Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Immunisering Alpakka (Lama Britis) med Protein antigener og produksjon av Antigen-spesifikke enkelt domene antistoffer

doi: 10.3791/58471 Published: January 26, 2019

Summary

En metode for produksjon av enkelt domene antistoffer fra Alpakka, inkludert immunisering, blod samling, B-celle isolasjon og utvalg er beskrevet.

Abstract

I dette manuskriptet er en metode for immunisering Alpaca og bruk av molekylærbiologi metoder for å produsere antigen-spesifikke enkelt domene antistoffer beskrevet og demonstrert. Camelids, har for eksempel alpakkaer og lamaer, blitt en verdifull ressurs for biomedisinsk forskning siden de produserer en roman type tunge kjede-bare antistoff som kan brukes til å produsere ett domenenavn antistoffer. Immunsystemet er svært fleksible, gjøres enkelt domene antistoffer til mange forskjellige protein antigener og med ulike konformasjonen av antigen, med en svært høy grad av spesifisitet. Disse funksjonene, blant annet gjør enkelt domene antistoffer et uvurderlig verktøy for biomedisinsk forskning. En metode for produksjon av enkelt domene antistoffer fra Alpakka er rapportert. En protokoll for immunisering, blod samling og B-celle isolasjon er beskrevet. B-celler brukes for bygging av en vaksineres biblioteket, som brukes ved valg av bestemte enkelt domene antistoffer via panorering. Antatte bestemt enkelt domene antistoffer Hentet via panorering er bekreftet av rullegardinmenyen, ELISA eller gel-Skift analyser. Resulterende enkelt domene antistoffer kan deretter brukes enten direkte eller som en del av en utvikling reagens. Bruk av enkelt domene antistoff og enkelt domene antistoff-baserte regents omfatter strukturelle, biokjemiske, mobilnettet, i vivo og terapeutiske programmer. Enkelt domene antistoffer kan være produsert i store mengder rekombinante proteinene i prokaryote uttrykk systemer, renset, og brukes direkte eller kan bli konstruert for å inneholde bestemte markører eller koder som kan brukes som journalister i mobilnettet studier eller diagnostikk.

Introduction

Alpakkaer og andre medlemmer av Kamelid familien, har blitt en populær kilde for å generere antistoffer for biomedisinsk forskning1,2,3. Camelids har en unik immunsystem at de produserer både normale antistoffer samt tunge-kjeden bare antistoffer som tillater produksjon av mye mindre enkelt domene antistoffer, samtidig som du beholder høy spesifisitet og høy affinitet. Dermed gir Kamelid antistoffer en allsidig reagens nyttig for en rekke formål. En metode for å immunize alpaca og produsere enkelt domene antistoffer mot en rekke protein antigener er her beskrevet. Disse antistoffene kan produseres i camelids via en relativt enkel prosess som bare krever immunisering via små injeksjoner av målet protein (antigen) og en blod tegne4. Deretter brukes bibliotek konstruksjon, M13 phage Vis5 og panorering mot rekombinant antigen6 til å isolere og produsere enkelt domene antistoffer med de ønskede egenskapene. Fordi prosessen utnytter kraften i phage teknologien, fem eller flere antigener kan benyttes samtidig per dyr, og dermed redusere antall dyr brukes og tilhørende kostnader.

Typisk pattedyr antistoffer eller immunglobuliner er store molekyler som består av to kjeder (2 tunge kjeder og 2 lys kjeder), som er knyttet sammen gjennom disulfide obligasjoner. Disse antistoffene er relativt store, viser molekylvekt ~ 140-190 kDa for mer rikelig IgG arten fra mennesker, mus, geiter og kaniner. På grunn av deres multi delenhet struktur, høy molekylvekt og disulfide obligasjoner, kan immunglobuliner være ganske utfordrende å produsere i store mengder, gjør sine kostnader høy. I 1990, ble det oppdaget at camelids, som inkluderer kameler, lamaer og alpakkaer gjøre, i tillegg til de typiske pattedyr type immunglobulin, en ny form for immunglobulin som er enklere i struktur, har bare tunge kjeder7. Disse unike Kamelid antistoffer har den samme evnen spesielt binde utenlandske stoffer med høy affinitet men bare består av et protein kjeden8. Videre kan Kamelid antistoffer eksperimentelt avkuttet til en mindre enhet VHH fragment, også kalt en enkelt domene antistoff9. På grunn av sin lille størrelse, enkelt domene antistoffer er nyttig for et bredt spekter av biomedisinsk forskning programmer og er tilgjengelig fra en rekke faglige og kommersielle kilder1,10. Et unntak synes å være vestlige blotting siden enkelt domene antistoffer er ofte rettet mot konformasjon avhengige epitopes, som vanligvis er tapt under denaturing betingelser brukes i vestlige blots.

Siden de består av en enkelt polypeptid kjede, kan bestemt enkelt domene antistoffer valgt og lett produsert i store mengder som rekombinante proteinene i bakterier. Enkelt domene antistoffer kan også være genetisk konstruert for å inneholde bestemte markører eller etiketter som kan brukes som "reporter grupper" for diagnostisering av sykdommer11. Denne enkel manipulering kombinert med deres fleksibilitet bruk gjør enkelt domene antistoffer en viktig ressurs for forskere ved universiteter og andre steder.

Som del av en National Institutes of Health støttet kjernen, har eksisterende metoder blitt tilpasset for å produsere ett domenenavn antistoffer alpakkaer3,4. Alpakka har betydelige fordeler i begge bevegelighet i forhold til større Kamelid familiemedlemmer, samt tilgjengelighet. Alpakka er mye hevet for fiber og kjøtt og dermed kan fås regionalt fra lokale alpaca bønder, som kan identifiseres gjennom sine nettsteder eller gjennom staten oppdretter foreninger. To raser av Alpakka er tilgjengelig, Suri og Huacaya. Huacaya er mer vanlig og ble brukt for denne protokollen, men protokollen er generelt gjelder enten raser og mer gjelder også andre camelids.

Protocol

Alle prosedyrer med alpakkaene ble utført i henhold til protokoller (2017-2627 og 2018-2925) godkjent av University of Kentuckys institusjonelle Animal Care og bruk Committee (IACUC).

1. generasjon av Antigen-spesifikke Alpaca antistoffer

  1. Alpaca håndtering og de generelle betraktninger
    1. Deg riktig institusjonelle og/eller forskrifter.
    2. Få voksne Alpakka, mindre enn 10 år med en betingelse score på minst 3,0 (skala 1-5)12. Fordi de flokk dyr, huset minst to men helst tre dyr sammen.
      Merk: Menn er anbefalt fordi, generelt, de har en jevnere temperament og er enklere å arbeide med.
    3. Sjekke helsetilstanden til dyr gjennom en veterinær eksamen inkludert gjennomgang av kosthold, boliger, vaksinasjon og parasite administrere programmer13. Kontroller at dyrene er oppdatert med vaksinasjoner passer til den lokale geografiske regionen basert på profesjonell veterinær anbefalinger. Utvikle en ecto- og endoparasite styreprogrammet i konsultasjon med en veterinær basert på en gjennomgang av historien til flokken og bestemte lokal betingelser13.
    4. Akklimatisere seg i minst en uke, stoppet samt eksponering for tilbakeholdenhet.
    5. Samle en 4 mL blodprøve for å få serum som en pre immunisering kontroll (se trinn 1.4). Fryse sera og lagre på 20 ° C i 0,5 mL dele.
      Merk: På denne tiden, bli ytterligere blod tatt for en komplett blodlegemer (CBC) analyse å overvåke dyrenes første helsetilstand.
  2. Antigen forberedelse
    1. Forberede renset protein antigener i fosfat-bufret saltvann (PBS) eller HEPES-bufret saltvann (HBS) og konsentrere til ≥1 mg/mL. Ca 3 mg protein trengs for komplett protokoll, inkludert immunisering, panorering og bekreftelse av kloner.
      Merk: Kamelid antistoffer viser høy spesifisitet og selektivitet mot protein antigener, men er generelt ikke godt egnet for ustrukturert proteiner eller peptid antigener som er generelt ustrukturert.
    2. Etablere antigen renhet, med renhet > 90% ønsket. Bruke en analytisk metode som SDS-side.
      Forsiktig: Betydelig forurensning med andre proteiner kan føre til problemer under valget der enkelt domene antistoffer kan være isolert til forurensninger i stedet for målet protein.
    3. Forberede frosne dele antigen som inneholder totalt 100 µg av antigen. 50 µL av en 2 mg/mL forberedelse er ideelt. 100 µL av 1 mg/mL er mest fortynne protein løsning egnet for immunisering. Alternativt hvis antigen kan ikke gjennomgå fryse/tine og er kjent for å være stabil løsning lang sikt, kan det være lagret på 4 ° C.
      Merk: For å sikre antigen kan gjennomgå en fryse/tine syklus, test en 20 µL aliquot av antigen bør bli utlevert til en tynn vegger PCR rør og fest frosset i flytende nitrogen. Tine røret, utføre høyhastighets sentrifugering og kontrollere kvantitative utvinning ved å sammenligne UV/VIS absorpsjon før og etter frysing eller kjøre en SDS side gel. Hvis mulig, bør også antigen testes for oppbevaring av biologiske aktivitet. Hvis fryse tine syklusen er vellykket, er gjenværende antigen frosset i 100 µL dele og lagret på-80 ° C. Hvis det er problemer med fryse/tine syklus, protokollen kan gjentas med tillegg av opptil 20% glyserol.
  3. Immunisering
    1. Bland opp til fem antigener, 200 µg hver, med adjuvant i et siste volum på mellom 300 til 1000 µL. Adjuvant bør utgjør ≥50% av det siste bindet bruke vann som fortynningsmiddel.
      Merk: Hvis bufferen er nødvendig, bruk HEPES, MOPPER eller glysin. En pH mellom 5 og 6 har ofte vist seg for å være mer gunstig enn strengt nøytral. Unngå polyvalent ioner som fosfat eller citrate, siden de kan provosere koagulering.
    2. Trim alpaca's hår med elektrisk avklipt, en halvmåne mønsteret langs bunnen av halsen fra skulder til skulder å avsløre regionene tilstøtende til lymfeknutene bue.
    3. Holder alpaca i nakken, sakte injisere antigen subcutaneously langs bunnen av halsen nær bue lymfeknutene bruker en 22 G nål. Utføre fem injeksjoner av ~ 200 µL (eller mindre) ~ 5 cm fra hverandre.
      Merk: Dyrene skal dempes av en andre medarbeider under injeksjoner. Sprøytebruk og blødning alpakkaer krever forsiktighet siden de ikke er utsatt for sparker, bare fra bak men sidelengs. Å ha dyr nær hverandre, i en gruppe, under prosedyrene er optimal. Gitt at de er flokk dyr, de er roligere i en gruppe og mindre sterkere tilbakeholdenhet kreves under prosedyrene.
    4. Overvåke dyr ~ 20 min post injeksjon for underskriver av anafylaksi (se trinn 1.6). Skjermen for lokaliserte betennelse på injeksjon nettsteder ukentlig, som ikke forventes når du bruker anbefalte adjuvant. Kontroller at blod lekkasjen fra injeksjonsstedet ikke er overdreven.
    5. Utføre fem påfølgende øker injeksjoner ukentlig med 100 µg av hver antigen i blandingen. Klipping hår på webområdene injeksjon være nødvendig ukentlig avhengig av sesongen. I høst og vinter, kan dyrenes hår vokser raskt.
  4. Tegning blod
    1. Klippet og desinfisere samling området med alkohol vattpinner.
    2. Holde dyr forsiktig med halsen holdt oppreist og rett.
      Merk: Dyr kan dempes manuelt som vist i videoen. Hvis tilgjengelig, bruk av en alpaca chute for å holde alpakkaene blødning og injeksjoner kan lette håndtering. For å bruk en alpaca chute, er stoppet Alpakka ført inn i sjakten og tilbakeholdne med halsen barer og stropper med hurtigkoblinger. Versjoner av alpaca sjakten er tilgjengelig fra kommersielle leverandører.
    3. Bruker ventrale projeksjon av tverrgående ryggvirvlene som et landemerke, occlude fotsporene av legge press bare mediale ventrale prosessen.
      Merk: Det er ingen tydelig jugulare fure i voksen alpaca. Vena årer er beskyttet av ventrale anslag tverrgående ryggvirvel prosesser. Denne tykk hud (f.eks 1 cm tykk "slåss plate" over de midterste 1/3 av halsen hos menn) og halsen muskulaturen gjør det vanskelig å visualisere eller palpate vena jugularis selv. Deretter er bruk ryggvirvel landemerker de mest nyttige indikatorene for jugular plassering.
    4. Sette inn nålen i 45° vinkel litt mediale (~ finger bredde) til projeksjon mot midten av halsen. Manipulere nålen til blodet flyter.
      Merk: Vena jugularis interna og arteria carotis er nær hverandre. Venøst blod kan være ganske rød i fargen, men er fortsatt mørkere enn arterial blod. Etter samlingen, trykket bør brukes på nettstedet for 0,5-1 min (eller lenger hvis carotis nås) til hemostasen er sikret.
    5. Tegne 4-10 mL blod for analytiske formål. Benytte en 1,5 tommer, 20 G nål vanligvis i forbindelse med en passende størrelse sprøyte eller blod samling rør. Bruke lavendel toppen K2EDTA rør for å samle hele blod når rensende lymfocytter. Bruke gull topp serum separasjon rør (BD) når blodet for serum produksjon.
    6. Trekke 50-100 mL blod til produksjonsformål. Bruke en ekstra 12-tommers infusjon forlengelsesslangen med en 19-20 G bevingede "butterfly" infusjon sett.
      Merk: En utvidelse angitt konfigurasjon tillater assistent å fylle flere blod samling rør, slik at venipuncturist å fokusere på å stabilisere samling nålen. Tillegg av infusjonen settet innkvarterer potensielle bevegelse av dyr (3-5 minutter prosedyre) og gir en komfortabel arbeidsavstand for operatører.
  5. Immun overvåking
    1. Tre til fire dager etter 3rd og 5th injeksjoner, utføre en liten test blø fra hvert dyr å få sera for testing. Fryse og lagre sera i 0,5 mL dele. Få flere blodprøver samtidig å overvåke tilstanden til dyret, som beskrevet ovenfor.
    2. Bekrefte tilstedeværelse av antigen-spesifikke antistoffer med ELISA bruker sera fra test utfall på pre immun, tre uker og fem ukers tidspunkt. Det er best å ta en endelig blø mens antistoff titer er fortsatt økende.
    3. Generere antigen affinitet plater med overflaten behandlet 96-brønns plater. Fortynne 0,1 µg av antigen i 100 mM natriumkarbonat buffer, pH 9.0. Tilsett 100 µL av løsningen hver brønn og ruge over natten på 4 ° C. Ti fortynninger av hver antigen testes i duplikat. En tom kontroll forberedt godt som er belagt med karbonat buffer bare.
    4. Etter den natten inkubering, snu platen opp ned for å fjerne innholdet i brønnene og vaske tre ganger med 0,1 mL PBS, 0,1% mellom 20 (PBS-T).
    5. Blokkere brønnene ved å legge 0,1 mL av BSA (5 mg/mL) i PBS-T og rugende platen i 1 time ved romtemperatur.
    6. Vaske platen tre ganger med PBS-T ved pipettering vaskeløsning i brønnen, og deretter fjerne vaskeløsningen ved inversjon av platen.
    7. Forberede todelt føljetong fortynninger av 0,3 mL hver av pre immun og immun sera i PBS-T buffer med en start fortynning av 1/100 og opp til 1/102, 400.
    8. Legge til 100 µL av hver fortynning brønnene og la ruge for 2 timer ved romtemperatur.
    9. Fjerne serum fra hver brønn og vask med 0,2 mL PBS-T tre ganger.
    10. Inkuber hver med 0,1 mL HRP-konjugerte geit anti-llama IgG antistoff på en fortynning av 1:20,000 1t.
      Merk: Immunforsvaret målt omfatter både konvensjonell og tunge-kjeden bare antistoffer, som finnes i omtrent like prosenter i sirkulasjon3,14.
    11. Fjerne antistoff løsningen og vask hver godt med 0,2 mL PBS-T tre ganger.
    12. Legg 100 µL av kromogent peroxidase substrat til brønnen og ruge ved romtemperatur før intensiteten av de to høyeste konsentrasjon punktene har blitt mettet, som vanligvis tar 5-10 min.
    13. Legge til 100 µL av 0.1 M svovelsyre i hver brønn for å stoppe reaksjonen.
    14. Måle absorbansen i hver brønn ved 450 nm likner en plate.
    15. Tegne absorbansen som en funksjon konsentrasjon.
  6. Alpaca overvåking og mulige komplikasjoner
    1. Sikre riktig alpaca overvåking i hele denne prosedyren.
      Merk: Fremgangsmåtene forventes ikke å forårsake betydelige bivirkninger. Dyr velvære og helse bør overvåkes daglig av dyrehold og/eller personell under fôring og vanning. Dyr med unalleviated eksperimentelt indusert eller spontane naturlig sykelighet skal være henvist til evalueringen av veterinærtjenester med treatment(s) som passer, opp til Human dødshjelp, om nødvendig.
      Potensielle negative konsekvenser forbundet med phlebotomy er blødning, blåmerker og hematom. Dyrene bør overvåkes for 20 min post blod tegn å se etter tegn til blødning. Ytterligere press på nettsteder bør brukes. Hvis blødningen ikke stopper, bør en veterinær kontaktes.
      Andre potensielle negative konsekvenser forbundet med injeksjoner og blødning inkluderer granulom formasjon og betennelse. Granulom formasjon forventes ikke og observert ikke på University of Kentucky. Injeksjon området betennelse (rødhet eller hevelse) kan oppstå og skal bringes til seg oppmerksomheten til en veterinær. Produksjon bleed representerer en potensielt betydelig volum av blod, og dyrene bør følges for å sikre at de er stabile og aktiv etter samlingen blod.
      Anafylaksi og pyrogenic svar er de to mest sannsynlig alvorlige negative konsekvensene, men er sjelden observert. Hvis det skulle skje, anafylaksi skjer kort tid etter antigen injeksjoner og være manifestert av en økning i endetarms temperatur, svakhet, oppkast, pusteproblemer og diaré. Endetarms temperatur kan overvåkes etter hver injeksjon å oppdage noen økning i kroppstemperatur. Hvis dette er anerkjent, varsle en veterinær umiddelbart for en konsultasjon. I tillegg bør en "Crash nødutstyr" (f.eks, adrenalin, kortikosteroider og antihistamin) i konsultasjon med en veterinær være tilgjengelig til å behandle dyr mistenkt for å ha en negativ reaksjon.

2. rensende lymfocytter for enkelt domene antistoffer biblioteket konstruksjon

  1. Samle 50 mL blod tre til fem dager etter siste injeksjon (se trinn 1.4).
    Merk: Rask behandling av blod og isolering av RNA er viktig å få en passende biblioteket størrelse15,3, som er svært viktig for å lykkes med panorering.
  2. Fortynne 15 mL samlet blod med 5 mL PBS.
  3. Benytte en lymfocytt separasjon rør for å isolere perifert blod lymfocytter (PBLs) av tetthet gradert sentrifugering ifølge produserer forslag.
    Forsiktig: Produsentens instruksjoner angir at opptil 25 mL blod kan brukes, men dette kan mette systemet og unngå å få en ren lymfocytt forberedelse.
  4. Legge til 5 mL av PBS prechilled 4 ° c til PBL.
  5. Spinn for 20 min 800 x g på 4 ° C.
  6. Vask to ganger ved å legge til 5 mL av PBS prechilled 4 ° c til PBL etterfulgt av sentrifugering for 20 min 800 x g på 4 ° C.
  7. Isolere totale RNA bruker en spin-kolonne basert system, i henhold til produsentens instruksjoner. Homogenize celler av vertexing i riktige bufferen og bruke Research-shredding systemet. Bruk et passende antall mini eller maxi-kolonner basert på cellen inngang.
  8. Syntetisere cDNA med revers transkriptase ved å kombinere 10 µg av med en blanding av 0,1 µg i Oligo (dT) 12-18 primere.
  9. Generere en bacteriophage biblioteket bruker etablerte metoder4. Dette innebærer kloning med begrensning enzymer i phage vise vektor pMES4 etterfulgt av uttrykket av sette del gen III av trådformede phage for produksjon av phage løsningen.

3. én domene antistoff panorering

  1. Produsere antigen affinitet plater med overflaten behandlet 96-brønns plater. Fortynne 0,25 µg av antigen i 100 mM natriumkarbonat buffer, pH 9.0. Legg 100 µL av denne løsningen i hver brønn og ruge over natten på 4 ° C. Coat to brønner per antigen. Forberede en tom kontroll godt som er belagt med karbonat buffer bare.
    Merk: Platene kan produsert og lagret i opptil en uke på 4 ° C om flere runder av utvalget skal utføres. Også bruker denne direkte absorpsjon som ikke krever merking mens andre bruker biotinylation eller andre typer merking strategier.
  2. Inkuber platen over natten. Inverter for å fjerne innholdet i brønnene og vaske tre ganger med 0,1 mL PBS-T.
  3. Blokkere brønnene ved å legge til 0,1 mL av BSA (20 mg/mL) i PBS og rugende platen i 2 timer ved romtemperatur.
  4. Vask plate tre ganger med PBS-T etterfulgt av tre ganger med PBS. Antigener kan også covalently merket og brukes i fangst systemer som for eksempel streptavidin/biotin systemer.
  5. Pre-spandere det phage løsningen (100 µL) med 100 µL av 40 mg/mL BSA i PBS på en vibrerende plattform ved romtemperatur for 30 min.
  6. Legg phage løsningen antigen belagt brønner og ruge med mild agitasjon for 2 timer ved romtemperatur. Bruke flere brønner for å sikre totalt 1011 phage for hver antigen.
  7. Forkaste ubundet phage av inversjon og deretter vaske brønnene fem ganger med 200 µL av PBS-T etterfulgt av fem ganger med PBS.
  8. Elute den bundne phage ved å legge til 0,1 mL av 0,25 mg/mL trypsin PBS og rugende i 30 min ved romtemperatur på vibrerende plattformen på 700 rpm.
  9. Overføre løsningen til ampuller som inneholder 5 µL 4 mg/mL 4-benzenesulfonyl fluorid hydrochloride(AEBSF) løsningen å slukke trypsin aktivitet.
  10. Vokse TG1 phage skjerm kompetent cellene på 37 ° C med skjelvende til OD600 = 0,5.
  11. Legge til 50 µL av elut phage i 3 mL TG1 cellene.
  12. Ruge på 37 ° C uten risting i 30 min.
  13. Legge til 7 mL av LB media med 100 µg/mL ampicillin, 2% glukose.
  14. Riste natten på 37 ° C.
    Merk: For å få mest mangfoldige enkelt domene antistoffer, kan kloner være sekvensert testet for egenskapene og utnyttet etter en runde med panorering. For å oppnå det høyeste affinitet enkelt domene antistoffer, skal to rundene panorering benyttes.
  15. Plate bakterier etter overnatting vekst på LB agar plater supplert med 100 µg/mL ampicillin, 2% glukose. Flere serielle fortynninger må å bli testet, starter med to fortynninger, plating 100 µL av 1/10 000 og 1/100 000 fortynninger.
  16. Inkuber platen overnatting på 37 ° C.
  17. Velg koloniene og vaksinere brønnene i et sterilt 96-brønns plate inneholder 100 µL av 2XYT med 100 µg/mL ampicillin, 2% glukose, 10% v/v glyserol per brønn.
  18. Ruge over natten på 37 ° C uten å riste.
  19. Neste dag, riste på 170 rpm på 37 ° C for 60 min.
  20. Fjerne 2 µL av media i PCR rør. Gjenværende løsningen kan igjen i platen og lagret på 4 ° C for 1-2 dager eller frosset og lagret på-80 ° C for senere bruk.
  21. Utføre PCR reaksjon med primere passer for vektoren utnyttet. PCR screening av positiv kloner bruker primer som flanken flere kloning området er pMES4, CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC og GGTGGTGTGAGGAGACGGTGACCTG. Bruke sykling betingelser egnet for polymerase brukt, en annealing temperatur på 57 ° C og 30 sykluser.
  22. Analysere PCR reaksjonen ved å kjøre en 1% (w/v) agarose gel. Koloniene som er positive har enkelt domene antistoff genet setter ~ 500 bp. sikre at positiv kloner er 20-50% av utvalget.
    Merk: Denne metoden gir et middel for klone valg og analyse som kan utføres i de fleste forskningslaboratorier. Alternativt, neste generasjons sekvensering kan brukes og gir store datasett som tillater statistiske og komparativ analyse16.
  23. Vaksinere positiv kloner fra platen inn frisk rørene som inneholder 7 mL av LB med 100 µg/mL ampicillin.
  24. Vokse med risting for overnatting på 37 ° C.
  25. Utføre en miniprep på kulturen å få plasmider DNA.
  26. Sekvens positiv kloner med standarden sekvensering primer pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC).
  27. Utføre beregningsformelen analyser på resulterende enkelt domene antistoff sekvenser. Kontroller at det finnes ingen stopp kodon eller rammen flyttes.
  28. Klassifisere resulterende sekvenser for likhet og mangfold. Sekvensene som identifiseres gjentatte ganger er mest sannsynlig å være høy affinitet bindende sekvenser, spesielt etter to runder med valg.
  29. Express enkelt domene antistoffer bruker en BL21-avledet uttrykk stamme av E. coil. Indusere uttrykk gjennom tillegg av IPTG, vokser over natten på 22 ° C.
  30. Rense enkelt domene antistoffer bruker immobilisert metall affinitet kromatografi (IMAC).
  31. Validere enkelt domene antistoff/antigen bindende ved hjelp av en direkte interaksjon analysen som rykk-ned, innfødte gel geleelektroforese eller ELISA.
  32. Kontrollere programspesifikke enkelt domene antistoff ytelse, som for det bestemte eksperimentet.

Representative Results

Protokollen presenteres her ble benyttet for å generere enkelt domene antistoffer mot en rekke protein antigener. Fem antigener utnyttet per alpaca. Immun overvåking indikerte at fleste antigener viste robust reaksjon begynnelsen på tre uker (figur 1). Produksjon utfallende og biblioteket bygging etter ca seks uker gir den beste balansen for dyr som har flere antigener injisert. To rundene panorering ble utført for hver antigen og isolert kolonier vist (figur 2). Sekvensering av positiv kolonier identifisert ulike enkelt domene antistoff sekvenser for de forskjellige antigener. For eksempler var tre unike kloner isolert til referanse antigen Maltose bindende Protein (MBP) (figur 3A). Som er ofte observert, inneholder enkelt domene antistoffer betydelige variasjonen og svært variabel CDR3 lengde (Figur 3). Disse funksjonene er spesielt viktig i enkelt domene antistoff/antigen interaksjoner som sett i de referanse enkelt domene antistoff/CX3CL1 komplekse17 (figur 3B).

Flertallet av full lengde enkelt domene antistoff sekvenser kan uttrykt og renset på 1-10 mg/L av kultur (figur 4A). På grunn av mangfoldet i CDR3 lengde viser ulike enkelt domene antistoffer liten variasjon i molekylvekt. Bekreftelse direkte bindende og programmet ytelse er avgjørende. For eksempel etter to runder av markeringen mot Antigen B identifisert et panel av enkelt domene antistoffer ble (figur 2). Flere identiske sekvenser ble identifisert, og enkelt domene antistoffer ble produsert og renset. Det var da testet via direkte trekke ned med antigen affinitet harpiks og viste robust doseavhengig binding (figur 4B). Viktigere, viste enkelt domene antistoffer ingen binding til å kontrollere harpiks. Disse dataene viser en direkte bindende interaksjon, og som er godt egnet for affinitet fange i både rullegardinmenyen og ELISA-baserte formater.

Figure 1
Figur 1 : Representant immun overvåking av to forskjellige antigener viser betydelig spesifikk immunrespons mot forskjellige antigener i samme dyret. Mange antigener viser robust reaksjon så tidlig som i tre uker etter begynner immunisering, med de fleste viser maksimal svar etter seks uker. Seks uker også tillater affinitet modning og er den anbefalte tiden for produksjon blø og B-celle isolasjon. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : PCR-baserte bekreftelse av positiv kloner. Primere span MCS av pMES4 vektoren, og en positiv nanobody klone produserer en amplicon ~ 500 bp (merket med *). Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Antigen-spesifikke sekvenser markere alpaca enkelt domene antistoff mangfold. (A) justering velger ett domenenavn antistoff sekvenser isolert å MBP med en referanse enkelt domene antistoff 4XT1, rammeverket og komplementaritet-bestemme regioner (Kabat) uthevet nedenfor. (B) strukturen i alpaca enkelt domene antistoff 4XT1 bundet til CX3CL1 (PDB 4XT1), understreker den kritiske rollen variabel CDR looper i spesifikke antigen bindende. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : Rensing og validering av enkelt domene antistoffer. (A) SDS side av IMAC renset enkelt domene antistoffer, sammenligne ulike enkelt domene antistoffer. Ulike molekylvekt er hovedsakelig på grunn av varierende lengde av CDR3 loop. Ulike nivåer av uttrykket er også observert, med et mindretall av enkelt domene antistoffer viser dårlig avkastning renset protein. (B) bekreftelse direkte bindingen bruke en antigen affinitet rullegardinmenyen. Robust doseavhengig enkelt domene antistoff bindingen er observert med antigen-kombinert harpiks, men ikke med kontroll harpiks. Klikk her for å se en større versjon av dette tallet.

Discussion

Som nevnt, høy affinitet og spesifisitet av enkelt domene antistoffer, kombinert med sin lettvinte uttrykk og stabilitet, gjør dem ideelle reagensene programmene i biomedisinsk forskning, som viktige biokjemiske reagenser, diagnostiske verktøy, eller terapeutiske agenter18. Kommersielle programmer er det noen problemer relatert til intellektuell eiendom som må vurderes. I tillegg kan enkelt domene antistoffer være konstruert for å inneholde bestemte markører eller koder som kan brukes som journalister i mobilnettet analyser eller diagnose. Nøkkelen til disse bruksområdene er evnen til å produsere bestemte enkelt domene antistoffer mot antigener rundt. En metode beskrives her for å produsere ett domenenavn antistoffer bruker Alpakka, som produserer en robust immunrespons mot en rekke protein antigener. Betraktninger for dyr håndtering og forskriftene er beskrevet. Dette er nøkkelen for å lykkes i denne delen av prosessen.

Det er andre strategier for å produsere ett domenenavn antistoffer som ikke krever immunisering, men i stedet bruke halvsyntetisk biblioteker med forskjellige systemer for valg og iterativ optimalisering slektskap19,20 . Fordelen med å bruke biblioteker fra vaksineres dyr er imidlertid muligheten til å pålitelig isolere svært beriket, variert og høy affinitet enkelt domene antistoffer. I tillegg ikke bare er betydelig sekvens variasjoner observert, men av bestemte enkelt domene antistoffer isolert hadde unike innsettinger og slettinger, spesielt i CDR3.

Videre, enkelt domene antistoffer kan produseres via en enkel prosess som bare krever liten injeksjoner av antigen, og etter denne prosessen, dyrene kan returneres til flokken. Av notatet, dyret kan brukes fritt for fiber produksjon, men skal utelates som kjøtt (menneskelige næringskjeden) på grunn av bruk av testen antigener og ikke-FDA godkjente adjuvant for enkelt domene antistoffproduksjon. Når prosedyren er fullført, kan dyrene bør overvåkes for en uke, gitt en veterinær eksamen, og deretter enten tilbake til gården deres hjem eller hvilte i seks måneder før en ny runde med enkelt domene antistoffproduksjon.

Disclosures

Dr. Whiteheart og Hersh på University of Kentucky og drive en kjerne i midten for molekylær medisin som produserer enkelt domene antistoffer i alpaca som et gebyr-for-service.

Acknowledgments

Dette arbeidet ble støttet av National Institutes of Health (P30GM103486).

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Immunisering Alpakka (<em>Lama Britis</em>) med Protein antigener og produksjon av Antigen-spesifikke enkelt domene antistoffer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter