Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Alpacas (लामा pacos) का प्रतिरक्षण प्रोटीन एंटीजन और प्रतिजन-विशिष्ट एकल डोमेन एंटीबॉडी के उत्पादन के साथ

doi: 10.3791/58471 Published: January 26, 2019

Summary

alpacas से एकल डोमेन एंटीबॉडी के उत्पादन के लिए एक विधि, जिसमें प्रतिरक्षण, रक्त संग्रह, बी-सेल अलगाव, और चयन का वर्णन किया गया है.

Abstract

इस पांडुलिपि में, अल्पाका के प्रतिरक्षण के लिए एक विधि और आणविक जीवविज्ञान पद्धतियों के उपयोग के लिए प्रतिजन-विशिष्ट एकल डोमेन एंटीबॉडी का उत्पादन और वर्णन किया गया है. Camelids, जैसे alpacas और llamas, जैव चिकित्सा अनुसंधान के लिए एक मूल्यवान संसाधन बन गए है क्योंकि वे भारी श्रृंखला के एक उपंयास प्रकार का उत्पादन केवल एंटीबॉडी जो एकल डोमेन एंटीबॉडी का उत्पादन किया जा सकता है । क्योंकि प्रतिरक्षा प्रणाली अत्यधिक लचीला है, एकल डोमेन एंटीबॉडी कई अलग प्रोटीन एंटीजन के लिए बनाया जा सकता है, और यहां तक कि प्रतिजन के विभिन्न संरचनाओं, विशिष्टता के एक बहुत ही उच्च डिग्री के साथ. इन सुविधाओं, दूसरों के बीच में, एक डोमेन एंटीबॉडी जैव चिकित्सा अनुसंधान के लिए एक अमूल्य उपकरण बनाते हैं । alpacas से एक डोमेन एंटीबॉडी के उत्पादन के लिए एक विधि की सूचना दी है । प्रतिरक्षण, रक्त संग्रह और बी-सेल अलगाव के लिए एक प्रोटोकॉल का वर्णन किया गया है । बी-कोशिकाओं एक प्रतिरक्षित पुस्तकालय है, जो panning के माध्यम से विशिष्ट एकल डोमेन एंटीबॉडी के चयन में प्रयोग किया जाता है के निर्माण के लिए उपयोग किया जाता है । ख्यात विशिष्ट एकल डोमेन एंटीबॉडी panning के माध्यम से प्राप्त खींच-नीचे, एलिसा, या जेल शिफ्ट परख द्वारा की पुष्टि कर रहे हैं । परिणामस्वरूप एक डोमेन एंटीबॉडी तो या तो सीधे या एक इंजीनियर एजेंट के एक भाग के रूप में इस्तेमाल किया जा सकता है । एकल डोमेन एंटीबॉडी और एकल डोमेन एंटीबॉडी-आधारित रीजेंट्स के उपयोग में शामिल है संरचनात्मक, जैव रासायनिक, सेलुलर, vivo में, और चिकित्सीय अनुप्रयोगों । एकल डोमेन एंटीबॉडी prokaryotic अभिव्यक्ति प्रणालियों में रिकॉमबिनेंट प्रोटीन के रूप में बड़ी मात्रा में उत्पादित किया जा सकता, शुद्ध, और सीधे इस्तेमाल किया या विशिष्ट मार्करों या टैग कि सेलुलर अध्ययन में पत्रकारों के रूप में इस्तेमाल किया जा सकता है या में शामिल करने के लिए इंजीनियर जा सकता है निदान.

Introduction

Alpacas, और camelid परिवार के अंय सदस्यों, जैव चिकित्सा अनुसंधान1,2,3के लिए एंटीबॉडी पैदा करने के लिए एक लोकप्रिय स्रोत बन गए हैं । Camelids में एक अद्वितीय प्रतिरक्षा प्रणाली है कि वे दोनों सामांय एंटीबॉडी उत्पादन के रूप में के रूप में अच्छी तरह से भारी श्रृंखला केवल एंटीबॉडी जो बहुत छोटे एकल डोमेन एंटीबॉडी के उत्पादन की अनुमति है, जबकि उच्च विशिष्टता और उच्च समानता को बनाए रखने । इस प्रकार, camelid एंटीबॉडी एक बहुमुखी एजेंट प्रयोजनों की एक किस्म के लिए उपयोगी प्रदान करते हैं । अल्पाका छुटकारा करने के लिए एक विधि और प्रोटीन एंटीजन की एक किस्म के लिए एकल डोमेन एंटीबॉडी का उत्पादन यहाँ वर्णित है. इन एंटीबॉडी camelids में एक अपेक्षाकृत सरल प्रक्रिया है कि केवल लक्ष्य प्रोटीन (प्रतिजन) और एक रक्त4ड्रा के छोटे इंजेक्शन के माध्यम से प्रतिरक्षण की आवश्यकता के माध्यम से उत्पादित किया जा सकता है । इसके बाद, पुस्तकालय निर्माण, M13 फेज प्रदर्शन5 और रिकॉमबिनेंट प्रतिजन6 बनाम panning अलग और वांछित विशेषताओं के साथ एक डोमेन एंटीबॉडी का उत्पादन करने के लिए प्रयोग किया जाता है. क्योंकि इस प्रक्रिया फेज प्रदर्शन प्रौद्योगिकी की शक्ति का लाभ लेता है, पांच या अधिक एंटीजन एक साथ पशु प्रति उपयोग किया जा सकता है, जिससे जानवरों की संख्या में इस्तेमाल किया और संबद्ध लागत को कम करने ।

ठेठ स्तनधारी एंटीबॉडी या इम्युनोग्लोबुलिन बड़ी जंजीरों के दो प्रकार (2 भारी चेन और 2 प्रकाश श्रृंखला) है, जो एक साथ डाइसल्फ़ाइड बांड के माध्यम से जुड़े हुए है से मिलकर अणु हैं । ये एंटीबॉडी अपेक्षाकृत बड़े हैं, मनुष्यों, चूहों, बकरियों, और खरगोशों से अधिक प्रचुर मात्रा में आईजीजी प्रजातियों के लिए ~ 140-190 केडीए के आणविक भार का प्रदर्शन. उनके बहु-उप इकाई संरचना, उच्च आणविक वजन, और डाइसल्फ़ाइड बांड के कारण, इम्युनोग्लोबुलिन बल्कि बड़ी मात्रा में उत्पादन करने के लिए चुनौतीपूर्ण हो सकता है, उनकी लागत उच्च बना रही है । में 1990 है, यह पता चला था कि camelids, जो ऊंट, llamas और alpacas, ठेठ स्तनधारी प्रकार immunoglobulin, immunoglobulin के एक उपंयास के रूप में शामिल है कि संरचना में सरल है, केवल भारी श्रृंखला7रखने के अलावा । इन अद्वितीय camelid एंटीबॉडी विशेष रूप से उच्च अपनत्व के साथ विदेशी पदार्थों को बांधने के लिए एक ही क्षमता के अधिकारी लेकिन केवल एक प्रोटीन श्रृंखला8से बना रहे हैं । इसके अलावा, camelid एंटीबॉडी प्रयोग किया जा सकता है एक भी छोटे इकाई वीएचएच टुकड़ा, भी कहा जाता है एक एकल डोमेन एंटीबॉडी9करने के लिए काट दिया । उनके छोटे आकार के कारण, एकल डोमेन एंटीबॉडी जैव चिकित्सा अनुसंधान अनुप्रयोगों की एक विस्तृत श्रृंखला के लिए उपयोगी होते हैं और शैक्षिक और वाणिज्यिक स्रोतों की एक किस्म से उपलब्ध हैं1,10. एक अपवाद पश्चिमी सोख्ता के बाद से एक डोमेन एंटीबॉडी अधिक बार अनुरूप निर्भर epitopes, जो आम तौर पर पश्चिमी दाग में इस्तेमाल किया denaturing शर्तों के तहत खो रहे है के खिलाफ निर्देशित कर रहे है प्रकट होता है ।

चूंकि वे एक एकल पॉलीपेप्टाइड श्रृंखला के बने होते हैं, विशिष्ट एकल डोमेन एंटीबॉडी का चयन किया जा सकता है और आसानी से बैक्टीरिया में रिकॉमबिनेंट प्रोटीन के रूप में बड़ी मात्रा में उत्पादित. एकल डोमेन एंटीबॉडी भी आनुवंशिक रूप से विशिष्ट मार्करों या टैग है कि11रोगों के निदान के लिए "रिपोर्टर समूह" के रूप में इस्तेमाल किया जा सकता है शामिल इंजीनियर हो सकता है । उपयोग के अपने लचीलेपन के साथ युग्मित हेरफेर की यह आसानी एकल डोमेन एंटीबॉडी विश्वविद्यालयों में और कहीं पर शोधकर्ताओं के लिए एक महत्वपूर्ण संसाधन बनाता है ।

स्वास्थ्य के एक राष्ट्रीय संस्थानों के भाग के रूप में समर्थित कोर, मौजूदा तरीकों को alpacas3,4से एकल डोमेन एंटीबॉडी का उत्पादन अनुकूलित किया गया है । Alpacas बड़ा camelid परिवार के सदस्यों के साथ ही पहुंच के सापेक्ष निपटने के दोनों आसानी में महत्वपूर्ण लाभ है । Alpacas व्यापक रूप से फाइबर और मांस के लिए उठाया जाता है और इस प्रकार स्थानीय अल्पाका किसानों, जो अपनी वेबसाइटों के माध्यम से या राज्य ब्रीडर संघों के माध्यम से पहचाना जा सकता से क्षेत्र प्राप्त किया जा सकता है । alpacas की दो नस्लें उपलब्ध हैं, सूरी और Huacaya । Huacaya अधिक आम है और इस प्रोटोकॉल के लिए इस्तेमाल किया गया है, लेकिन प्रोटोकॉल आम तौर पर या तो नस्लों और भी अधिक व्यापक रूप से लागू अंय camelids के लिए लागू है ।

Protocol

alpacas के साथ सभी प्रक्रियाओं प्रोटोकॉल (2017-2627 और 2018-2925) केंटुकी के संस्थागत पशु देखभाल और उपयोग समिति (IACUC) के विश्वविद्यालय द्वारा अनुमोदित के साथ अनुसार प्रदर्शन किया गया ।

1. प्रतिजन-विशिष्ट अल्पाका एंटीबॉडी की पीढ़ी

  1. अल्पाका हैंडलिंग और सामांय विचार
    1. उपयुक्त संस्थागत और/या विनियामक अनुमोदन प्राप्त करें ।
    2. वयस्क alpacas प्राप्त करने के लिए, कम से कम ३.० (स्केल 1-5)12के एक शरीर की स्थिति स्कोर के साथ उंर के 10 साल से । क्योंकि वे झुंड जानवर हैं, दो की एक ंयूनतम घर लेकिन अधिमानतः तीन जानवरों के साथ ।
      नोट: पुरुषों की सिफारिश कर रहे हैं, क्योंकि सामान्य रूप में, वे एक और भी स्वभाव है और साथ काम करने के लिए आसान कर रहे हैं.
    3. आहार, आवास, टीकाकरण और परजीवी नियंत्रण कार्यक्रम13की समीक्षा सहित एक पशु चिकित्सा परीक्षा के माध्यम से पशुओं के स्वास्थ्य की स्थिति की जांच करें । सुनिश्चित करें कि पशुओं को पेशेवर पशु चिकित्सा सिफारिशों के आधार पर स्थानीय भौगोलिक क्षेत्र के लिए उपयुक्त टीकाकरण के साथ तारीख तक कर रहे हैं । एक ecto और endoparasite नियंत्रण कार्यक्रम एक पशुचिकित्सा मूल और विशिष्ट स्थानीय शर्तों13के झुंड के इतिहास की समीक्षा पर आधारित के साथ परामर्श में विकसित करना ।
    4. Acclimatize के लिए एक सप्ताह का समय है, जिसमें लगाम प्रशिक्षण और संयम के लिए जोखिम है ।
    5. एक पूर्व प्रतिरक्षण नियंत्रण के रूप में उपयोग के लिए सीरम प्राप्त करने के लिए एक 4 मिलीलीटर रक्त का नमूना लीजिए (१.४ कदम देखें). ०.५ मिलीलीटर aliquots में-20 ° c में सीरा और स्टोर को फ़्रीज़ करें ।
      नोट: इस समय, अतिरिक्त रक्त एक पूर्ण रक्त कोशिका (सीबीसी) विश्लेषण के लिए जानवरों की प्रारंभिक स्वास्थ्य की स्थिति पर नजर रखने के लिए लिया जा सकता है ।
  2. Antigen तैयारी
    1. फॉस्फेट-बफर खारा (पंजाब) या HEPES-बफर खारा (एचबीएस) में शुद्ध प्रोटीन एंटीजन तैयार करें और ≥ 1 मिलीग्राम/एमएल करने के लिए ध्यान केंद्रित । लगभग 3 प्रोटीन की मिलीग्राम पूर्ण प्रोटोकॉल के लिए आवश्यक है, प्रतिरक्षण सहित, panning, और क्लोन की पुष्टि.
      नोट: Camelid एंटीबॉडी उच्च विशिष्टता और प्रोटीन एंटीजन के खिलाफ selectivity प्रदर्शित लेकिन आम तौर पर unstructure्ड प्रोटीन या पेप्टाइड एंटीजन के लिए आमतौर पर अच्छी तरह से अनुकूल नहीं हैं ।
    2. प्रतिजन पवित्रता की स्थापना, पवित्रता > 90% वांछित के साथ । ऐसे एसडीएस के रूप में एक विश्लेषणात्मक विधि का उपयोग-पृष्ठ ।
      सावधानी: अंय प्रोटीन के साथ महत्वपूर्ण संदूषण चयन के दौरान समस्याओं के लिए नेतृत्व कर सकते है जहां एकल डोमेन एंटीबॉडी के बजाय लक्ष्य प्रोटीन संदूषण के लिए अलग किया जा सकता है ।
    3. जमी aliquots antigen की १०० µ g की कुल शामिल है जो प्रतिजन की तैयारी करें । ५० µ एल ए 2 मिलीग्राम/एमएल की तैयारी आदर्श है । १०० µ एल के 1 मिलीग्राम/मिलीलीटर सबसे पतला प्रोटीन समाधान प्रतिरक्षण के लिए उपयुक्त है । वैकल्पिक रूप से, यदि antigen फ्रीज/गल से गुजर नहीं कर सकता है और समाधान दीर्घकालिक में स्थिर होने के लिए जाना जाता है, यह 4 ° c पर संग्रहीत किया जा सकता है ।
      नोट: सुनिश्चित करने के लिए antigen एक फ्रीज/गल चक्र से गुजरना कर सकते हैं, एक 20 µ एल aliquot का परीक्षण प्रतिजन एक पतली दीवारों पीसीआर ट्यूब और तरल नाइट्रोजन में जमे हुए तस्वीर में तिरस्कृत किया जाना चाहिए । ट्यूब गल, उच्च गति केंद्रापसारक प्रदर्शन, और यूवी/विज़ अवशोषण की तुलना से पहले और ठंड के बाद या एक एसडीएस-पृष्ठ जेल चला कर मात्रात्मक वसूली की पुष्टि करें । यदि संभव हो तो, antigen भी जैविक गतिविधि की अवधारण के लिए परीक्षण किया जाना चाहिए । फ्रीज गल चक्र सफल होता है, तो शेष प्रतिजन १०० µ एल aliquots में जमे हुए स्नैप है और-८० डिग्री सेल्सियस पर संग्रहित है । फ्रीज/गल चक्र के साथ मुद्दे हैं, तो प्रोटोकॉल अप करने के लिए 20% ग्लिसरॉल के अलावा के साथ दोहराया जा सकता है ।
  3. प्रतिरक्षण
    1. पांच एंटीजन तक मिश्रण, २०० µ जी प्रत्येक, ३०० के बीच १,००० µ एल के बीच के एक अंतिम मात्रा में सहायक के साथ. सहायक मंदक के रूप में पानी का उपयोग कर अंतिम मात्रा के ≥ ५०% का गठन करना चाहिए ।
      नोट: यदि बफ़र आवश्यक है, तो HEPES, MOPS, या glycine का उपयोग करें । 5 और 6 के बीच का पीएच अक्सर कड़ाई से तटस्थ होने से ज्यादा अनुकूल साबित होता है । ऐसे फॉस्फेट या साइट्रेट के रूप में polyvalent आयनों से बचें, क्योंकि वे जमावट भड़काने कर सकते हैं ।
    2. बिजली की कतरनों के साथ अल्पाका के बाल छांटो, कंधे से कंधे तक अपनी गर्दन के आधार के साथ एक वर्धमान चाँद पैटर्न में धनुष लिम्फ नोड्स से सटे क्षेत्रों को बेनकाब करने के लिए ।
    3. गर्दन से अल्पाका होल्डिंग, धीरे से प्रतिजन एक 22 जी सुई का उपयोग कर धनुष लिम्फ नोड्स के पास गर्दन के आधार पर के साथ चमड़े का इंजेक्शन । प्रदर्शन के पांच इंजेक्शन ~ २०० µ एल (या कम) ~ 5 सेमी के अलावा ।
      नोट: पशुओं को इंजेक्शन के दौरान किसी दूसरे स्टाफ सदस्य द्वारा रोका जाना चाहिए । इंजेक्शन और alpacas से खून बह रहा है सावधानी के लिए कॉल के बाद से वे लात मार के लिए प्रवण हैं, न सिर्फ पीछे से लेकिन बग़ल में । पशुओं को एक दूसरे के करीब होने, एक समूह में, प्रक्रियाओं के दौरान इष्टतम है । यह देखते हुए कि वे झुंड जानवर हैं, वे एक समूह में शांत और कम जबरदस्ती संयम प्रक्रियाओं के दौरान की जरूरत है ।
    4. तीव्रग्राहिता के लक्षण के लिए ~ 20 मिनट पोस्ट इंजेक्शन के लिए जानवरों की निगरानी (१.६ कदम देखें) । इंजेक्शन साइटों साप्ताहिक, जो अनुशंसित सहायक का उपयोग करते समय अपेक्षित नहीं है पर स्थानीयकृत सूजन के लिए मॉनिटर । यह सुनिश्चित करें कि इंजेक्शन की साइट से रक्त रिसाव अत्यधिक नहीं है ।
    5. पांच बाद बढ़ाने इंजेक्शन साप्ताहिक मिश्रण में प्रत्येक प्रतिजन के १०० µ जी का उपयोग करते हैं । इंजेक्शन साइटों पर बाल कतरन मौसम के आधार पर साप्ताहिक की आवश्यकता हो सकती है । गिरावट और सर्दी में जानवरों के बाल तेजी से बढ़ सकते हैं ।
  4. ड्राइंग रक्त
    1. क्लिप और शराब झाड़ू के साथ संग्रह साइट को संक्रमित ।
    2. गर्दन के साथ धीरे से पशुओं को नियंत्रित ईमानदार और सीधे आयोजित किया ।
      नोट: जानवरों मैन्युअल रूप से वीडियो में प्रदर्शन के रूप में नियंत्रित किया जा सकता है. यदि उपलब्ध है, एक अल्पाका ढलान का उपयोग करने के लिए खून बह रहा है और इंजेक्शन के दौरान alpacas नियंत्रित आसानी से निपटने कर सकते हैं । एक अल्पाका ढलान का उपयोग करने के लिए, haltered alpacas ढलान में नेतृत्व कर रहे हैं और त्वरित रिलीज के साथ गर्दन सलाखों और पट्टियों के साथ रोका । अल्पाका ढलान के संस्करणों वाणिज्यिक विक्रेताओं से उपलब्ध हैं ।
    3. एक मील का पत्थर के रूप में कशेरुकाओं की अनुप्रस्थ प्रक्रिया के ventral प्रक्षेपण का प्रयोग, ventral प्रक्रिया के लिए बस औसत दर्जे का दबाव लागू करके नस बंद करना ।
      नोट: वयस्क अल्पाका में कोई भेद jugular कुंड नहीं है । jugular नसों अनुप्रस्थ कशेरुका प्रक्रियाओं के ventral अनुमानों द्वारा संरक्षित हैं । यह मोटी त्वचा (जैसे, 1 सेमी मोटी पुरुषों में गर्दन के बीच 1/3 से अधिक "लड़ थाली") और गर्दन पेशियां यह मुश्किल कल्पना या टटोलना jugular नस ही बनाता है । बाद में, कशेरुका स्थलों का उपयोग jugular स्थान के लिए सबसे उपयोगी संकेतक है ।
    4. एक ४५ ° कोण थोड़ा औसत दर्जे का (~ गर्दन के केंद्र की ओर प्रक्षेपण के लिए उंगली चौड़ाई) पर सुई डालें । सुई खून बहता है जब तक हेरफेर ।
      नोट: jugular नस और मन्या धमनी एक दूसरे के करीब हैं । शिरापरक रक्त रंग में काफी लाल हो सकता है, लेकिन अभी भी धमनी रक्त से गहरा है । संग्रह के बाद, दबाव को 0.5-1 मिनट के लिए साइट पर लागू किया जाना चाहिए (या मन्या तक पहुँचा है, तो) रक्तस्तम्भन आश्वासन दिया है जब तक लंबे समय तक.
    5. विश्लेषणात्मक प्रयोजनों के लिए रक्त की 4-10 मिलीलीटर ड्रा । एक १.५ इंच का उपयोग, 20 जी सुई आमतौर पर एक उचित आकार सिरिंज या रक्त संग्रह ट्यूब के साथ संयोजन के रूप में. लिम्फोसाइटों शुद्ध जब पूरे खून इकट्ठा करने के लिए लैवेंडर शीर्ष कश्मीर2EDTA ट्यूबों का उपयोग । उपयोग सोने शीर्ष सीरम जुदाई ट्यूबों (BD) जब सीरम उत्पादन के लिए रक्त का संग्रह.
    6. उत्पादन प्रयोजनों के लिए रक्त की 50-100 मिलीलीटर ड्रा । एक अतिरिक्त 12 इंच अर्क एक 19-20 जी पंखों वाला "तितली" अर्क सेट के साथ स्थापित विस्तार का प्रयोग करें ।
      नोट: एक एक्सटेंशन सेट विन्यास एक सहायक एकाधिक रक्त संग्रह ट्यूबों को भरने के लिए अनुमति देता है, venipuncturist संग्रह सुई स्थिर पर ध्यान केंद्रित करने की अनुमति. अर्क के अलावा सेट पशु (3-5 ंयूनतम प्रक्रिया) के संभावित आंदोलन को समायोजित और ऑपरेटरों के लिए एक आरामदायक काम दूरी देता है ।
  5. प्रतिरक्षा निगरानी
    1. तीन से चार दिनों के बाद 3rd और 5गु इंजेक्शन, प्रत्येक जानवर से एक छोटे से परीक्षण भरो प्रदर्शन करने के लिए परीक्षण के लिए सीरा प्राप्त करते हैं । ०.५ एमएल aliquots में सीरा को फ्रीज और स्टोर करें । पशु के स्वास्थ्य पर नजर रखने के लिए एक ही समय में अतिरिक्त रक्त के नमूने प्राप्त, के रूप में ऊपर चर्चा की ।
    2. पूर्व-प्रतिरक्षा, तीन सप्ताह, और पांच सप्ताह के समय अंक में परीक्षण खून से प्राप्त सीरा का उपयोग एलिसा द्वारा प्रतिजन-विशिष्ट एंटीबॉडी की उपस्थिति की पुष्टि करें । यह एक अंतिम खून लेने के लिए सबसे अच्छा है, जबकि एंटीबॉडी titer अभी भी बढ़ रहा है ।
    3. उत्पंन प्रतिजन संबध प्लेटों सतह इलाज ९६-अच्छी तरह से प्लेटों का उपयोग । १०० mM सोडियम कार्बोनेट बफर, पीएच ९.० में प्रतिजन के ०.१ µ जी पतला । एक अच्छी तरह से समाधान के १०० µ एल जोड़ें और 4 डिग्री सेल्सियस पर रात भर गर्मी । प्रत्येक प्रतिजन के दस कमजोर पड़ने डुप्लिकेट में परीक्षण कर रहे हैं । एक रिक्त नियंत्रण अच्छी तरह से तैयार है कि कार्बोनेट बफर के साथ ही लेपित है ।
    4. रात भर की गर्मी के बाद, प्लेट उलटा कुओं की सामग्री को हटाने और पंजाबियों की ०.१ मिलीलीटर, ०.१% 20 के बीच (पंजाब-टी) के साथ तीन बार धो लो ।
    5. पंजाब में BSA के ०.१ मिलीलीटर (5 मिलीग्राम/एमएल) को जोड़कर कुओं को ब्लॉक टी और कमरे के तापमान पर 1 घंटे के लिए थाली मशीन ।
    6. अच्छी तरह से वॉश सॉल्यूशन को pipetting करके और फिर प्लेट के उलटा करके वॉश सॉल्यूशन निकाल कर पंजाब-टी के साथ तीन बार प्लेट धो लें ।
    7. ०.३ मिलीलीटर के दो-गुना धारावाहिक कमजोर पड़ने की तैयारी-प्रत्येक पूर्व प्रतिरक्षा और पंजाब में प्रतिरक्षा सीरा-टी बफर 1/100 की एक प्रारंभिक कमजोर पड़ने का उपयोग कर, और अप करने के लिए 1/102400 ।
    8. कुओं के लिए प्रत्येक कमजोर पड़ने के १०० µ एल जोड़ें और कमरे के तापमान पर 2 घंटे के लिए गर्मी की अनुमति दें ।
    9. प्रत्येक कुआं से सीरम निकालें और पंजाब के ०.२ मिलीलीटर के साथ धो-टी तीन बार ।
    10. 1 एच के लिए 20000 के एक कमजोर पड़ने पर एचआरपी-संयुग्मित बकरी विरोधी लामा आईजीजी एंटीबॉडी के ०.१ मिलीलीटर के साथ एक अच्छी तरह से मशीन ।
      नोट: प्रतिरक्षा प्रतिक्रिया मापा दोनों पारंपरिक के रूप में के रूप में अच्छी तरह से भारी श्रृंखला केवल एंटीबॉडी, जो3संचलन में लगभग बराबर अनुपात में मौजूद हैं,14शामिल हैं ।
    11. एंटीबॉडी समाधान निकालें और प्रत्येक अच्छी तरह से पंजाब के ०.२ मिलीलीटर के साथ धो-टी तीन बार ।
    12. chromogenic peroxidase सब्सट्रेट के १०० µ एल जोड़ें अच्छी तरह से और दो उच्चतम एकाग्रता अंक की तीव्रता तक कमरे के तापमान पर गर्मी, जो आम तौर पर 5-10 मिनट लगते हैं ।
    13. एक अच्छी तरह से प्रतिक्रिया को रोकने के लिए ०.१ एम सल्फर एसिड के १०० µ एल जोड़ें ।
    14. एक प्लेट रीडर का उपयोग कर ४५० एनएम पर एक अच्छी तरह से अवशोषण को मापने ।
    15. एक समारोह एकाग्रता के रूप में अवशोषित प्लाट ।
  6. अल्पाका निगरानी और संभावित जटिलताओं
    1. प्रक्रिया के दौरान उचित अल्पाका निगरानी सुनिश्चित करें ।
      नोट: प्रक्रियाओं महत्वपूर्ण प्रतिकूल प्रभाव पैदा करने की उम्मीद नहीं कर रहे हैं । पशु भलाई और स्वास्थ्य को खिलाने और पानी पिलाने के दौरान पशुपालन और/या अनुसंधान कर्मियों द्वारा दैनिक निगरानी की जानी चाहिए । एक के साथ किसी भी जानवर प्रयोग जनित प्रेरित, या सहज प्राकृतिक रुग्णता उपचार के साथ पशु चिकित्सा सेवाओं द्वारा मूल्यांकन के लिए भेजा जाना चाहिए (ओं) के रूप में उपयुक्त प्रदान की, मानवीय इच्छामृत्यु के लिए, यदि आवश्यक हो ।
      phlebotomy के साथ जुड़े संभावित प्रतिकूल परिणाम खून बह रहा है, चोट, और रक्तगुल्म । जानवरों के खून बह रहा है के लक्षण के लिए देखने के लिए 20 मिनट के बाद रक्त ड्रा के लिए निगरानी की जानी चाहिए । साइटों पर अतिरिक्त दबाव का प्रयोग किया जाना चाहिए । अगर खून बह रहा है बंद नहीं करता है, एक पशुचिकित्सा संपर्क किया जाना चाहिए ।
      इंजेक्शन और रक्तस्राव के साथ जुड़े अन्य संभावित प्रतिकूल परिणामों में ग्रेन्युलोमा गठन और सूजन शामिल हैं । ग्रेन्युलोमा गठन की उंमीद नहीं है और केंटुकी के विश्वविद्यालय में नहीं मनाया गया है । इंजेक्शन साइट सूजन (लालिमा या सूजन) हो सकता है और एक पशुचिकित्सा के ध्यान में लाया जाना चाहिए । उत्पादन खून की एक संभावित महत्वपूर्ण मात्रा का प्रतिनिधित्व करता है, और पशुओं को विश्वास दिलाता हूं कि वे स्थिर और रक्त संग्रह के बाद सक्रिय है निगरानी की जानी चाहिए ।
      तीव्रग्राहिता और pyrogenic प्रतिक्रियाओं दो सबसे अधिक संभावना गंभीर प्रतिकूल परिणाम हैं, लेकिन बहुत कम ही मनाया जाता है । यदि यह होने के लिए थे, तीव्रग्राहिता शीघ्र ही प्रतिजन इंजेक्शन के बाद हो जाएगा और मलाशय के तापमान में वृद्धि, कमजोरी, उल्टी, सांस लेने की समस्याओं के द्वारा प्रकट हो, और/ मलाशय के तापमान शरीर के तापमान में किसी भी वृद्धि का पता लगाने के लिए प्रत्येक इंजेक्शन के बाद निगरानी की जा सकती है । यदि ये मांयता प्राप्त है, एक पशुचिकित्सा तुरंत एक परामर्श के लिए सूचित करें । इसके अतिरिक्त, एक आपातकालीन "क्रैश किट" (जैसे, एड्रेनालाईन, कोर्टिकोस्टेरोइड, और antihistamine) एक पशुचिकित्सा के साथ परामर्श में तैयार पशुओं के इलाज के लिए एक प्रतिकूल प्रतिक्रिया होने का संदेह उपलब्ध होना चाहिए ।

2. एकल डोमेन एंटीबॉडी पुस्तकालय निर्माण के लिए शुद्ध लिम्फोसाइटों

  1. पिछले इंजेक्शन के बाद तीन से पांच दिनों के रक्त की ५० मिलीलीटर लीजिए (चरण १.४ देखें) ।
    नोट: रक्त और आरएनए के अलगाव के तेजी से प्रसंस्करण एक उपयुक्त पुस्तकालय आकार15,3, जो panning की सफलता के लिए बहुत महत्वपूर्ण है प्राप्त करने के लिए महत्वपूर्ण है ।
  2. पंजाब के 5 मिलीलीटर के साथ एकत्र रक्त की 15 मिलीलीटर पतला ।
  3. एक लिम्फोसाइट जुदाई ट्यूब का उपयोग परिधीय रक्त लिम्फोसाइटों को अलग करने के लिए (PBLs) घनत्व के अनुसार ढाल केंद्रापसारक द्वारा सुझाव बनाती है ।
    सावधानी: निर्माता के निर्देश संकेत मिलता है कि अप करने के लिए 25 रक्त की मिलीलीटर इस्तेमाल किया जा सकता है, लेकिन यह प्रणाली संतृप्त कर सकते हैं और एक स्वच्छ लिम्फोसाइट तैयारी प्राप्त करने को रोकने.
  4. PBL करने के लिए 4 डिग्री सेल्सियस के लिए ठंडा कर पंजाब के 5 मिलीलीटर जोड़ें ।
  5. 4 डिग्री सेल्सियस पर ८०० x g पर 20 मिनट के लिए स्पिन ।
  6. 4 डिग्री सेल्सियस पर 20 मिनट के लिए ८०० x g पर 4 डिग्री सेल्सियस के लिए PBL के बाद पंजाबियों के 5 मिलीलीटर से अधिक ठंडा करने के लिए दो बार धो लें ।
  7. एक स्पिन-कॉलम आधारित प्रणाली का उपयोग कर कुल आरएनए को अलग करें, निर्माता के निर्देशों के अनुसार. Homogenize उचित बफर में शीर्ष और एक गैर-बहुलक-कतरन प्रणाली के लिए आवेदन करने के द्वारा कोशिकाओं को लागू । कक्ष इनपुट के आधार पर mini या मैक्सी-स्तंभों की उचित संख्या का उपयोग करें ।
  8. Oligo (डीटी) 12-18 प्राइमरों के ०.१ µ जी के मिश्रण के साथ 10 µ आरएनए के संयोजन द्वारा रिवर्स transcriptase का उपयोग सीडीएनए संश्लेषित ।
  9. स्थापित विधियों का उपयोग करते हुए एक भोजी लाइब्रेरी जनरेट करें4. इस फेज प्रदर्शन वेक्टर pMES4 में प्रतिबंध एंजाइमों के साथ क्लोनिंग शामिल है फेज समाधान के उत्पादन के लिए रेशा फेज के जीन III से जुड़े डालने की अभिव्यक्ति के बाद ।

3. एकल डोमेन एंटीबॉडी panning

  1. प्रतिजन संबध प्लेटों सतह इलाज ९६-well प्लेट्स का उपयोग कर उत्पादन । १०० mM सोडियम कार्बोनेट बफर, पीएच ९.० में प्रतिजन के ०.२५ µ जी पतला । इस समाधान के १०० µ एल जोड़ें एक अच्छी तरह से और 4 डिग्री सेल्सियस पर रात भर गर्मी । कोट प्रति प्रतिजन दो कुओं । एक खाली नियंत्रण अच्छी तरह से तैयार है कि कार्बोनेट बफर के साथ ही लेपित है ।
    नोट: प्लेटों का उत्पादन किया जा सकता है और 4 ° c पर एक सप्ताह के लिए संग्रहीत अगर चयन के कई दौर प्रदर्शन किया जाएगा । इसके अलावा, इस विधि प्रत्यक्ष अवशोषण जो लेबलिंग की आवश्यकता नहीं है, जबकि अंय तरीकों biotinylation या लेबलिंग रणनीतियों के अंय प्रकार का उपयोग करता है ।
  2. थाली रात भर गर्मी । कुओं की सामग्री को हटाने के लिए पलटने और पंजाब के ०.१ मिलीलीटर के साथ तीन बार धो-टी ।
  3. पंजाब में BSA की ०.१ मिलीलीटर (20 मिलीग्राम/एमएल) जोड़कर कुओं को ब्लॉक करें और कमरे के तापमान पर 2 घंटे के लिए थाली की मशीन ।
  4. पंजाबियों के साथ तीन बार के बाद तीन बार प्लेट धो लें । एंटीजन भी covalently लेबल किया जा सकता है और इस तरह के रूप में कब्जा प्रणालियों में इस्तेमाल किया, उदाहरण के लिए, streptavidin/
  5. 30 मिनट के लिए कमरे के तापमान पर एक हिल मंच पर पंजाब में ४० मिलीग्राम/एमएल BSA के १०० µ एल के साथ फेज समाधान (१०० µ एल) पूर्व उपचार ।
  6. प्रतिजन लेपित कुओं के लिए फेज समाधान जोड़ें और कमरे के तापमान पर 2 घंटे के लिए कोमल आंदोलन के साथ मशीन । एकाधिक कुओं का प्रयोग करें क्रम में प्रत्येक प्रतिजन के लिए 1011 फेज की कुल सुनिश्चित करने के लिए ।
  7. अनबाउंड फेज को उलटा करके छोड़ें और फिर कुओं को धोकर पांच बार पंजाब के २०० µ एल के साथ पांच बार पंजाबियों के साथ पीछा किया ।
  8. Elute में ०.२५ मिलीग्राम/एमएल trypsin के ०.१ मिलीलीटर जोड़कर फेज और ७०० rpm पर हिल मंच पर कमरे के तापमान पर 30 मिनट के लिए मशीनिंग ।
  9. 4 मिलीग्राम/एमएल 4 के 5 µ एल युक्त एक शीशी के समाधान स्थानांतरण-benzenesulfonyl फ्लोराइड हाइडरोक्लॉराइड (AEBSF) trypsin गतिविधि बुझाने के लिए समाधान ।
  10. TG1 फेज ३७ डिग्री सेल्सियस पर सक्षम कोशिकाओं को मिलाने के साथ जब तक ओडी६०० = ०.५ प्रदर्शन बढ़ाएँ ।
  11. TG1 कोशिकाओं के 3 मिलीलीटर के लिए eluted फेज के ५० µ एल जोड़ें ।
  12. 30 मिनट के लिए मिलाते हुए बिना ३७ डिग्री सेल्सियस पर मशीन ।
  13. १०० µ जी/एमएल एम्पीसिलीन, 2% ग्लूकोज के साथ पूरक पौंड मीडिया के 7 मिलीलीटर जोड़ें ।
  14. ३७ डिग्री सेल्सियस पर रात भर हिला ।
    नोट: सबसे विविध एकल डोमेन एंटीबॉडी प्राप्त करने के लिए, क्लोन अनुक्रम, वांछित संपत्तियों के लिए परीक्षण किया जा सकता है, और panning के एक दौर के बाद का उपयोग । उच्चतम संबध एकल डोमेन एंटीबॉडी प्राप्त करने के लिए panning के दो दौर का उपयोग किया जाना चाहिए.
  15. प्लेट पौंड आगर पर रातोंरात विकास के बाद बैक्टीरिया १०० µ g/एमएल एम्पीसिलीन, 2% ग्लूकोज के साथ पूरक प्लेटें । कई धारावाहिक कमजोर पड़ने का परीक्षण करने की आवश्यकता होगी, दो कमजोर पड़ने के साथ शुरू, 1/10000 और 1/100000 कमजोर पड़ने के १०० µ एल चढ़ाना ।
  16. ३७ डिग्री सेल्सियस पर रात भर थाली मशीन ।
  17. कालोनियों उठाओ और एक बाँझ ९६-अच्छी तरह से inoculate १०० µ एल के कुओं के साथ 2XYT १०० µ जी/एमएल एम्पीसिलीन, 2% ग्लूकोज, 10% वी/वी ग्लिसरॉल प्रति अच्छी तरह से ।
  18. मिलाते हुए बिना ३७ डिग्री सेल्सियस पर रात भर गर्मी ।
  19. अगले दिन, ६० मिनट के लिए ३७ डिग्री सेल्सियस पर १७० आरपीएम पर हिला ।
  20. पीसीआर ट्यूबों में मीडिया के 2 µ एल निकालें । शेष समाधान प्लेट में छोड़ दिया जा सकता है और 1-2 दिन या जमे हुए और बाद में उपयोग के लिए पर संग्रहित-८० डिग्री सेल्सियस के लिए 4 डिग्री सेल्सियस पर संग्रहीत ।
  21. प्रदर्शन पीसीआर का उपयोग करने के लिए उपयुक्त प्राइमरों का प्रयोग सदिश । pMES4 के लिए, सकारात्मक क्लोनों की पीसीआर स्क्रीनिंग प्राइमरों का उपयोग करता है कि एकाधिक क्लोनिंग साइट पार्श्व CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC और GGTGGTGTGAGGAGACGGTGACCTG हैं । पोलीमरेज़ इस्तेमाल किया, ५७ डिग्री सेल्सियस, और 30 चक्र के एक एनीलिंग तापमान के लिए उपयुक्त सायक्लिंग शर्तों का उपयोग ।
  22. 1% (w/v) agarose जेल चलाकर पीसीआर रिएक्शन का विश्लेषण करें । कालोनियों है कि सकारात्मक है एकल डोमेन एंटीबॉडी जीन आवेषण के ~ ५०० बीपी । सुनिश्चित करें कि सकारात्मक क्लोन नमूने के 20-50% हैं ।
    नोट: इस विधि क्लोन चयन और विश्लेषण है कि ज्यादातर अनुसंधान प्रयोगशालाओं में प्रदर्शन किया जा सकता है के लिए एक साधन प्रदान करता है । वैकल्पिक रूप से, अगली पीढ़ी के अनुक्रमण लागू किया जा सकता है और जो सांख्यिकीय और तुलनात्मक विश्लेषण16की अनुमति बड़े डेटासेट प्रदान करता है ।
  23. Inoculate थाली से सकारात्मक क्लोनों १०० µ g/एमएल एम्पीसिलीन के साथ पौंड की 7 मिलीलीटर युक्त ताजा ट्यूबों में ।
  24. ३७ डिग्री सेल्सियस पर रात भर के लिए झटकों के साथ हो जाना ।
  25. प्लाज्मिड डीएनए प्राप्त करने के लिए संस्कृति पर एक miniprep प्रदर्शन करते हैं ।
  26. मानक अनुक्रमण प्राइमर pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC) का उपयोग अनुक्रम सकारात्मक क्लोन ।
  27. परिणामी एकल डोमेन एंटीबॉडी अनुक्रम पर गणनात्मक विश्लेषण निष्पादित करें । सुनिश्चित करें कि कोई स्टॉप codons या फ़्रेम शिफ़्ट हैं ।
  28. समानता और विविधता के लिए परिणामी अनुक्रम वर्गीकृत । अक्सर पहचाने जाते हैं जो अनुक्रम उच्च संबध बाइंडिंग अनुक्रम, विशेष रूप से चयन के दो राउंड के बाद होने की संभावना है ।
  29. ई. कुंडल के एक BL21-व्युत्पन्न अभिव्यक्ति तनाव का उपयोग कर एकल डोमेन एंटीबॉडी व्यक्त. IPTG के अलावा के माध्यम से अभिव्यक्ति प्रेरित, 22 डिग्री सेल्सियस पर रात भर बढ़ रही है ।
  30. मैटीरियल मेटल संबध क्रोमैटोग्राफी (IMAC) का उपयोग करते हुए एकल डोमेन एंटीबॉडी को शुद्ध करना ।
  31. मांय एकल डोमेन एंटीबॉडी/प्रतिजन एक सीधा संपर्क परख जैसे पुल-डाउन, देशी जेल ट्रो, या एलिसा का उपयोग बाध्यकारी ।
  32. विशिष्ट प्रयोग के लिए वांछित के रूप में अनुप्रयोग विशिष्ट एकल डोमेन एंटीबॉडी प्रदर्शन, सत्यापित करें ।

Representative Results

यहां प्रस्तुत प्रोटोकॉल प्रोटीन एंटीजन की एक श्रृंखला के खिलाफ एकल डोमेन एंटीबॉडी उत्पन्न करने के लिए उपयोग किया गया था. पांच एंटीजन प्रति अल्पाका का उपयोग किया गया । प्रतिरक्षा निगरानी संकेत दिया है कि एंटीजन के बहुमत तीन सप्ताह में शुरुआत मजबूत प्रतिक्रिया दिखाई (चित्रा 1). उत्पादन खून और पुस्तकालय निर्माण लगभग छह सप्ताह के बाद जानवरों है कि कई एंटीजन इंजेक्शन के लिए सबसे अच्छा संतुलन देता है । panning के दो दौर प्रत्येक प्रतिजन के लिए प्रदर्शन किया गया, और पृथक कालोनियों (चित्रा 2) दिखलाई । विभिन्न प्रतिजनों के लिए विविध एकल डोमेन एंटीबॉडी अनुक्रम की पहचान की सकारात्मक कालोनियों के अनुक्रमण । उदाहरण के लिए, तीन अद्वितीय क्लोन संदर्भ प्रतिजन माल्टोज़ बाइंडिंग प्रोटीन (MBP) (चित्रा 3ए) को अलग किया गया । अक्सर के रूप में मनाया जाता है, एक डोमेन एंटीबॉडी महत्वपूर्ण अनुक्रम विविधता और उच्च चर CDR3 लंबाई (चित्रा 3) होते हैं । इन सुविधाओं में एक डोमेन एंटीबॉडी/antigen इंटरैक्शन संदर्भ एकल डोमेन एंटीबॉडी/CX3CL1 परिसर17 (चित्र 3 बी) में देखा के रूप में विशेष रूप से महत्वपूर्ण हैं ।

पूर्ण लंबाई एकल डोमेन एंटीबॉडी दृश्यों के बहुमत और व्यक्त किया जा सकता है 1-10 mg/L की संस्कृति (चित्र 4a) पर शुद्ध । CDR3 लंबाई में विविधता की वजह से, अलग एकल डोमेन एंटीबॉडी आणविक वजन में मामूली भिन्नता दिखा. प्रत्यक्ष बाइंडिंग और अनुप्रयोग विशिष्ट प्रदर्शन की पुष्टि महत्वपूर्ण है । उदाहरण के लिए, Antigen B के विरुद्ध चयन के दो राउंड के बाद, एकल डोमेन एंटीबॉडी के एक पैनल की पहचान की गई (चित्रा 2) । एकाधिक समान अनुक्रम की पहचान की गई, और एकल डोमेन एंटीबॉडी का उत्पादन और शुद्ध किया गया था । यह तो सीधे के माध्यम से परीक्षण किया गया था प्रतिजन संबंध राल के साथ नीचे खींच और मजबूत खुराक पर निर्भर बाध्यकारी (चित्रा 4B) दिखाया. महत्वपूर्ण बात, एकल डोमेन एंटीबॉडी राल को नियंत्रित करने के लिए कोई बाध्यकारी दिखाया । इन आंकड़ों को एक प्रत्यक्ष बाध्यकारी संपर्क, और एक है कि अच्छी तरह से दोनों पुल नीचे और एलिसा आधारित स्वरूपों में आत्मीयता पर कब्जा के लिए अनुकूल है प्रदर्शित करता है ।

Figure 1
चित्रा 1 : प्रतिनिधि प्रतिरक्षा निगरानी के दो अलग एंटीजन एक ही जानवर में अलग प्रतिजनों के लिए महत्वपूर्ण विशिष्ट प्रतिरक्षा प्रतिक्रिया दिखा. कई प्रतिजनों शुरू प्रतिरक्षण के बाद तीन सप्ताह के रूप में जल्दी के रूप में मजबूत प्रतिक्रिया दिखाने के छह सप्ताह के बाद अधिकतम प्रतिक्रिया दिखा बहुमत के साथ । छह सप्ताह भी संबंध परिपक्वता के लिए अनुमति देता है और उत्पादन खून और बी सेल अलगाव के लिए सिफारिश की समय है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2 : पीसीआर आधारित सकारात्मक क्लोन की पुष्टि । प्राइमरों pMES4 वेक्टर के MCS अवधि, और एक सकारात्मक nanobody क्लोन ~ ५०० bp (* के साथ चिह्नित) के एक amplicon पैदा करता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3 : Antigen-विशिष्ट अनुक्रम हाइलाइट अल्पाका एकल डोमेन एंटीबॉडी विविधता । (एक) का चयन एकल डोमेन एंटीबॉडी अनुक्रम एक संदर्भ एकल डोमेन एंटीबॉडी 4XT1, फ्रेमवर्क और complementarity-निर्धारण क्षेत्रों (Kabat) के साथ के साथ MBP के लिए पृथक का संरेखण नीचे हाइलाइट । () अल्पाका एकल डोमेन एंटीबॉडी 4XT1 की संरचना CX3CL1 करने के लिए बाध्य (PDB 4XT1), विशिष्ट प्रतिजन बंधन में चर सीडीआर छोरों की महत्वपूर्ण भूमिका पर बल. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्र 4 : शुद्धि और एकल डोमेन एंटीबॉडी के सत्यापन । () एसडीएस-IMAC के पृष्ठ एकल डोमेन एंटीबॉडी शुद्ध, विविध एकल डोमेन एंटीबॉडी की तुलना । विभिन्न आणविक भार मुख्य रूप से CDR3 पाश की लंबाई अलग करने के लिए कारण हैं. अभिव्यक्ति के भिंन स्तर भी एक डोमेन एंटीबॉडी के एक अल्पसंख्यक के साथ मनाया जाता है, शुद्ध प्रोटीन के गरीब पैदावार दिखा । (B) किसी antigen समानता pull-डाउन का उपयोग कर प्रत्यक्ष बाइंडिंग का सत्यापन । मजबूत खुराक-निर्भर एकल डोमेन एंटीबॉडी बाइंडिंग antigen-युग्मित राल के साथ नहीं बल्कि नियंत्रण राल के साथ मनाया जाता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Discussion

के रूप में उल्लेख किया है, उच्च समानता और एकल डोमेन एंटीबॉडी की विशिष्टता, उनके सतही अभिव्यक्ति और स्थिरता के साथ संयुक्त, जैव चिकित्सा अनुसंधान में अनुप्रयोगों के लिए उंहें आदर्श reagents बनाने, महत्वपूर्ण जैव रासायनिक एजेंट के रूप में, नैदानिक उपकरण, या चिकित्सकीय एजेंटों18। व्यावसायिक अनुप्रयोगों के लिए, बौद्धिक संपदा से संबंधित कुछ मुद्दे हैं, जिन पर विचार किया जाना चाहिए. इसके अतिरिक्त, एकल डोमेन एंटीबॉडी विशिष्ट मार्करों या टैग है कि सेलुलर परख में या निदान में पत्रकारों के रूप में इस्तेमाल किया जा सकता है शामिल करने के लिए इंजीनियर किया जा सकता है । इन का उपयोग करता है की कुंजी के लिए ब्याज की एंटीजन के खिलाफ विशिष्ट एकल डोमेन एंटीबॉडी का उत्पादन करने की क्षमता है । एक विधि यहां वर्णित है alpacas, जो प्रोटीन एंटीजन की एक विस्तृत विविधता के खिलाफ एक मजबूत प्रतिरक्षा प्रतिक्रिया पैदा करता है का उपयोग कर एकल डोमेन एंटीबॉडी का उत्पादन । पशु हैंडलिंग और विनियामक अनुपालन के लिए विचार बताए गए हैं । इस प्रक्रिया के इस भाग में सफलता के लिए महत्वपूर्ण हैं ।

वहां एक डोमेन एंटीबॉडी कि प्रतिरक्षण की आवश्यकता नहीं है उत्पादन के लिए अंय रणनीतियों रहे हैं, लेकिन इसके बजाय चयन और समानताएं19,20 के चलने अनुकूलन के लिए विभिंन प्रणालियों के साथ semisynthetic पुस्तकालयों का उपयोग करें . हालांकि, प्रतिरक्षित पशुओं से व्युत्पंन पुस्तकालयों का उपयोग करने के लाभ के लिए मज़बूती से उच्च समृद्ध, विविध, और उच्च समानता एकल डोमेन एंटीबॉडी की क्षमता है । इसके अतिरिक्त, न केवल महत्वपूर्ण अनुक्रम रूपांतरों मनाया जाता है, लेकिन विशिष्ट एकल डोमेन एंटीबॉडी के एक महत्वपूर्ण बहुमत अलग अद्वितीय सम्मिलन और विलोपन, विशेष रूप से CDR3 में था.

इसके अलावा, एक डोमेन एंटीबॉडी एक सीधी प्रक्रिया है कि केवल प्रतिजन के छोटे इंजेक्शन की आवश्यकता के द्वारा उत्पादित किया जा सकता है, और इस प्रक्रिया के बाद, जानवरों के झुंड को वापस किया जा सकता है । नोट के, पशु मुक्त रूप से फाइबर उत्पादन के लिए इस्तेमाल किया जा सकता है, लेकिन मांस के रूप में उपयोग से बाहर रखा जाना चाहिए (मानव खाद्य श्रृंखला) परीक्षण एंटीजन और गैर एफडीए के उपयोग के कारण एकल डोमेन एंटीबॉडी उत्पादन के लिए सहायक अनुमोदित. जब प्रक्रिया पूरी हो गई है, एक सप्ताह के लिए पशुओं की निगरानी की जानी चाहिए, एक अंतिम पशु चिकित्सा परीक्षा दी, और फिर या तो अपने घर खेत में लौट सकते है या छह महीने के लिए विश्राम किया एक डोमेन एंटीबॉडी उत्पादन के दूसरे दौर से पहले ।

Disclosures

डीआरएस. Whiteheart और Hersh केंटुकी के विश्वविद्यालय में है और आणविक दवा है कि अल्पाका में एक शुल्क के रूप में सेवा के लिए एक डोमेन एंटीबॉडी का उत्पादन के लिए केंद्र में एक कोर काम करते हैं ।

Acknowledgments

इस काम को राष्ट्रीय स्वास्थ्य संस्थान (P30GM103486) ने समर्थन दिया था.

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Alpacas (<em>लामा pacos</em>) का प्रतिरक्षण प्रोटीन एंटीजन और प्रतिजन-विशिष्ट एकल डोमेन एंटीबॉडी के उत्पादन के साथ
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter