’expérience spécifique.

Representative Results

Le protocole présenté ici a été utilisé pour générer des anticorps à domaine unique contre une gamme des antigènes protéiques. Cinq antigènes ont été utilisés par l’alpaga. La surveillance immunitaire a indiqué que la plupart des antigènes début de réponse robuste à trois semaines (Figure 1). Les saignements de production et de la construction de la bibliothèque après environ six semaines donne le meilleur équilibre pour les animaux qui ont plusieurs antigènes injectés. Deux séries de panoramique a eu lieu pour chaque antigène et isolés colonies criblées (Figure 2). Séquençage des colonies positives identifiées séquences anticorps divers domaine unique pour les différents antigènes. Pour obtenir des exemples, trois clones uniques ont été isolées à l’antigène de référence Maltose Binding Protein (MBP) (Figure 3 a). Comme on l’observe fréquemment, l’anticorps seul domaine contiennent la diversité des séquences significatives et longueur très variable CDR3 (Figure 3). Ces fonctionnalités sont particulièrement importantes dans les interactions anticorps/antigène domaine unique comme le montre la référence unique domaine anticorps/CX3CL1 complexe17 (Figure 3 b).

La majorité des séquences d’anticorps pleine longueur domaine unique peut être exprimée et purifiée au 1-10 mg/L de culture (Figure 4 a). En raison de la diversité en longueur CDR3, anticorps différents domaine unique montrent légère variation de poids moléculaire. Confirmation de la liaison directe et les performances des applications spécifiques est critique. Par exemple, après deux tours de sélection contre l’antigène B, un groupe de domaine unique, les anticorps ont été identifiés (Figure 2). Plusieurs séquences identiques ont été identifiées, et les anticorps à domaine unique a été produit et purifié. Il était ensuite testé par traction directe vers le bas avec de la résine d’affinité antigène et robuste liaison dose-dépendante (Figure 4 b). Ce qui est important, l’anticorps seul domaine a montré aucune liaison pour contrôler la résine. Ces résultats démontrent une interaction de liaison directe et qui est bien adapté pour la capture d’affinité en modes déroulant et par ELISA.

Figure 1
Figure 1 : Surveillance immunitaire représentatifs des deux antigènes distincts montrant la réponse immunitaire spécifique significative aux antigènes distincts chez le même animal. De nombreux antigènes montrent robuste réponse aussi tôt que trois semaines après la vaccination, en commençant par la majorité montrant la réponse maximale après six semaines. Six semaines également permettant la maturation d’affinité et est la durée recommandée pour la purge de la production et l’isolement de cellules B. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Confirmation basées sur la PCR clones positifs. Amorces enjambent le MCS du vecteur pMES4, et un clone de nanobody positif produit un amplicon de ~ 500 bp (marqués avec *). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Séquences spécifiques d’un antigène mettre en évidence la diversité des anticorps seul domaine de l’alpaga. (A) alignement de domaine unique sélectionnez anticorps séquences isolées pour MBP avec une référence unique domaine anticorps 4XT1, cadre et régions déterminant la complémentarité (Kabat) a mis en évidence ci-dessous. (B) Structure d’alpaga domaine unique anticorps 4XT1 lié à CX3CL1 (APB 4XT1), soulignant le rôle essentiel des CDR variable effectue une boucle dans la liaison de l’antigène spécifique. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : Purification et validation des anticorps seul domaine. (A) SDS-PAGE des anticorps à domaine unique IMAC purifiée, comparant les anticorps divers domaine unique. Différents poids moléculaires sont principalement en raison de la longueur variable de la boucle CDR3. Différents niveaux d’expression sont également observées, avec une minorité d’anticorps à domaine unique montrant les piètres rendements de protéine purifiée. (B) vérification de liaison directe à l’aide d’une affinité antigène déroulants. Liaison d’anticorps robuste domaine unique dose-dépendante est observée avec résine couplé à l’antigène, mais pas avec de la résine de contrôle. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Discussion

Tel que mentionné, la haute affinité et la spécificité des anticorps à domaine unique, combinée à leur expression facile et leur stabilité, rendent réactifs idéales pour les applications dans la recherche biomédicale, comme critiques réactifs biochimiques, outils de diagnostic, ou agents thérapeutiques18. Pour les applications commerciales, il y a certaines questions de propriété intellectuelle qui doit être considérée. En outre, anticorps à domaine unique peuvent être conçues pour contenir des marqueurs spécifiques ou des balises qui peuvent être utilisés comme reporters en essais cellulaires ou diagnostics. La clé de ces usages est la capacité à produire des anticorps contre les antigènes d’intérêt spécifique de domaine unique. Une méthode est décrite ici pour produire des anticorps à domaine unique à l’aide d’alpagas, qui produit une réponse immunitaire contre une grande variété d’antigènes protéiques. Considérations relatives à l’animal de manutention et de la conformité réglementaire sont décrits. Voici les clés du succès dans cette partie du processus.

Il existe des autres stratégies de production d’anticorps à domaine unique qui ne nécessitent pas la vaccination, mais plutôt utilisent des bibliothèques semi-synthétiques avec différents systèmes pour la sélection et l’optimisation itérative des affinités19,20 . Toutefois, l’avantage d’utiliser des bibliothèques provenant d’animaux vaccinés est la capacité d’isoler avec fiabilité les anticorps hautement enrichi, diversifié et de haute affinité de domaine unique. En outre, non seulement sont des variations de séquence significative observées, mais une majorité significative d’anticorps spécifiques seul domaine isolé avait uniques insertions et suppressions, particulièrement en CDR3.

En outre, seul domaine des anticorps peuvent être produits par un processus très simple qui ne nécessite que petites injections de l’antigène et après ce processus, les animaux peuvent être retournés dans le troupeau. À noter, l’animal peut être librement utilisé pour la production de fibres, mais doit être exclus de servir de viande (chaîne alimentaire humaine) en raison de l’utilisation des antigènes de test et non FDA approuvé adjuvant pour la production d’anticorps de domaine unique. Une fois la procédure terminée, les animaux doivent être surveillés pendant une semaine, un examen vétérinaire final, puis peuvent être retournés à leur ferme ou reposés pendant six mois avant un nouveau cycle de production d’anticorps de domaine unique.

Disclosures

DRS Whiteheart et Hersh sont à l’Université du Kentucky et exploiter un noyau au centre de médecine moléculaire qui produit des anticorps à domaine unique en alpaca comme un paiement à l’acte.

Acknowledgments

Ce travail a été soutenu par le National Institutes of Health (P30GM103486).

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Immunisation des alpaga (<em>Lama pacos</em>) avec les antigènes protéiques et de la Production d’anticorps spécifiques de l’antigène unique
Play Video
PDF DOI

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter