Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Oral antibiyotik tedavisinden sonra fare bağırsak Microbiota nicel polimeraz zincir reaksiyonu tabanlı analiz

doi: 10.3791/58481 Published: November 17, 2018

Summary

Burada biz ayrıntılı iletişim kuralları antibiyotik sözlü yönetimi için fareler, dışkı örnekleri, DNA ekstraksiyon ve miktar dışkı bakteri topluluğu tarafından qPCR sağlar.

Abstract

Gut microbiota insan sağlığı merkezi bir etkisi vardır. Mikrobiyal dysbiosis iltihabi bağırsak hastalığı, astım ve artrit gibi birçok ortak immunopathologies ile ilişkilidir. Böylece, microbiota-bağışıklık sistemi crosstalk yatan mekanizmaları anlama kritik önem taşımaktadır. Antibiyotik yönetim patojen geçiş izni, yardım ederken, aynı zamanda içinde büyüklük ve insan sağlığı üzerindeki etkisi olabilir bağırsak bakteri toplulukları bileşimi köklü değişiklikler neden olmaktadır. Antibiyotik tedavisi farelerde etkisi ve uzun vadeli değişimler insan microbiota antibiyotik tedavi edilen hastaların recapitulates ve soruşturma mikrobiyal topluluklar değişimler ve bağışıklık hücre işlevi arasında mekanik bağlantılar sağlar. Farelerin antibiyotik tedavisi için birkaç yöntem tarif var iken, bazıları ciddi dehidratasyon ve zayıflama verilerin yorumlanması karmaşık hale getiren ikna etmek. Burada, fareler uzun süreli tedavi için önemli kilo kaybı inducing olmadan kullanılabilir oral antibiyotik yönetim için iki protokol sağlamak. Bu protokoller antibiyotik kombinasyonu hedefleyen gram pozitif ve gram-negatif bakteri faydalanmak ve her iki ad libitum içme suyu veya oral gavaj tarafından sağlanabilir. Ayrıca, antibiyotik tedavisi etkinliğini doğrulamak için kullanılan qPCR tarafından miktar dışkı örneklerinde mikrobiyal yoğunluğu için bir yöntem açıklanmaktadır. Bu yaklaşımlardan birleşimini bağırsak microbiota manipülasyon ve farelerde antibiyotik tedavisinin etkileri çalışmanın güvenilir bir yöntem sağlar.

Introduction

Memeli gastrointestinal mukoza ev sahibi ile ilişkilerden bir ilişki kurmak mikroorganizmaların son derece karmaşık bir karışımı tarafından kolonize eşsiz bir ortamdır. Bağırsak mukoza savunma sistemi bir epitel tabakası ve commensals bağırsak içinde onların sayısı ve çeşitliliği korurken kısıtlamak bağışıklık hücreleri bir bolluk oluşur. Diğer taraftan, komensal organizmalar tamamen işlevsel bir bağışıklık sistemi geliştirme için gerekli olan. Ana bilgisayar ve komensal bakteriler arasındaki etkileşimler normalde yararlı olmakla birlikte, o dysregulated bağışıklık sistemi-microbiota crosstalk böyle asinflammatory bağırsak kronik inflamatuar hastalıkların gelişme lehine giderek daha açık hale geliyor hastalığı, artrit veya astım1,2.

Gut microbiota çeşitli faktörler tarafından değiştirilebilir, ancak belki de en köklü değişiklikler ciddi bakteriyel topluluklar3,4bileşimi ve boyutu değiştirir antibiyotik tedavisi tarafından indüklenen vardır. Antibiyotikler enfeksiyonları tedavisi için yararları tartışılmaz olmakla birlikte, insanlarda antibiyotik pozlama tarafından indüklenen microbiota değişiklikleri de sağlığı üzerinde zararlı etkileri yol açabilir bağışıklık savunma değiştirebilirsiniz. Örneğin, insanlarda antibiyotik tedavisi Clostridium difficileriski için bağlantılı olmuştur-indüklenen ishal, astım ve kanser3belirli türden. Antibiyotik tedavisi farelerde etkisi ve uzun vadeli değişiklikler antibiyotik tedavi edilen hastaların bağırsak topluluklar içinde bulunan recapitulates ve soruşturma mikrobiyal topluluklar değişimler ve bağışıklık hücre işlevi arasında mekanik bağlantılar sağlamıştır. Ancak, çeşitli raporlar gibi muhtemelen onun kötü tat5,6nedeniyle içme suyu fareler kaçınmaya içme suyu ad libitum antibiyotik yönetimini çok belirgin kilo kaybı sonuçları göstermiştir. Böylece, bu modelleri ciddi dehidratasyon oral antibiyotik yönetim için eşlik eden bağışıklık hücre işlevindeki antibiyotik tedavinin etkisini belirlemek için amaçlayan deneyler yorumlanması karmaşık.

Birkaç yaklaşım boyutu ve bağırsak yuvası7mikrobiyal toplulukların kompozisyon keşfetmek için kullanılabilir. Yeni nesil sıralama teknolojileri bu yöntemler nispeten pahalı ancak çok değerli veri bu madde8, hazırladık ve uzman bioinformatic analizleri için veri yorumlama gerektirir. Öte yandan, geleneksel mikrobiyolojik kültür yöntemleri algılama bakteri türlerinin izin ama onlar düşük duyarlılık ve komensal bakteriler (özellikle anaerop) büyük bir kısmı çok zor veya imkansız ile yetiştirmek için Şu anda kullanılabilir yöntemleri8. Toplam mikrobiyal yükü, hızlı ve güvenilir kültür bağımsız ölçütü sağladıkları gibi nicel polimeraz zincir reaksiyonu (qPCR) teknikleri giderek miktar ve dışkı bakteriyel türler, tanımlaması için kullanılmaktadır. Buna göre qPCR yöntemleri yaş veya ilerleme iltihabi bağırsak hastalığı9,10da dahil olmak üzere çeşitli hastalıklar ile ilişkili microbiota değişiklikleri incelemek yararlı kanıtladık. Buna paralel olarak, çeşitli tedaviler (antibiyotikler de dahil olmak üzere) etkisini doğrulamak için hızlı ve uygun maliyetli bir yaklaşım dışkı bakteriyel yükler ve microbiota kompozisyon10,11,12qPCR yöntemleri sağlar.

Burada, iki ayrı protokol oral antibiyotik yönetim için ayrıntılı adım adım hesabını fareler, dışkı örneği koleksiyonu, DNA ekstraksiyon, standartların hazırlanması ve miktar bakteri dışkı örneklerinde qPCR tarafından mevcut. Bu protokoller farelerde bağırsak microbiota işlemek için ve antibiyotik tedavisi bağırsak homeostazı ve hastalık etkilerinden çalışmak için güvenilir bir yöntem sağlar.

Protocol

Burada açıklanan deneyler 6-8 hafta eski vahşi-türü (C57BL6/J) fareler bir belirli patojen ücretsiz (SPF) tesiste saklanır kullanarak gerçekleştirilen. Tüm hayvan deneyleri Londra'daki King's College ve Francis Crick Enstitüsü hayvan refahı ve etik İnceleme vücuda ve İngiltere ev ofisi tarafından kabul edildi. Herhangi bir hayvan yordama başlamadan önce uygun izinleri yerel kurum/kuruluş içinde elde edilen olun.

1. Yönetim antibiyotik

Not: Antibiyotik tedavisi için iki alternatif yöntemler sağlanır: oral gavaj (adım 1.1) ve yönetim antibiyotik ile içme suyu (adım 1.2).

  1. Sözlü sonda ile besleme
    1. Aşağıdaki konsantrasyonlarda autoclaved suda çözülerek stokları bireysel antibiyotik hazırlamak: 100 mg/mL, ampisilin, gentamisin, 100 mg/mL, 100 mg/mL, paromisin, 10 mg/mL, metronidazol ve 100 mg/mL, vankomisin. Filtre sterilize 0,45 µm filtre kullanarak. Aliquot ve mağaza-20 ° C'de
    2. Bir kokteyl antibiyotik yukarıda hazırlanan stokları karıştırarak hazırlayın. 1 mL bir birim için ampisilin (5 mg/mL son) 50 µL, 50 µL gentamisin (5 mg/mL son), paromisin (5 mg/mL son) 50 µL, metronidazol (5 mg/mL son) 500 µL, vankomisin (2.5 mg/mL son) 25 µL ve 325 µL su karıştırın. Kullanmadan önce kokteyl taze hazırlayın.
    3. Antibiyotik karışımı steril 1 mL şırınga yüklemek ve herhangi bir kabarcıklar ayrıcılıklarına uygun ölçer sonda ile besleme iğne (20 G 15-20 g fareler için) düzeltin.
    4. 200 µL antibiyotik karışımı ile sonda ile besleme fareler.
      1. Cilt fare omuz üzerinden sıkıca tut, baş ve boyun özofagus düzleştirmek için streç. Besleme iğneyi ağız ve yutak arkasına doğru çatı boyunca top ucu doğrudan. Daha sonra hafifçe yemek borusu içine uzatın ve 200 μL çözüm enjekte.
    5. Antibiyotik kokteyl bir kez günlük deneme süresi için yönetmek.
  2. İçme suyu antibiyotik
    Dikkat: Dikkatle fare ağırlık günlük içme suyu antibiyotik yönetiminin ilk iki hafta izleyin.
    1. Aşağıda autoclaved su 1 litre, çözülerek antibiyotik bir kokteyl hazırlamak: 1 g ampisilin (1 g/L son), paromisin (1 g/L son), metronidazol (1 g/L son), vankomisin (0.5 g/L son) ve 8 paketler (0.75 g her), yapay 0.5 g 1 g 1 g tatlandırıcı (60 g/L son). Eriyene kadar salla. 4 ° C'de mağaza
      Not: Tatlandırıcı antibiyotik lezzet gizlemek ve fareler su kaybı önlemek için eklenir. Birkaç tatlandırıcı marka çalışırken gerekli son konsantrasyonu her marka için farklı olabilir.
    2. Antibiyotik kokteyl bir su şişesi doldurun (~ 100 mL/şişe) ve şişe üzerinde fare kafese koyun.
      Not: kahverengi şişe kullanın veya antibiyotik ışıktan korumak için folyo ile şişe kapağı.
    3. Antibiyotik kokteyl ile taze stok deneme süresi için haftada iki kez değiştirin.

2. dışkı, Ileum içerik ve Ileum duvar dışkı örnekleri toplanması

  1. Tartmak ve 2 mL örnek koleksiyonun autoclaved tüpleri etiket.
  2. Taze dışkı örneği topluluğu, bir restrainer yer her fare ve doğrudan bir koleksiyon tüp anüs dışkı parçaları toplamak.
    Not: Örnekleri de fareler temiz autoclaved bir kafese koyup dışkı örneği temiz steril forseps ile toplama edinilebilir.
  3. CO2 boğulma tarafından servikal yerinden çıkması takip ile fareler ötenazi.
  4. Karın bölgesi % 70 etanol ile sprey ve bir fare leşi tamamen maruz karın ile yatıyordu.
  5. Steril forseps ve makas kullanarak, herhangi bir iç dokulara zarar vermeden Karın zarını ortaya çıkarmak için karın enine bir kesi olun. Karın zarını kaldırın ve bağırsak ortaya çıkarmak için bir kesi yapmak.
  6. (Dan mide kolon) bağırsaklar pensler ve makas ile çıkarın ve içinde steril Petri kabına yerleştirin.
  7. Dikkatli forseps ince bağırsak (sı) alay mezenterik arter ve yağ uzak kullanın. Bağırsak genişletmek ve temiz laboratuvar mendil üzerinde yerleştirin.
  8. Bir cetvel ile ölçmek ve 4 cm (en yakın bölümü çekum için) sı distal ileum kesti. Kesmek ve bağırsak için çekum proksimal 1 cm atın. İleum bağırsak bakterileri toplamak için kullanılacak yaptı 3 cm kısmı olacak.
  9. İleum bölümü (3 cm) 2 mL steril tüp üzerinde tutun. Bağırsak içeriği doğrudan ekstrüzyon bağırsak ve colleting tüp örnek toplamak. Bu örnek bakteri ileum içerikten olacaktır.
  10. Soğuk fosfat tamponlu tuz (PBS) 20 mL şırınga hazırlamak ve ileum bölümü (DISCARD akışı ile) yıkayın.
  11. İleum bölümü temiz kağıt havlu yerleştirin ve boyuna makasla açın.
  12. Bir neşter ile ileum duvar içini kazımak.
  13. Herhangi bir bakteri neşter PBS 1 mL üzerinde temiz santrifüj tüpü ile yıkayarak neşter üzerinde toplamak. 8.000 × g bakteri cips ve süpernatant atmak 5 min için de spin. Bu örnek ileum duvar bakteri içerir.
    Not: Dışkı, ileum içerik ve duvar dışkı örnekleri donmuş ve-80 ° C'de kadar kullanmak depolanır.
  14. Dışkı ve ileum içerikten örnekleri içeren tüpler tartmak ve her örnek içinde dışkı ağırlık elde etmek için boş tüpler (Kimden adım 2.1) üzerinden ağırlık çıkarın.
  15. Bakteriyel DNA dışkı, ileum içerik ve ticari olarak mevcut kitleri kullanarak ileum duvar örnekleri ayıklamak. -20 ° C'de DNA örnekleri kullanmak kadar saklamak.

3. qPCR tarafından bağırsak Microbiota miktar

Not: Bu yordam bir standart (adım 3.1) üretimi ve qPCR kurulum için standart ve dışkı örnekleri (adım 3.2) için yöntemi içerir

  1. QPCR için standart bir nesil
    1. Polimeraz zincir tepkimesi (PCR) 16S rRNA gen reaktifler13 ve Tablo 1' de ayrıntılı PCR koşulları kullanarak bir bakteri kültürü elde genomik DNA yükseltmek için kullanın.
    2. PCR ürünü % 1.5 özel jel üzerinde çalıştırmak ve piyasada bulunan bir DNA ekstraksiyon kiti kullanılarak DNA grup arındırmak.
    3. Saf DNA parçası bir klonlama kiti (antibiyotik direnci işaretleri ve β-galaktozidaz (LacZ) gen füzyon için mavi/beyaz koloni seçimi içeren bir vektör kullanın Tablo malzemeleri, görmek) kullanarak ligate ve DH10 yetkili dönüşümü E. coli üreticinin yönergeleri izleyin. Plaka ampisilin dönüşümü (100 µg/mL), X-gal (20 µg/mL) Luria Bertani (LB) ağar kaplamalar (10 g/L Tryptone, 5 g/L maya ekstresi, 10 g/M NaCl, 15 g/M Agar). Kuluçkaya gecelik (O/N) 37 ° C'de
    4. Bir tek pozitif (beyaz) koloni plaka seçin. 5 mL LB suyu 100 µg/mL ampisilin içeren aşılamak ve O/N 250 devir / dakikada sallayarak 37 ° C'de kuluçkaya.
    5. O/N kültüründen izole ve üreticinin yönergelerine uygun bir ticari miniprep kit kullanarak plazmid arındırmak.
      Not: Bu aşamada, plazmid 16S rRNA gen tek bir kopyasını içerdiğinden emin olun ve baz çifti (bp) uzunluğunu belirlemek için plazmid Ekle sıra önemlidir.
    6. Bu yalnızca bir kez plazmid kesim bir Restriksiyon enzimi ile plazmid linearize.
    7. Piyasada bulunan bir seti kullanarak Doğrusallaştırılmış plazmid arındırmak.
    8. 260 absorbans ölçerek plazmid konsantrasyonu belirlemek bir spektrofotometre kullanarak nm.
    9. Plazmid kopya/µL aşağıdaki formül14kullanarak örnek sayısını hesaplar:
      kopya sayısı = (Miktar * 6.022 × 1023) / (uzunluk * 1 × 109 * 650)
      Miktar adım 3.1.8 (ng/µL);'de elde edilen DNA toplama nerede ve uzunluğu (eklemek ile) plazmid bp içinde toplam uzunluğu. Kopya kopya/µL elde edilir.
      Not: Yukarıdaki formülü temel alarak plazmid kopya sayısını kolay hesaplanması etkinleştirmek çevrimiçi araçlar vardır.
    10. Aliquot ve mağaza-20 ° C kadar kullanmak gerektiği gibi standart.
  2. qPCR kurulum için standart ve dışkı örnekleri
    1. QPCR (adımından 3.1.10) standart, dışkı örneklerinden DNA (adım 2.15) ve qPCR kimyasalları (ticari olarak mevcut bir kitinden) buz çözme.
      Not: Bu örnekte kullanılan qPCR reaktifler SYBR yeşil qPCR reaksiyon mix ve ileriye ve geriye doğru astar (Tablo 2) içerir.
    2. Steril DNA ücretsiz su 10 aralığında standardında seyreltik7 102 kopya/µL ' (Örneğin, 1/5 seri dilutions 107 için 6,4 x 102 kopya/µL). Dışkı örneği DNA 1/5, 1/2, 1/10. sulandırmak
    3. Bir ana mix tepki reaksiyonlar artı 1 (Tablo 2) toplam sayısı için yapmak.
    4. Karışımı 30 µL ana mix ve 5 µL şablonunun (Standart, örnek veya su negatif kontrol için)
    5. Her şey bir 384-şey optik qPCR plaka 10 µL bu karışımı ekleyin. Her reaksiyon nüsha gerçekleştirin.
    6. QPCR yer mühür, kısaca santrifüj kapasitesi ve plaka üzerinde aşağıdaki Bisiklet koşullarını ile programlanmış qPCR makine yüklemek: 20 min için 95 ° C 95 ° C 40 döngüsü tarafından takip 15 s ve 60 ° C için 1 dk için.
    7. Standart ve örnekleri için CT değerlerini elde etmek.
    8. CT değerlerini karşı plazmid (olarak hesaplanan 3.1.9. adımda) kopya sayısı logaritması standartları için komplo tarafından standart bir eğri oluşturur. Standart eğri çizgisel gerileme gerçekleştirin.
    9. 16S rDNA kopya numaraları dışkı örnekleri için standart eğri CT değerleri (3.2.2. adımda elde) enterpolasyonla tarafından hesaplayın.
      Not: (adım 3.2.2 hazırlanırken) örnek seyreltme faktörü göz önünde bulundurarak 16S rDNA kopya numaraları her örnek için düzeltilmesi gerektiğini (adım 2.15) eluted son hacim nükleik asitler ve miktarını elde etmek için dışkı örneği (içinde hesaplanan adım 2.14) dışkı gram başına gen kopya.

Representative Results

Burada fareler oral antibiyotik tedavisi için iki alternatif iletişim kuralları sağlar. Şekil 1 oral gavaj (kırmızı) ya da içme suyu (mavi) 10 gün üst üste antibiyotiklerle tedavi farelerde vücut ağırlığı (her hayvan için özgün taban çizgisinin kilo ile ilgili) yüzdesini gösterir. Hiçbir belirgin kilo kaybı antibiyotik almak farelerde oral gavaj tarafından bulunur. Fareler antibiyotik ad libitum içme suyu ile tedavi ederken, onlar kaybetmek ağırlık (~ %10) antibiyotik yönetim ilk birkaç gün içinde ancak, bundan sonra normal kilo alımı (Şekil 1) yeniden elde etmek. Yine de, yaklaşık 5-%10 içme suyuna antibiyotik alma farelerin ulaşabilirsiniz > % 20 kilo kaybı tedavi, ilk hafta içinde bu durumda onlar are euthanized.

Bakteri dışkı örneklerinde miktar (olarak hesaplanan 3.2.2. adımda) standart qPCR (adım 3.2.7) elde edilen CT değerler ve kopya numarası günlük komplo tarafından elde edilen yeterli bir standart eğri kullanımını gerektirir. Şekil 2A R2 değeri 0.99827,-3.09 ve bir verimlilik bir eğim ile standart eğri performans ölçütleri karşılayan bir standart eğri temsil edici bir örnek gösterir ((-1 + % 110 10^(-1/slope))*100). R2 değerleri 0,99 ve PCR verimliliği % 90-110 aralığındaki tercih edilir. Doğrusal Aralık içinde regresyon analiz denklemi miktar 16S rDNA bereket içinde dışkı örnekleri sağlar. Şekil 2B dışkı dışkı, SI içerik ve SI duvar 16S rDNA kopya sayısını gösterir. Şekil 2B veri 16S rDNA kopya/g dışkı dışkı ve SI içerik için dışkı örneği olarak gösterilir. SI duvar için veri 16S rDNA kopyası (malzeme başlayan miktar kesin ağırlık elde etmek için çok küçük olduğundan) SI duvarın cm 3 Kurtarılan bakterilerden elde edilen toplam sayısı olarak sunulmaktadır.

Antibiyotik bakteri dışkı örneklerinde yoğunluğu üzerindeki etkisini değerlendirmek için fareler antibiyotiklerle oral gavaj tarafından her gün 10 gün boyunca tedavi edildi (gün 1-10) ve dışkı örneği (bir gün önce 0), toplanan farklı noktalarda zaman-antibiyotik tedavisi () sırasında gün 5 ve 10) ve antibiyotik Yönetim (gün 17; durdurma sonra 7 gün Şekil 3A). Şekil 3B' de gösterildiği gibi antibiyotik tedavisi 16S rDNA kopya/g olarak normal seviyelere (ön arıtma için karşılaştırılabilir) 1 hafta sonra yeniden elde etmek belgili tanımlık feces bakteri yoğunluğu ise 5 ile 10 gün itibariyle tespit dışkı sayısı güçlü bir düşüş neden olmaktadır antibiyotik Yönetim (gün 17) durduruldu.

Figure 1
Şekil 1: antibiyotik yönetim. Fareler antibiyotik oral gavaj (kırmızı) veya 10 gün üst üste için (mavi) içme suyu aldı. Arsa ağırlıkları antibiyotik Yönetim (0 gün) önce orijinal ağırlık göre deney süresince farelerin gösterir. Verileri ortalama ± SEM gösterilir Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: 16S rRNA gen qPCR amplifikasyon standartları ve dışkı örnekleri. (A)standart eğri tanımlayıcıları ile standart eğrisi doğrusal regresyon. (B) gen zenginliği dışkı örneklerinden hesaplanması. Verileri ortalama ± SEM gösterilir Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: antibiyotik tedavisi sırasında dışkı bakteri. (A)şematik antibiyotik yönetim tarafından oral gavaj (Ab) ve ile gösterildiği gibi örnek toplama planının *. (B) 16S rDNA dışkı örnekleri belirtilen gün toplanan fare dışkısı gram başına kopyalar. Verileri ortalama ± SEM gösterilir Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Reaktif Birim
DNA 8 ΜL
Arabellek 10 X 2 ΜL
dNTPs (10mM) 0.4 ΜL
Eubacteria - F astar (10 mM) 1 ΜL
Eubacteria - R astar (10 mM) 1 ΜL
Taq Polimerase 0.2 ΜL
H2O 7.4 ΜL
Toplam hacim 20 ΜL
Astar dizileri
Eubacteria - F astar 5' ACTCCTACGGGAGGCAGCAGT 3'
Eubacteria - R astar 5' ATTACCGCGGCTGCTGGC 3'
Bisiklet koşullarını
Sıcaklık Zaman Döngüleri
94 ° C 5 dk 1 x
94 ° C 30 s 30 x
60 ° C 30 s 30 x
72 ° C 1 dk. 30 x
72 ° C 5 dk 1 x
4 ° C 1 x

Tablo 1: PCR koşulları ve reaktifler. Bu tablo reaktifler ve qPCR deneyleri içinde kullanmak için bir standart nesil 16S rRNA gen bakteri kültüründen yükseltmek için PCR Bisiklet koşullarını sağlar. Astar dizileri aslında Kruglov vd tarafından yayınlandı 13.

Reaktif Birim
SYBR yeşil ana mix (2 x) 17,5 ΜL
Eubacteria - F astar (10 mM) 0.7 ΜL
Eubacteria - R astar (10 mM) 0.7 ΜL
H2O 11.1 ΜL

Tablo 2: qPCR ana mix. Nüsha (10 µL her) 384-şey qPCR tabakta (5 µL pipetting hata için ilave için muhasebe) üzerinde çalışmak üzere tek bir örnek için (son hacim 35 µL) gösterilen birimleri vardır. Tutarı çözümlenmesi için örnek sayısına göre ölçekli.

Discussion

Burada deneysel protokoller oral antibiyotik yönetimi için fare ve miktar dışkı bakteri tarafından qPCR sağlamak. Antibiyotik kombinasyonu bu (ampisilin, gentamisin, paromisin, metronidazol ve vankomisin içeren) protokolü hedefleri gram pozitif ve gram-negatif bakteriler, bakteri tam bir spektrum karşı bakterisidal etkinlik sunan kullanılır. Oral gavaj ve antibiyotik içme suyu Yönetimi büyük ölçüde azaltmak dışkı bakteriyel5,6,12yük. Ayrıca, her iki tedaviler çeşitli özellikleri döl-özgür fareler azaltılmış dalak büyüklüğü ve genişlemiş çekum gibi tipik geliştirdikçe fareler fenotip üzerinde derin bir etkisi var. Olarak sözlü sonda ile besleme yöntemi daha emek yoğun ve muhtemelen daha fazla rahatsızlık neden antibiyotik, günlük yönetim gerektirir antibiyotik yönetim için belirli bir yöntemi seçimi Belki deneme uzunluğuna bağlı olabilir uzun vadede hayvanlarda.

Bu fareler dehidrasyon tutmak için önemli bir faktör olarak antibiyotik içme suyu yönetimi için antibiyotik karışıma tatlandırıcı ilavesi ile dikkat alınmalıdır. Çeşitli gruplar nasıl yönetim antibiyotik içme suyu (olmadan tatlandırıcı ilavesi) yol açar çok ciddi ve hızlı zayıflama için tüm fareler ilk vücut ağırlığı % 20'den fazla deneme5 ilk birkaç gün içinde kaybetme ile göstermiştir , 6. bizim protokolündeki tatlı tabanlı tatlandırıcı kullanımı su ve antibiyotik yönetim sonra ilk birkaç gün içinde kilo fareler antibiyotik tadında maskelemek için yeterli gibi görünüyordu, ama onların ağırlık hızlı bir şekilde o ( sonra kurtarıldı Şekil 1). Yine de, bizim deneylerinde farelerin % 5-10 hala ulaşmak insan son > temellerin % 20 kaybı vücut ağırlığı ve ötenazi gerekiyordu. Ayrıca tamamen fareler su kaybı önlemek için başarısız olan Sukraloz tabanlı tatlandırıcılar test ettik (%100 kayıp farelerin > ağırlığının % 20) diğer yazarlar benzer hataları aspartam tabanlı tatlandırıcılar5,6için yayımlanan. Zayıflama ve hayvan refahı antibiyotik tedavisi sırasında etkileyebilir gibi buna ek, yaş, genetik arka plan ve deneyler için kullanılan fare genel sağlık durumu, düşünülmelidir. Bu nedenle, dikkatli fare ağırlık ve genel sağlık durumu izleme günlük ilk iki hafta boyunca oral antibiyotik Yönetim yapılmalıdır.

qPCR yöntemleri 16S rRNA dışkı örneklerinde miktar için hızlı ve uygun maliyetli bir yaklaşım sağlar. Ancak, bazı sınırlamalar bu tekniği de dahil olmak üzere ilgili olarak gereken: Ben) gereksinim güvenilir yüksek kalite standartı; II) tasarım ve qPCR astar verimliliğini; III) mikroorganizmalar 16S rRNA gen sayıda farklı kopya olabilir aslında, böylece gen kopya doğrudan hücre sayımları15eşit değil. Yine de, qPCR hızlı analiz dışkı örnekleri sağlayan bir sağlam ve duyarlı bir yöntemdir. Bu yöntem hızlı bir şekilde (antibiyotikler de dahil olmak üzere) dışkı bakteriyel yükler çeşitli tedavilerde etkisi ayrıntılı burada olarak doğrulamak özellikle yararlı olabilir. Ayrıca, her ne kadar biz, Toplam 16S miktar için bir protokol sağlar rRNA, bu yöntem kolay adapte (belirli astar16tasarlayarak) için kimlik böylece hem nicel sağlayan bireysel bakteriyel özellikleri etkinleştirmek ve microbiome boyutu ve kompozisyon hakkında nitel bilgi.

Özetle, Biz fareler ve dışkı bakterilerde antibiyotik kaynaklı değişiklikleri ölçmek için bir qPCR tabanlı yöntemi oral antibiyotik tedavisi için iki protokol sağladı. Her ne kadar bu protokoller olabilir daha fazla en iyi duruma getirilmiş ve diğer yaklaşımlar bireysel deneysel ihtiyaçlarına göre ile birlikte, hızlı, uygun maliyetli ve güvenilir fare bağırsak microbiota işlemek ve etkilerini incelemek için araçlar sunabilir antibiyotik tedavisinde bağırsak homeostazı ve hastalık.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Bu eser İngiltere'de tıbbi araştırma Konseyi tarafından (grant P.B. Bay/L008157/1); finanse edildi R.J. Marie Curie Intra-European Bursu (H2020-MSCA-Eğer-2015-703639); tarafından desteklenen P.M.B. bir öğrencilik İngiltere'de tıbbi araştırma Konseyi ve King's College London doktora eğitim ortaklık Biyomedikal Bilimler (Bay/N013700/1) tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Ampicillin sodium salt Sigma-Aldrich (Merck) A9518
Neomycnin trisulfate salt hydrate Sigma-Aldrich (Merck) N1876
Metronidazole Sigma-Aldrich (Merck) M3761
Vancomycin hydrochloride Sigma-Aldrich (Merck) V2002
Gentamicin sulfate salt Sigma-Aldrich (Merck) G3632
Tryptone Sigma-Aldrich (Merck) T7293
Yeast Extract Sigma-Aldrich (Merck) Y1625
NaCL Sigma-Aldrich (Merck) S7653
Sweetener Sweet'n Low Sweet'N Low Available in the UK from Amazon.co.uk
X-Gal (5-brom-4-chloro-3-indoyl B-D-galactopyranoside) Fisher scientific 10234923
Phosphate Buffered Saline  Thermo Fisher Scientific (Gibco) 10010023
Ultrapure Agarose Thermo Fisher Scientific (Invitrogen) 16500500
RT-PCR grade water Thermo Fisher Scientific (Invitrogen) AM9935
Phusion High-Fidelity DNA Polymerase New England BioLabs M0530
Deoxynucleotide (dNTP) Solution Mix New England BioLabs N0447
iTaq Universal SYBR Green Supermix Bio-Rad 1725124 with ROX
TOPO TA cloningTM for sequencing Thermo Fisher Scientific (Invitrogen) 450030
QIAamp fast DNA Stool mini kit  Qiagen 51604
QIAprep spin Miniprep kit Qiagen 27106
QIAquick gel  extraction kit Qiagen 28704
Syringe filter 0.45 µm Fisher scientific 10460031
Swann-MortonTM Carbon steel sterile scalpel blades Fisher scientific 11792724
Syringe (1 mL) BD Plastipak 303172
Syringe (20 mL) BD Plastipak 300613
1.5 mL Crystal clear microcentriguge tube StarLab E1415-1500
2 mL Ultra high recovery microcentrifuge tube StarLab I1420-2600
Oral dosing needles 20 G x 38 mm curved (pk/3) Vet-Tech DE008A
Sterilin petri dish 50 mm  Scientific Laboratory Supplies PET2020
Absolute qPCR plate seals Thermo Fisher Scientific AB1170
MicroAmpTM optical 384-well plate  Thermo Fisher Scientific (Applied Biosystems) 4309849
ViiA7TM 7 real-time PCR system with 384-well block Thermo Fisher Scientific (Applied Biosystems) 4453536
Spectrophotometer (Nanodrop 1000) Thermo Fisher Scientific ND-1000
Labnet Prism microcentrifuge Labnet C2500
MultiGene Optimax Thermal cycler Labnet TC9610

DOWNLOAD MATERIALS LIST

References

  1. Belkaid, Y., Hand, T. W. Role of the microbiota in immunity and inflammation. Cell. 157, (1), 121-141 (2014).
  2. Hooper, L. V., Littman, D. R., Macpherson, A. J. Interactions between the microbiota and the immune system. Science. 336, (6086), 1268-1273 (2012).
  3. Ubeda, C., Pamer, E. G. Antibiotics, microbiota, and immune defense. Trends in Immunology. 33, (9), 459-466 (2012).
  4. Dethlefsen, L., Huse, S., Sogin, M. L., Relman, D. A. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biology. 6, (11), e280 (2008).
  5. Reikvam, D. H., et al. Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression. PLoS One. 6, (3), e17996 (2011).
  6. Hill, D. A., et al. Metagenomic analyses reveal antibiotic-induced temporal and spatial changes in intestinal microbiota with associated alterations in immune cell homeostasis. Mucosal Immunology. 3, (2), 148-158 (2010).
  7. Fraher, M. H., O'Toole, P. W., Quigley, E. M. Techniques used to characterize the gut microbiota: a guide for the clinician. Nature Reviews Gastroenterology & Hepatology. 9, (6), 312-322 (2012).
  8. Eckburg, P. B., et al. Diversity of the human intestinal microbial flora. Science. 308, (5728), 1635-1638 (2005).
  9. Sokol, H., et al. Low counts of Fecalibacterium prausnitzii in colitis microbiota. Inflammatiry Bowel Diseases. 15, (8), 1183-1189 (2009).
  10. Bartosch, S., Fite, A., Macfarlane, G. T., McMurdo, M. E. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Applied Environmental Microbiology. 70, (6), 3575-3581 (2004).
  11. Ubeda, C., et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation. 120, (12), 4332-4341 (2010).
  12. Saez de Guinoa, J., et al. CD1d-mediated lipid presentation by CD11c(+) cells regulates intestinal homeostasis. EMBO Journal. 37, (5), (2018).
  13. Kruglov, A. A., et al. Nonredundant function of soluble LTalpha3 produced by innate lymphoid cells in intestinal homeostasis. Science. 342, (6163), 1243-1246 (2013).
  14. Wilhelm, J., Pingoud, A., Hahn, M. Real-time PCR-based method for the estimation of genome sizes. Nucleic Acids Research. 31, (10), e56 (2003).
  15. Kembel, S. W., Wu, M., Eisen, J. A., Green, J. L. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Computational Biology. 8, (10), e1002743 (2012).
  16. Yang, Y. W., et al. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces. Applied Environmental Microbiology. 81, (19), 6749-6756 (2015).
Oral antibiyotik tedavisinden sonra fare bağırsak Microbiota nicel polimeraz zincir reaksiyonu tabanlı analiz
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).More

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter