Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Kvantitative Polymerase Chain Reaction-baserede analyser af Murine tarmens mikrobiota efter peroral antibiotisk behandling

doi: 10.3791/58481 Published: November 17, 2018

Summary

Her leverer vi detaljerede protokoller til oral administration af antibiotika til mus, samling af fækal prøver, DNA-ekstraktion og kvantificering af fækal bakterier af qPCR.

Abstract

Gut mikrobiota har en central indflydelse på menneskers sundhed. Mikrobielle dysbiosis er forbundet med mange fælles immunopathologies som inflammatorisk tarmsygdom, astma og gigt. Dermed, forståelse af de underliggende mikrobiota immunsystemet krydstale mekanismer er af afgørende betydning. Antibiotika administration, mens medvirken patogen clearance, også inducerer drastiske ændringer i størrelse og sammensætning af intestinale bakterielle samfund, som kan have en indvirkning på menneskers sundhed. Antibiotisk behandling i mus sammenfatter indflydelse og langsigtede ændringer i menneskelige mikrobiota fra antibiotisk behandlede patienter, og giver mulighed for undersøgelse af de mekaniske forbindelser mellem ændringer i mikrobielle samfund og immun cellefunktion. Mens flere metoder for antibiotisk behandling af musene er blevet beskrevet, fremkalde nogle af dem alvorlig dehydrering og vægttab komplicerer fortolkningen af data. Her give vi to protokoller for oral antibiotika administration, som kan bruges til langtidsbehandling af mus uden inducerende store vægttab. Disse protokoller gør brug af en kombination af antibiotika, der er rettet mod både Gram-positive og Gram-negative bakterier og kan leveres enten ad libitum i drikkevandet eller ved mundtlig sonde. Desuden, vi beskriver en metode til kvantificering af mikrobielle tæthed i fecal prøver af qPCR, som kan bruges til at validere effekt af antibiotisk behandling. Kombination af disse metoder giver en pålidelig metode til manipulation af tarmens mikrobiota og undersøgelse af virkningerne af antibiotisk behandling hos mus.

Introduction

Den pattedyr gastrointestinale mucosa er et unikt miljø koloniseret af en meget kompleks blanding af mikroorganismer, der opretter en mutualistic relation med værten. Forsvarssystem af tarmslimhinden består af en epitel lag og en overflod af immunceller, der begrænser latente i tarmen samtidig bevare deres antal og mangfoldighed. Omvendt, commensal organismer er nødvendige for udviklingen af et velfungerende immunsystem. Mens samspillet mellem vært og commensal bakterier er normalt gavnlige, bliver det stadig tydeligere, at dysregulated immunsystemet-mikrobiota krydstale kan favor udvikling af kroniske inflammatoriske sygdomme, sådan asinflammatory tarm sygdom, gigt eller astma1,2.

Gut mikrobiota kan ændres af forskellige faktorer, men måske de mest drastiske ændringer er induceret af antibiotisk behandling, som alvorligt ændrer både størrelse og sammensætning af bakterielle samfund3,4. Mens fordelene ved antibiotika til behandling af infektioner er ubestridelige, kan mikrobiota ændringer foranlediget af antibiotisk eksponering hos mennesker også ændre immun forsvar, hvilket kan føre til skadelige virkninger på sundhed. For eksempel, antibiotisk behandling hos mennesker er blevet forbundet med en øget risiko for Clostridium difficile-induceret diarré, astma og visse former for kræft3. Antibiotisk behandling i mus sammenfatter indflydelse og langsigtede ændringer i gut Fællesskaber af antibiotika-behandlede patienter, og har aktiveret undersøgelse af de mekaniske forbindelser mellem ændringer i mikrobielle samfund og immun cellefunktion. Flere rapporter har dog vist, at administration af antibiotika på drikkevand ad libitum resulterer i meget mærkbar vægttab som mus afstå fra drikkevand, formentlig på grund af dens foul smag5,6. Således i disse modeller kan svær dehydrering samtidige mundtlige antibiotika administration komplicere fortolkningen af eksperimenter med henblik på at identificere effekten af antibiotikabehandling i immun cellefunktion.

Flere metoder kan bruges til at udforske størrelse og sammensætning af mikrobielle samfund i tarm rum7. Next generation sequencing teknologier har givet uvurderlige data om denne sag8, men disse metoder er forholdsvis dyre og kræver ekspert bioinformatic analyser for fortolkning af data. På den anden side traditionelle mikrobiologiske kultur metoder giver mulighed for påvisning af bakteriearter, men de har lav følsomhed og en stor del af commensal bakterier (især anaerober) er meget vanskeligt eller umuligt at dyrke med i øjeblikket tilgængelige metoder8. Kvantitative polymerase kæde reaktion (qPCR) teknikker der bruges i stigende grad til kvantificering og identifikation af fækal bakteriearter, da de giver en hurtig og pålidelig kultur-uafhængig måling af total mikrobielle belastning. I overensstemmelse hermed, qPCR metoder har vist sig nyttige til at studere ændringer i mikrobiota forbundet med alder eller progression af flere sygdomme herunder inflammatoriske tarm sygdom9,10. I overensstemmelse hermed giver qPCR metoder en hurtig og omkostningseffektiv metode til at validere effekten af forskellige behandlinger (herunder antibiotika) i fecal bakteriel belastninger og mikrobiota sammensætning10,11,12.

Her præsenterer vi en detaljeret trinvis redegørelse af to adskilte protokoller for oral antibiotika administration til mus, fækal prøvetagning, DNA-ekstraktion, udarbejdelse af standarder og kvantificering af bakterier i fecal prøver af qPCR. Disse protokoller levere en pålidelig metode til at manipulere den tarmens mikrobiota i mus og studere virkningerne af antibiotikabehandling i tarm homøostase og sygdom.

Protocol

Eksperimenter beskrevet her blev udført ved hjælp af 6-8 uger gamle vildtype (C57BL6/J) mus opretholdt i en specifik pathogen gratis (SPF) facilitet. Alle dyreforsøg blev godkendt ved King's College London og Francis Crick Institute dyrs velfærd og etisk klageinstansen og Storbritannien Home Office. Forud for begyndelsen nogen dyr procedure, sikre at de relevante tilladelser er opnået gennem den lokale institution/organisation.

1. administration af antibiotika

Bemærk: To alternative metoder for behandling med antibiotika er givet: mundtlig sonde (trin 1.1) og administration af antibiotika via drikkevand (trin 1.2).

  1. Mundtlige sonde
    1. Forberede bestande af individuelle antibiotika ved at opløse dem i autoklaveres vand på følgende koncentrationer: Ampicillin på 100 mg/mL, Gentamicin på 100 mg/mL, Neomycin på 100 mg/mL, metronidazol på 10 mg/mL og Vancomycin på 100 mg/mL. Filter sterilisere ved hjælp af et 0,45 µm filter. Alikvot og opbevares ved-20 ° C.
    2. Forberede en cocktail af antibiotika ved at blande bestandene forberedt ovenfor. For et volumen paa 1 mL Bland 50 µL af Ampicillin (5 mg/mL endelige), 50 µL af Gentamicin (5 mg/mL endelige), 50 µL af Neomycin (5 mg/mL endelige), 500 µL af metronidazol (5 mg/mL endelige), 25 µL af Vancomycin (2,5 mg/mL endelige) og 325 µL vand. Forberede den cocktail friske før brug.
    3. Indlæse den antibiotiske mix i en steril 1 mL sprøjte og fastsætte en passende gauge sonde nål (20 G for 15 – 20 g mus) samtidig fjerne eventuelle bobler.
    4. Mavesonde mus med 200 µL af antibiotika mix.
      1. Få fat i huden over musen skulder fast, strække hoved og hals til at glatte spiserøret. Direkte bolden-spidsen af fodring nålen langs taget af munden og mod bagsiden af svælget. Derefter forsigtigt passere det ned i spiserøret og tilføre 200 μl løsningen.
    5. Administrere den antibiotiske cocktail én gang dagligt for varigheden af forsøget.
  2. Antibiotika i drikkevandet
    Forsigtig: Omhyggeligt overvåge musen vægt dagligt i de første to uger af antibiotika administration i drikkevandet.
    1. Forberede en cocktail af antibiotika ved at opløse følgende i 1 L autoklaveres vand: 1 g af Ampicillin (1 g/L endelige), 1 g af Neomycin (1 g/L endelige), 1 g af metronidazol (1 g/L endelige), 0,5 g af Vancomycin (0,5 g/L endelige) og 8 breve (0,75 g hver) af kunstige sødemiddel (60 g/L endelige). Ryst indtil opløst. Opbevares ved 4 ° C.
      Bemærk: Sødestof føjes til skjule smag af antibiotika og forhindre mus dehydrering. Mens flere sødestof mærker kan arbejde, kan den endelige koncentration, der kræves være forskellige for hver specifik mærke.
    2. Fylde den antibiotiske cocktail til en vandflaske (~ 100 mL/bottle) og læg flasken på en mus bur.
      Bemærk: Brug brune flasker eller dække flasker med folie for at beskytte antibiotika mod lys.
    3. Erstatte den antibiotiske cocktail med friske stock to gange om ugen for varigheden af forsøget.

2. indsamling af fækal prøver fra skammel, Ileum indhold og Ileum væg

  1. Vejer og etiket 2 mL autoklaveres rør for prøvetagning.
  2. Til samling af friske afføringsprøver, opstille hver mus i en Tilbageholderen og indsamle fækal træpiller direkte fra anus i en collection tube.
    Bemærk: Prøver kan også opnås ved at placere mus i en ren autoklaveres bur, og indsamle afføringsprøver med ren steriliseret pincet.
  3. Aflive mus med CO2 kvælning efterfulgt af cervikal dislokation.
  4. Lægge en mus slagtekroppen med maven fuldt eksponeret og spray abdominale område med 70% ethanol.
  5. Brug saks og steriliseret pincet, lave et tværgående snit i maven til at udsætte bughinden uden at beskadige nogen indre væv. Løft bughinden og gøre et snit til at eksponere tarmene.
  6. Fjerne tarmene (fra tyktarmen til maven) med saks og pincet og placere det i en steril petriskål.
  7. Omhyggeligt bruge pincet til at drille tyndtarmen (SI) fra mesenteriallymfeknuderne arterier og fedt. Udvide tarmen og placere den på en ren lab tørre.
  8. Med en lineal, måle og skære 4 cm af den distale ileum af SI (den nærmeste del til coecum). Klip og kassér 1 cm af tarmen proksimalt for coecum. Der vil være en 3 cm del af ileum venstre, som vil blive brugt til at indsamle tarmbakterier.
  9. Holde ileum del (3 cm) over en 2 mL sterilt tube. Indsamle de tarmindholdet ved direkte strengpresning tarmen og colleting prøven i røret. I dette eksempel vil have bakterier fra ileum indhold.
  10. Forberede en 20 mL sprøjte med kolde fosfatbufferet saltopløsning (PBS) og skyl ileum del (kassere gennemstrømnings-).
  11. Placer ileum del på et rent stykke køkkenrulle og åbne den på langs med en saks.
  12. Skrabe indersiden af ileum væggen med en skalpel.
  13. Indsamle eventuelle bakterier på skalpel ved at vaske skalpel med 1 mL PBS over en ren centrifugeglas. Spin på 8.000 × g for 5 min pellet bakterier og supernatanten. I dette eksempel vil indeholde bakterier fra ileum væg.
    Bemærk: Fækal prøver fra skammel, ileum indhold og væg kan være frosset og opbevares ved-80 ° C indtil brug.
  14. Vejer de rør, der indeholder prøver fra afføring og ileum indhold, og fratræk vægten fra de tomme rør (fra trin 2.1) for at opnå den fækal vægt i hver prøve.
  15. Uddrag bakteriel DNA fra skammel, ileum indhold og ileum væg prøver ved hjælp af kommercielt tilgængelige kits. Gemme DNA-prøver ved-20 ° C indtil brug.

3. kvantificering af tarmens mikrobiota af qPCR

Bemærk: Denne procedure omfatter generation af en standard (trin 3.1) og metoden for qPCR set-up for standard og fækal prøver (trin 3.2)

  1. Generation af en standard for qPCR
    1. Bruge Polymerasekædereaktionen (PCR) til at forstærke 16S rRNA gen fra genomisk DNA ekstraheret fra en bakteriel kultur ved hjælp af reagenser13 og PCR betingelser beskrevet i tabel 1.
    2. Køre PCR produkt på en 1,5% agarosegel og rense DNA bandet ved hjælp af en kommercielt tilgængelig DNA udvinding kit.
    3. Ligate den oprenset DNA fragment bruger en kloning kit (Se Tabel af materialer, bruge en vektor, der indeholder antibiotikaresistensmarkører og β-galactosidase (LacZ) gen fusion for blå/hvid koloni udvalg) og omdanne DH10 kompetente E. coli efter fabrikantens anvisninger. Plade transformation på Ampicillin (100 µg/mL), X-gal (20 µg/mL) Luria Bertani (LB) agar plader (10 g/L trypton, 5 g/L gærekstrakt, 10 g/L NaCl, 15 g/L Agar). Der inkuberes natten over (O/N) ved 37 ° C.
    4. Vælg en enkelt positiv (hvid) koloni fra pladen. Podes det i 5 mL LB bouillon indeholdende 100 µg/mL Ampicillin og O/N der inkuberes ved 37 ° C, rysten på 250 rpm.
    5. Fra O/N kultur, isolere og rense plasmid ved hjælp af en kommerciel miniprep kit ifølge producentens anvisninger.
      Bemærk: Det er vigtigt at sekvens plasmidet indsætte på dette stadium, til at sikre, at plasmidet indeholder kun én kopi af 16S rRNA gen og bestemme dens længde i basepar (bp).
    6. Linearize plasmid med en restriktion enzym, som skærer plasmidet kun én gang.
    7. Rense den lineariseret plasmid ved hjælp af et kommercielt tilgængeligt kit.
    8. Bestemme koncentrationen af plasmidet ved måling af absorbans ved 260 nm med et spektrofotometer.
    9. Beregne antallet af plasmid kopier/µL af prøven ved hjælp af den følgende formel14:
      Antal kopier = (beløb * 6.022 × 1023) / (længde * 1 × 109 * 650)
      hvor beløb er DNA-koncentrationen fremstillet i trin 3.1.8 (i ng/µL); og længde er den samlede længde af plasmid (med indstik) i bp. Antallet af kopier vil blive opnået som kopier/µL.
      Bemærk: Der er online værktøjer baseret på ovenstående formel, der giver nem beregning af antallet af plasmid kopier.
    10. Alikvot og butik standard efter behov ved-20 ° C indtil brug.
  2. qPCR Set-up for Standard og fækal prøver
    1. Tø qPCR standard (fra trin 3.1.10), fækal prøver DNA (fra trin 2.15) og qPCR reagenser (fra et kommercielt tilgængeligt kit) på is.
      Bemærk: qPCR reagenser, der anvendes i dette eksempel omfatter SYBR Green qPCR mastermix og forward og reverse primere (tabel 2).
    2. Fortyndet standard i sterile DNA-frit vand i et område fra 107 til 102 kopier/µL (f.eks. 1/5 serielle fortyndinger fra 107 til 6,4 x 102 kopier/µL). Fortynd fækal prøve DNA til 1/2, 1/5, 1/10.
    3. Gøre en master mix reaktion for det samlede antal reaktioner plus 1 (tabel 2).
    4. Mix 30 µL af den master mix og 5 µL af skabelon (standard, prøve eller vand til negativ kontrol)
    5. Tilsæt 10 µL af denne blanding til hver brønd i en 384-godt optisk qPCR plade. Udføre hver reaktion i tre eksemplarer.
    6. Forsegle qPCR sted, centrifugeres kort og indlæse plade på qPCR maskinen programmeret med følgende cykling betingelser: 95 ° C i 20 min. efterfulgt af 40 cyklusser af 95 ° C til 15 s og 60 ° C i 1 min.
    7. Få CT -værdier for standard og prøver.
    8. Generere en standardkurve ved at plotte CT -værdier for standarder versus logaritme antal kopi af plasmidet (som beregnet i trin 3.1.9). Udføre lineal regression af standardkurven.
    9. Beregne 16S rDNA kopi numre for fækal prøver ved interpolering CT værdier (fremstillet i trin 3.2.2) i standardkurven.
      Bemærk: 16S rDNA kopi numre for hver prøve skal korrigeres overvejer fortyndingsfaktoren af prøven (som udarbejdet i trin 3.2.2), de endelige rumfang nukleinsyrer, der blev elueret (i trin 2.15) og mængden af fækal prøve (beregnet i trin 2.14) at opnå gen kopier pr. gram af afføring.

Representative Results

Her giver vi to alternative protokoller for peroral antibiotisk behandling af mus. Figur 1 viser procent af kropsvægten (relateret til oprindelige base line vægt for hvert dyr) i mus behandlet med antibiotika mundtlig sonde (rød) eller i drikkevand (blå) i 10 på hinanden følgende dage. Ingen mærkbar vægttab er fundet i mus, der får antibiotika af mundtlige sonde. Men når mus behandlet med antibiotika ad libitum i drikkevandet, de tabe sig (~ 10%) inden for de første par dage af antibiotika administration, men gendanne normal vægt gevinst derefter (figur 1). Ikke desto mindre, omkring 5-10% af mus modtage antibiotika i drikkevandet kan nå > 20% vægttab i den første uge af behandling, i hvilket tilfælde de er euthanized.

Kvantificering af bakterier i fecal prøver kræver brug af en passende standardkurve, der er fremstillet ved plotte log af kopi nummer for standard (som beregnet i trin 3.2.2) versus CT værdier opnået fra qPCR (trin 3.2.7). Figur 2A viser et repræsentativt eksempel fra en standardkurve, som opfylder standardkurven resultatkriterierne med et F2 værdi af 0.99827, en skråning af-3.09 og en effektivitet ((-1 + 10^(-1/slope))*100) på 110%. R2 værdier af 0,99 og PCR effektivitetsgevinster inden for området af 90 til 110% er at foretrække. Inden for det lineære område muliggør analyse regressionsligningen kvantificering af 16S rDNA overflod inden for fækal prøverne. Figur 2B viser antal 16S rDNA kopier i fecal taburet, SI indhold og SI væg. I figur 2B vises data som 16S rDNA kopier/g fækal prøve for fækal afføring og SI indhold. For SI væg præsenteres data som samlede antal 16S rDNA kopier fremstillet af bakterier inddrives fra 3 cm af SI væg (som antallet startende materiale er for lille til at opnå en præcis vægt).

For at evaluere effekten af antibiotika på tætheden af bakterier i fecal prøver, mus blev behandlet med antibiotika af mundtlige sonde dagligt i 10 dage (dage 1 til 10) og afføringsprøver blev indsamlet før (dag 0), på forskellige tidspunkter under behandling med antibiotika ( dage 5 og 10), og 7 dage efter ophør med antibiotika administration (dag 17; Figur 3A). Som vist i figur 3B, inducerer antibiotisk behandling en stærk nedgang i antallet af 16S rDNA kopier/g af afføring opdaget på dage 5 og 10, mens tætheden af bakterier i afføring inddrives til normale niveauer (sammenlignelige forbehandling) 1 uge efter antibiotika administration blev stoppet (dag 17).

Figure 1
Figur 1: Administration af antibiotika. Mus fået antibiotika mundtlig sonde (rød) eller i (blå) drikkevand i 10 på hinanden følgende dage. Plot viser vægte af mus i hele varigheden af eksperimenter i forhold til oprindelige vægt før antibiotika administration (dag 0). Data er vist som gennemsnit ± SEM. venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: 16S rRNA gen qPCR forstærkning af standarder og fækal prøver. (A) lineær regression af standardkurven med standardkurven deskriptorer. (B) beregning af genet mængder fra fecal prøver. Data er vist som gennemsnit ± SEM. venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: fækal bakterier i løbet af antibiotikabehandling. (A) skematisk af tidsplanen for antibiotika administration af oral sonde (Ab) og prøve samling som afbildet med *. (B) 16S rDNA kopier pr. gram afføring i afføringsprøver fra mus, der opsamlet på de angivne dage. Data er vist som gennemsnit ± SEM. venligst klik her for at se en større version af dette tal.

Reagens Volumen
DNA 8 ΜL
Buffer 10 X 2 ΜL
dNTP'er (10mM) 0,4 ΜL
Eubacteria - F primer (10 mM) 1 ΜL
Eubacteria - R primer (10 mM) 1 ΜL
Taq Polimerase 0.2 ΜL
H2O 7.4 ΜL
Samlede volumen 20 ΜL
Primer sekvenser
Eubacteria - F primer 5' ACTCCTACGGGAGGCAGCAGT 3'
Eubacteria - R primer 5' ATTACCGCGGCTGCTGGC 3'
Cykling betingelser
Temperatur Tid Cykler
94 ° C 5 min 1 x
94 ° C 30 s 30 x
60 ° C 30 s 30 x
72 ° C 1 min 30 x
72 ° C 5 min 1 x
4 ° C 1 x

Tabel 1: PCR reagenser og betingelser. Denne tabel indeholder de reagenser og PCR cykling betingelser til at forstærke 16S rRNA gen fra bakteriekulturen til generering af en standard at bruge i qPCR assays. Primer sekvenser blev oprindeligt udgivet af Kruglov et al. 13.

Reagens Volumen
SYBR Green master mix (2 x) 17,5 ΜL
Eubacteria - F primer (10 mM) 0,7 ΜL
Eubacteria - R primer (10 mM) 0,7 ΜL
H2O 11,1 ΜL

Tabel 2: qPCR master mix. De mængder, der er vist (endelige rumfang 35 µL) er på en enkelt prøve at køre på tre eksemplarer (10 µL) på en 384-godt qPCR plade (tegner sig for 5 µL ekstra for pipettering fejl). Beløbet kan skaleres afhængig af antallet af prøver der skal analyseres.

Discussion

Her leverer vi eksperimentelle protokoller til oral administration af antibiotika til mus og kvantificering af fækal bakterier af qPCR. Kombinationen af antibiotika anvendes i denne protokol (indeholdende ampicillin, gentamycin, neomycin, metronidazol og vancomycin) mål både Gram-positive og Gram-negative bakterier, tilbyder bakteriedræbende aktivitet mod et fuldt spektrum af bakterier. Både oral sonde og administration af antibiotika i drikkevandet i høj grad mindske fækal bakteriel indlæse5,6,12. Desuden har begge behandlinger en dybtgående indvirkning på Fænotypen af mus som de udvikler flere karakteristika typisk af Kim-fri mus herunder reduceret milt størrelse og udvidede coecum. Udvælgelsen af en bestemt metode til administration af antibiotika kan eventuelt afhænge af længden af eksperimentet som mundtlige sonde metoden kræver daglig administration af antibiotika, bliver mere arbejdskrævende og muligvis forårsager mere ubehag til den dyr i det lange løb.

For administrationen af antibiotika i drikkevandet udvises forsigtighed med tilsætning af sødemiddel til antibiotika blandingen som det er afgørende at holde mus fra dehydrering. Flere grupper har vist, hvordan administration af antibiotika i drikkevand (uden tilsætning af sødemiddel) fører til meget svær og hurtig vægttab med alle mus at miste mere end 20% af oprindelige kropsvægt inden for de første par dage af eksperiment5 , 6. i vores protokol, brug af sødemidlet sakkarin-baserede syntes at være tilstrækkelig til at maskere den antibiotiske smag i vand og mus tabte sig i de første par dage efter antibiotika administration, men genvundet deres vægte hurtigt efter at ( Figur 1). Ikke desto mindre, i vores forsøg 5-10% af mus stadig nå den menneskelige farveprøve af > 20% tab af baseline kropsvægt og skulle aflives. Vi har også testet sucralose-baserede sødestoffer, der har helt undladt at forhindre mus dehydrering (100% af mus tabte > 20% af vægten) mens andre forfattere har publiceret lignende fiaskoer for aspartam-baserede sødestoffer5,6. Føjes til dette, bør alder, genetiske baggrund og generelle sundhedstilstand mus bruges til forsøgene overvejes, da de kan påvirke vægttab og dyrs velbefindende under behandling med antibiotika. Således skal nøje overvågning af mus vægt og generelle sundhedstilstand udføres dagligt i de første to uger af oral antibiotika administration.

qPCR metoder giver en hurtig og omkostningseffektiv metode til kvantificering af 16S rRNA i fecal prøver. Dog nogle begrænsninger bør betragtes med hensyn til denne teknik herunder: Jeg) kravet om en pålidelig høj kvalitet standard; II) af design og effektiviteten af qPCR primere; III), at mikroorganismer kan have forskellige kopi numre af 16S rRNA gen, således gen kopier kan ikke direkte lig celle tæller15. Ikke desto mindre qPCR er en robust og følsom metode, som muliggør hurtig analyse af fækal prøver. Denne metode kan være særlig nyttig for hurtigt validere effekten af forskellige behandlinger (herunder antibiotika) i fecal bakteriel belastninger nemlig indgåendeher ovre. Desuden, selv om vi leverer en protokol til kvantificering af samlede 16S rRNA, denne metode kan let tilpasses (ved at designe specifikke primere16) identifikation af individuelle bakteriel taxa, hvilket giver både kvantitative og kvalitative oplysninger om microbiome størrelse og sammensætning.

I sammendrag, har vi givet to protokoller for oral antibiotikabehandling mus og en qPCR-baseret metode til kvantificering af antibiotika-inducerede ændringer i fecal bakterier. Selv om disse protokoller kan være yderligere optimeret og kombineret med andre metoder efter individuelle eksperimentelle behov, kan de tjene som hurtige, omkostningseffektive og pålidelige værktøjer til at manipulere den murine tarmens mikrobiota og studere virkninger af antibiotisk behandling i tarm homøostase og sygdom.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Dette arbejde blev støttet af den britiske Medical Research Council (tilskud til P.B. hr./L008157/1); R.J. blev støttet af et Marie Curie intraeuropæisk stipendium (H2020-MSCA-IF-2015-703639); P.M.B. blev støttet af en studentship fra britiske Medical Research Council og King's College London ph.d.-uddannelse partnerskab i biomedicinske videnskaber (hr./N013700/1).

Materials

Name Company Catalog Number Comments
Ampicillin sodium salt Sigma-Aldrich (Merck) A9518
Neomycnin trisulfate salt hydrate Sigma-Aldrich (Merck) N1876
Metronidazole Sigma-Aldrich (Merck) M3761
Vancomycin hydrochloride Sigma-Aldrich (Merck) V2002
Gentamicin sulfate salt Sigma-Aldrich (Merck) G3632
Tryptone Sigma-Aldrich (Merck) T7293
Yeast Extract Sigma-Aldrich (Merck) Y1625
NaCL Sigma-Aldrich (Merck) S7653
Sweetener Sweet'n Low Sweet'N Low Available in the UK from Amazon.co.uk
X-Gal (5-brom-4-chloro-3-indoyl B-D-galactopyranoside) Fisher scientific 10234923
Phosphate Buffered Saline  Thermo Fisher Scientific (Gibco) 10010023
Ultrapure Agarose Thermo Fisher Scientific (Invitrogen) 16500500
RT-PCR grade water Thermo Fisher Scientific (Invitrogen) AM9935
Phusion High-Fidelity DNA Polymerase New England BioLabs M0530
Deoxynucleotide (dNTP) Solution Mix New England BioLabs N0447
iTaq Universal SYBR Green Supermix Bio-Rad 1725124 with ROX
TOPO TA cloningTM for sequencing Thermo Fisher Scientific (Invitrogen) 450030
QIAamp fast DNA Stool mini kit  Qiagen 51604
QIAprep spin Miniprep kit Qiagen 27106
QIAquick gel  extraction kit Qiagen 28704
Syringe filter 0.45 µm Fisher scientific 10460031
Swann-MortonTM Carbon steel sterile scalpel blades Fisher scientific 11792724
Syringe (1 mL) BD Plastipak 303172
Syringe (20 mL) BD Plastipak 300613
1.5 mL Crystal clear microcentriguge tube StarLab E1415-1500
2 mL Ultra high recovery microcentrifuge tube StarLab I1420-2600
Oral dosing needles 20 G x 38 mm curved (pk/3) Vet-Tech DE008A
Sterilin petri dish 50 mm  Scientific Laboratory Supplies PET2020
Absolute qPCR plate seals Thermo Fisher Scientific AB1170
MicroAmpTM optical 384-well plate  Thermo Fisher Scientific (Applied Biosystems) 4309849
ViiA7TM 7 real-time PCR system with 384-well block Thermo Fisher Scientific (Applied Biosystems) 4453536
Spectrophotometer (Nanodrop 1000) Thermo Fisher Scientific ND-1000
Labnet Prism microcentrifuge Labnet C2500
MultiGene Optimax Thermal cycler Labnet TC9610

DOWNLOAD MATERIALS LIST

References

  1. Belkaid, Y., Hand, T. W. Role of the microbiota in immunity and inflammation. Cell. 157, (1), 121-141 (2014).
  2. Hooper, L. V., Littman, D. R., Macpherson, A. J. Interactions between the microbiota and the immune system. Science. 336, (6086), 1268-1273 (2012).
  3. Ubeda, C., Pamer, E. G. Antibiotics, microbiota, and immune defense. Trends in Immunology. 33, (9), 459-466 (2012).
  4. Dethlefsen, L., Huse, S., Sogin, M. L., Relman, D. A. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biology. 6, (11), e280 (2008).
  5. Reikvam, D. H., et al. Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression. PLoS One. 6, (3), e17996 (2011).
  6. Hill, D. A., et al. Metagenomic analyses reveal antibiotic-induced temporal and spatial changes in intestinal microbiota with associated alterations in immune cell homeostasis. Mucosal Immunology. 3, (2), 148-158 (2010).
  7. Fraher, M. H., O'Toole, P. W., Quigley, E. M. Techniques used to characterize the gut microbiota: a guide for the clinician. Nature Reviews Gastroenterology & Hepatology. 9, (6), 312-322 (2012).
  8. Eckburg, P. B., et al. Diversity of the human intestinal microbial flora. Science. 308, (5728), 1635-1638 (2005).
  9. Sokol, H., et al. Low counts of Fecalibacterium prausnitzii in colitis microbiota. Inflammatiry Bowel Diseases. 15, (8), 1183-1189 (2009).
  10. Bartosch, S., Fite, A., Macfarlane, G. T., McMurdo, M. E. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Applied Environmental Microbiology. 70, (6), 3575-3581 (2004).
  11. Ubeda, C., et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation. 120, (12), 4332-4341 (2010).
  12. Saez de Guinoa, J., et al. CD1d-mediated lipid presentation by CD11c(+) cells regulates intestinal homeostasis. EMBO Journal. 37, (5), (2018).
  13. Kruglov, A. A., et al. Nonredundant function of soluble LTalpha3 produced by innate lymphoid cells in intestinal homeostasis. Science. 342, (6163), 1243-1246 (2013).
  14. Wilhelm, J., Pingoud, A., Hahn, M. Real-time PCR-based method for the estimation of genome sizes. Nucleic Acids Research. 31, (10), e56 (2003).
  15. Kembel, S. W., Wu, M., Eisen, J. A., Green, J. L. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Computational Biology. 8, (10), e1002743 (2012).
  16. Yang, Y. W., et al. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces. Applied Environmental Microbiology. 81, (19), 6749-6756 (2015).
Kvantitative Polymerase Chain Reaction-baserede analyser af Murine tarmens mikrobiota efter peroral antibiotisk behandling
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).More

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter