Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Metagenomic yarı analiz Salmonella gıda ve çevre örnekleri

doi: 10.3791/58612 Published: October 25, 2018

Summary

Burada, gıda ve çevre microbiomes DNA örnekleri uyumlu algılama ve Salmonella quasimetagenomic sıralama yoluyla subtyping hazırlamak için bir iletişim kuralı mevcut. Kombine kullanım kültürü zenginleştirme, immunomagnetic ayrılık (IMS) ve birden çok deplasman amplifikasyon (MDA) Gıda ve çevre örnekleri Salmonella genomik DNA'ın etkili konsantrasyon sağlar.

Abstract

Sözde metagenomics sıralama değiştirilmiş microbiomes gıda ve çevre örnekleri sıralama tabanlı analiz eder. Bu protokol için microbiome değişiklik algılama kolaylaştırmak için genomik DNA'ın çifte bir hedef gıda kaynaklı patojen kirletici ve tek iş akışında patojen subtyping konsantre için tasarlanmıştır. Burada, biz açıklamak ve göstermek Salmonella enterica yarı metagenomics analiz temsilcisi gıda ve çevre örnek yonca filizi, dahil için örnek hazırlanması adım karabiber zemin, zemin sığır eti, tavuk göğsü ve çevresel temizleme bezi. Örnekleri ilk Salmonella kültürü zenginleştirme bir süre kısaltılmış ve ayarlanabilir (4 – 24 h) tabi. Salmonella hücreleri zenginleştirme kültüründen immunomagnetic ayrılık (IMS) seçmeli olarak yakalanır. Son olarak, birden çok deplasman amplifikasyon (MDA) IMS yakalanan hücrelerden DNA yükseltmek için gerçekleştirilir. Bu iletişim kuralı DNA çıktısını yüksek işlem hacmi sıralama platformları tarafından sıralı. İsteğe bağlı bir kantitatif PCR analiz Salmonella algılama için sıralama değiştirme veya sıralama önce Salmonella DNA konsantrasyonu değerlendirmek için gerçekleştirilebilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Metagenomics sıralama teorik olarak uyumlu algılama ve gıda kaynaklı patojenler subtyping sağlar. Ancak, gıda örnekleri gıda microbiome doğrudan sıralama tarafından patojen analiz için sorunlar mevcut. İlk olarak, gıda kaynaklı patojenler düşük seviyelerde gıda örnekleri mevcut çoğu kez. Çoğu hala piyasada bulunan hızlı algılama yöntemleri, 8-48 h patojen tespit düzey1hücrelere zenginleştirmek için kültür gerektirir. İkinci olarak, birçok gıdalar içeren bol mikrofloranın hücreleri ve/veya gıda DNA, algılama ve subtyping tarafından metagenomic sıralama yolu tarif etmek için gıda kaynaklı patojen DNA gıda metagenome ve zor bir hedef küçük bir kısmını yapma.

Gıda microbiomes modifikasyonu gıda kaynaklı patojen DNA sıralama tabanlı algılama Shiga toksin üreten Escherichia coli2,3 ve kolaylaştırmak için önemli konsantrasyon izin bildirilmiştir Salmonella enterica4. Çünkü gıda modifiye microbiomes hala karışımları farklı mikrobiyal türlerin, onların sıralama yarı metagenomic analiz4adlandırılır. Microbiome değişiklik veya immunomagnetic ayrılık (IMS) ile birlikte ve birden çok deplasman amplifikasyon (MDA)4,5kültürü zenginleştirme yalnız2,3 tarafından gerçekleştirilebilir. IMS antikor kaplı manyetik boncuklar ile zenginleştirme kültüründen patojen hücreleri seçerek yakalayabilirsiniz. MDA genomik DNA sıralama ile yüksek verimli ɸ29 DNA polimeraz6için yeterli miktarda oluşturabilirsiniz. IMS-MDA kültür bağımsız patojen algılama klinik örnekler7ve metagenomic yarı algılama için kültür kendilerini zenginleştirmek kısalma ve Salmonella gıda örnekleri4' subtyping izin verdi.

Bu yöntem genel amacı gıda örnekleri metagenomic yarı DNA'dan Salmonella genomik DNA ve sonraki algılama hedeflenen konsantrasyon ve Salmonella kirletici sıralama tarafından subtyping izin vermek için hazırlamaktır. Salmonella algılama8,9 standart yöntemleri ile karşılaştırıldığında ve10subtyping quasimetagenomic yaklaşım kontamine gıda ve çevre örnekleri için gerçekleştirme süresi önemli ölçüde kısaltabilir genellikle iki birleştirici tarafından patojen moleküler alt türlerinden analizleri tek bir iş akışı içine ayrılmış. Bu yöntem özellikle gıda kaynaklı outbreak yanıt ve sağlam patojen subtyping patojen algılama ek olarak gereklidir ve hızlı analitik dönüş önemli olduğu yerde diğer izleme arka araştırmalar gibi uygulamalar için kullanışlıdır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. numune hazırlama

Not: Gıda örnekleri için ön zenginleştirme ABD Bölümü Tarım Gıda güvenliği ve teftiş Servisi (USDA-FSIS)11 ve bakteriyolojik analitik kılavuzun (BAM) ABD Gıda Mikrobiyolojisi Laboratuvarı rehber (MLG) göre hazırlanır ve İlaç İdaresi (FDA)12.

  1. Aseptik gıda örnek karabiber, tavuk göğsü, kıyma ve yonca filizi veya çevresel bir pamuklu çubuk gibi 25 g bölümü olan yerleşik bir filtre bir steril laboratuvar blender torbaya koyun. Çevresel bir çubukla aseptik zenginleştirme suyu (Rappaport Vassiliadis, RV) bir süngerle nemlendirme tarafından hazırlayın. Daha sonra çubukla tüm yüzey veya önceden belirlenmiş alan üzerine sürükleyin ve bir laboratuvar blender torbaya koyun.

Figure 1
Şekil 1: temsilcisi gıda ve çevre örnekleri metagenomics yarı algılama ve Salmonellasubtyping için. Örnekleri steril filtre stomacher çanta RV suyu ile birlikte yer alır. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

  1. Her 25 g örnek RV zenginleştirme ile 225 mL 30 için bir laboratuvar blender veya el masaj kullanarak suyu iyice karıştırın s.
    Not: MLG ve BAM tarafından tavsiye edilen şekilde RV suyu türevleri örnek türlerine bağlı olarak kullanılabilir.
  2. Örnek-zenginleştirme suyu karışımı bir laboratuvar kuluçka 42 ° c 4-24 h için kuluçkaya.
  3. Kuluçka sonra ayrı 50 mL santrifüj tüpü çantada süzülmüş tarafında 50 mL subsample zenginleştirme suyu toplamak.
  4. 10 dakika içinde homogenate katı enkaz kaldırmak 100 x g de tüp santrifüj kapasitesi.
  5. Dikkatli bir şekilde yeni bir 50 mL tüp santrifüj kapasitesi ve 3000-6000 x g hücre Pelet kurtarmak 10 dk de tüpler santrifüj kapasitesi süpernatant kurtarmak.
  6. (İsteğe bağlı) Süpernatant atmak ve re-süspansiyon 5 ml arabelleğe alınmış pepton su (BPW) tarafından Pelet yıkama ve 3000-6000 × g 10 dk de tüpler santrifüj kapasitesi.
    Not: BPW hazır tarafından eriterek 10 g pepton, sodyum klorür, 5 g, 3.5 g disodyum fosfat, ve monopotassium fosfat 1 L / içine 1.5 g distile su. Son pH 7.2 ± 0.2 25 ° C'de ayarlanmalıdır Otoklav, 15 dk. piyasada bulunan BPW 121 ºC de kullanılabilir.
  7. Süpernatant atın ve Pelet 5 mL BPW yeniden askıya alma.

2. Immunomagnetic ayrılık (IMS) ve birden çok deplasman amplifikasyon (MDA)

Not: örnek arasında çapraz bulaşma önlemek için bir Biyogüvenlik kabini iş, pipet ipuçları her tüp için değiştirmek, pipet ile tüp dokunmaktan kaçının ve tüpleri birbirine yakın yıkama adımında manyetik tribünde koymayın.

  1. Örnek arabellek ve buz üzerinde veya 4 ° C'de MDA Takımı'ndan tepki tampon önceden çözülme.
  2. Mix 1 mL yeniden askıya alınan hücrenin içinde BPW ile anti -Salmonella boncuk 1.5 mL microcentrifuge tüpler 20 μL cips ve dönen mikser, oda sıcaklığında 30 dakika yerleştirin.
    Not: Rekabetçi flora, yağ tanecikleri ve proteinler arasında resuspended Pelet IMS ile çakışabilir. BPW yeniden askıya alınan hücre Pelet seyreltme adımları yıkama sırasında manyetik standından boncuk -Salmonella kompleksleri kaybı azaltmaya yardımcı olur.
  3. Tüpler manyetik stand içine yerleştirin ve 3 dak boncuklar uygun kurtarma için raf birkaç kez içine tüp tarafında bir Pelet boncuk konsantre ters çevirme tarafından izin.
  4. Tüpler manyetik kürsüye tutun. Aspire edin ve süpernatant her tüpün yanı sıra her tüpün kapağı içinde kalan sıvı atın.
    Not: IMS boncuk tüp mıknatıs karşı yan duvarında Pelet bozmamaya dikkat.
  5. Boru tutucu manyetik standından kaldırmak ve yıkama arabellek (% 0.05 (v/v) polysorbate 20 içeren PBS) 1 mL ekleyin ve özellikle bağlama bakteri karmaşık kaldırmak için birkaç kez tersine çevirin.
  6. 2.3-2.5 adımları iki kez tekrarlayın.
  7. 3rd yıkama sonra adımları 2.3-2.4 yineleyerek son manyetik ayırma boncuk gerçekleştirin. Tüpler manyetik rafa kaldırmak ve bir microfuge 1 için yer onları boncuk spin için s. O zaman, tüpler manyetik raf 3 min için herhangi bir kalıntı yıkama arabellek kaldırmadan önce yerleştirin.
  8. Boncuk -Salmonella kompleksleri içinde 9 μL örnek arabelleği yeniden askıya alma ve 95 ° c denatürasyon 3 dakikadır için kuluçkaya.
  9. 4 ° c buz soğutma sonra reaksiyon arabellek 9 μL ile birleştirmek artı 1 μL enzim karışımı ve buz üzerinde tutun.
  10. Bir termal cycler içinde tüpler için güçlendirme, enzim ve serin buz üzerinde 4 ° C için devre dışı bırakabilirsiniz için 10 dk 65 ° C'de Isıtma tarafından takip için 2 h 30 ° C'de kuluçkaya.
  11. Miktar ve MDA ürünlerin kalitesini değerlendirmek DNA konsantrasyon ve saflık (260/280 oranı > 1.8) fluorospectrometer cihazda ölçerek.
    Not: nedeniyle non-spesifik bağlama IMS boncuk genomik DNA organizmalar Salmonella dışında'MDA ürünlerinde mevcut olma olasılığı yüksektir, ama bu aşağı akım Analizi etkilemez.
  12. Son ürünler (20 μL) gerçek zamanlı PCR kullanımı ve/veya quasimetagenomics sıralama için Kütüphane hazırlık kadar-20 ° C'de depolayın.

3. gerçek zamanlı PCR

Not: Bu 1) Salmonella subtyping olmadan, algılamak için isteğe bağlı bir adımdır ve 2) değerlendirirken örnek kalite quasimetagenomics sıralama öncesinde.

  1. 18 μL örnek, evrensel PCR Master içeren başına PCR karışımı hazırlayın (10 μL) Mix, ileri astar (2 μL, 900 nM), ters astar (2 μL, 900 nM), sonda (2 μL, 250 nM) ve moleküler sınıf su (2 μL).
    Not: Salmonella-belirli oligonükleotid astar (ileri: CTCACCAGGAGATTACAACATGG, ters: AGCTCAGACCAAAAGTGACCATC) ve sonda 94-bp sıra (GenBank katılım Hayır. ttr gen içinde yükseltmek için tasarlanmıştır AF 282268)13.
  2. MDA ürün--dan adım 2.12 yavaşça yukarı ve aşağı boncuk -Salmonella kompleksleri ile birlikte bir süspansiyon oluşturmak için sıvı pipetting tarafından karıştırın. Süspansiyon 2 μL PCR karışımı 18 μL ekleyin.
  3. En iyi duruma getirilmiş bir gerçek zamanlı PCR protokolü kullanarak gerçek zamanlı PCR koş, iki holding dönemleri, bir 50 ° c 2 min için ve başka bir 10 dakika, 95 ° C'de belirtme 95 ° C 40 döngüsü tarafından takip 15 s ve 60 ° C 60 s.
  4. Eşik çizgiyi için güçlendirilmiş DNA floresan için gerekli devir sayısı eşiği döngüsü (Ct), hesaplayın.
    Not: Eşik satır taban çizgisinin ve yayla amplifikasyon parsel örnekleri arasında doğrusal aşamasında ayarlanır. Negatif sonuç 40 veya Ct değerleri negatif kontrol daha yüksek olan örnekleri üzerinde Ct değerlerine karşılık gelen.

4. Kütüphane hazırlık Quasimetagenomic sıralama için

Not: MDA ürünler her ikisi için de kısa okuma ve uzun (nanopore) sıralama platformlar sıralı. DNA Kütüphane hazırlık setleri sıralama platformlar üreticileri tarafından sağlanan en son sürümünü kullanın. DNA Kütüphane hazırlık göre üreticilerin talimat gerçekleştirin. Uzun okunur sıralama platform5için Kütüphane hazırlık için 2D düşük-girdili genomik DNA protokolünü kullanır. Kısa okuma sıralama platformu için hazırlık Kütüphane, üreticinin iletişim kuralı küçük değişiklikler aşağıda verilmiştir.

  1. Tampon çözeltiler ve Kimyasalları MDA ürünler ekleyerek standart kitaplığı hazırlama yöntemleri uygulayın. Prepped sıralama MDA ürünlerin 40 μL yeni bir tabağa aktarın ve her şey için 20 μL PCR arıtma boncuk ekleyin.
  2. Plaka 10 dakika oda sıcaklığında sallayarak olmadan kuluçkaya.
  3. Boncuk % 80 etanol ile yıkayıp kurulayın boncuk 12 dk için.
  4. Kurutulmuş boncuk resuspension arabellek 53 μL içinde yeniden askıya alma ve sallayarak olmadan 2 min için kuluçkaya.
  5. Sulandırmak ve üreticisinin yönerge izleyen kitaplıklar Havuzu.
    Not: 10 de havuza alınmış ve denatüre Kütüphane sıralı için hazır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Quasimetagenomic sıralama öncesinde genel miktar ve saflık IMS-MDA ürünlerin fluorospectrometer (Tablo 1) tarafından değerlendirilebilir.

Zenginleştirme saat (h) CT değeri Konsantrasyonu (ng/ul) Saflık (260/280)
Marka A 4 24,71 812.91 1.89
8 25.80 900.36 1.87
12 15.41 753.88 1,84
Marka B 4 20,63 872.61 1.87
8 22.61 993.41 1.87
12 19.08 954.44 1.87

Tablo 1: DNA'ın kalite ve miktar değerlendirme örnekleri metagenomic yarı sıralama için. Salmonella hücreleri aşısını çiğ tavuk göğsü 1 CFU/g. Inoculated adlı iki markaların 25 g örnekleri RV 4, 8 ve 12 saat IMS-MDA önce için zenginleştirilmiş.

Hedeflenen miktar değerlendirme Salmonella DNA subtyping gerekmiyorsa Salmonella algılama için alternatif olarak da hizmet veren gerçek zamanlı PCR tarafından (Tablo 1 ve Şekil 2), gerçekleştirilebilir.

Figure 2
Resim 2: Gerçek zamanlı PCR yarı metagenomics sıralama için Salmonella algılama veya örnek değerlendirme için. Gerçek zamanlı PCR Salmonella DNA amplifikasyon eğrileri IMS-MDA ürünlerinde 4, 8 ve 12 h zenginleştirme zaman sonra gösterilir. Bir örnek sadece 2 h zenginleştirme sonra da bulunur. Salmonella hücreleri (0,27 CFU/g) aşılamaya 25 gr çiğ tavuk göğsü A ve b iki markalardan biri olduğunu Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Fluorospectrometer okuma ilk numune hazırlama değerlendirilmesi izin. IMS-MDA ürünleri örnek DNA güçlendirilmiş düşündüren kirlenmiş tavuk göğsü örnekleri 701.54 945.86 ng/µL, değişiyordu Salmonella hazırlanan konsantrasyon. Üretici rehberlik göre en az DNA örneği okuma ve uzun sıralama kısaca 0.2 ng/µL ve 1 µg, sırasıyla bölgedir. DNA örnekleri yüksek saflıkta protein kirlenme seviyesinin düşük ile gösterilen 1,88 (Tablo 1), 1.85 değişiyordu 260/280 oranı.

Alt Ct değerleri daha yüksek konsantrasyonlarda Salmonella genomik DNA örnek gösterir. Tablo 1 ve Şekil 2' de gösterildiği Ct değerleri IMS-MDA ürünleri zenginleştirme zaman arttıkça azalır. 4, ne zaman CT değerleri 25, çoğunluğu daha düşük bulunmuştur bizim önceki çalışma (> % 50) SE genom sıralı muhtemeldir ve ham sıralama okuma dan serotip tahmin başarılı oldu.

Başarısız kültür zenginleştirme ya da IMS son örnekteki Salmonella genomik DNA'ın düşük konsantrasyon Şekil 2' de gösterildiği gibi gösteren nispeten yüksek bir Ct değerleri sonuçlanabilir. Bu bir DNA yoğun ve saflık olarak fluorospectrometer kaynaklar tarafından önerilen IMS-MDA ürünlerin rağmen ortaya çıkabilir.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Genellikle düşük bereket ve gıda ve çevre örnekleri Salmonella içinde homojen varlığı nedeniyle, kültür zenginleştirme IMS-MDA önce yine Salmonella algılama ve subtyping için gereklidir; Bu nedenle iletişim kuralının kritik bir adımdır. Salmonella bereket örnek arka plan flora göre artırmak için en uygun koşulları tanımlamak için farklı zenginleştirme medya belirli örnekler için değerlendirilecek. MLG ve BAM göre RV suyu gibi Seçmeli Orta ve tamponlu pepton su ve laktoz suyu gibi non-selektif orta Salmonella zenginleştirme gıda örneklerinden için kullanılabilir. RV kullanımı 42 ° C'de bizim önceki çalışma4 Salmonella zenginleştirme çiğ tavuk eti, marul ve quasimetagenomic analiz patojenin desteklemek için karabiber değerlendirilmiştir. FDA BAM ve AOAC precollaborative8,9ve ortak çalışmalar14,15göre RV yüksek mikrobiyal ve düşük mikrobiyal yükü gıdalar analiz için önerilir.

Kültür zenginleştirme en uygun süresi örnek türü, Salmonella bulaşma düzeyine ve Salmonella kirletici fizyolojik durumunu gibi birden fazla faktöre bağlıdır. Örneğin, ne zaman düzeyleri düşük Salmonella (Örneğin, < 1 CFU/g) hücreleri bir et örnek ve soğutma stres altında bulunması, zenginleştirme daha uzun (Örneğin, > 12 h) canlandırmak ve Salmonella hücreleri zenginleştirmek için gerekli. Salmonella yeterli bolluk içinde değiştirilmiş microbiome zorlanma düzeyinde tek nükleotit polimorfizmi (SNP)4yazmaya izin verebilirsiniz Salmonella kirletici genom yeterli sıralama kapsamını yol açar. Daha kısa kültürü zenginleştirme (Örneğin, daha az 12 h) Salmonella4serotyping ya da hızlı algılama5 için mümkün.

Salmonella bulaşma yüksek düzeyde ve/veya kontamine gıda örneklerinin daha uzun kültürü zenginleştirme Salmonella genomik DNA Ct değerleri düşürmek için yol değiştirilmiş gıda microbiomes içinde daha yüksek konsantrasyonlarda neden olur gerçek zamanlı PCR analizi. CT değerleri sıralama kapsamı ile negatif bir korelasyon Salmonella kirletici genom4görüntülemek ve bu nedenle en iyi duruma getirme ve iş akışının değiştirilmesi için kullanılabilir. Bizim deneyim göre kültür zenginleştirme, özellikle uzunluğu, kez sorun giderme çabaları odak noktasıdır. Örneğin, bir çiğ tavuk göğsü örnek IMS-MDA ürününden Ct değerini 35,94 (Şekil 1) nispeten yüksek oldu. Bu örnek 2.5 CFU/g ile SE hücre aşılamaya ve inkübe BPW 2 h. için 37 ° C'de içinde bu örnek nın SE genomunun serotip tahmin izin vermek için yeterli kapsama sağlamadı. Buna karşılık, diğer örnekleri 4 h veya daha uzun zenginleştirme ile başarılı bir şekilde quasimetagenomic sıralama veri (veri gösterilmez) serotyped.

Sonra sıralama, Salmonella tanımlamak için Kraken16 kullanarak daha ileri Biyoinformatik analizleri için okur öneririz. CFSAN SNP boru hattı17 ve SeqSero18 yazarak ve tahmin gelen ham sıralama şöyle, sırasıyla serotyping SNP için kullanılabilir.

Bu quasimetagenomic teknik bazı sınırlamalara sahiptir. İlk olarak, DNA toplama ve saflık bir fluorospectrometer tarafından ölçülen IMS-MDA ürünlerin ön bir uygun numune hazırlama göstergeyle kullanılmalıdır. MDA yüksek verimlilik nedeniyle, eser miktarda giriş DNA'ın tüm genom sıralama19yeterli için çoğaltılabilir. Bu nedenle, yüksek kalite ve miktar DNA örnekleri hala kültür zenginleştirme ya da IMS etkili Salmonella hücreleri konsantre başarısız olsa bile oluşturulabilir. İsteğe bağlı gerçek zamanlı PCR analiz tüm örnek hazırlama iş akışı daha hedefli ve bilgilendirici bir değerlendirmesini sağlar. İkinci, kültür zor Salmonella hücreleri gibi ama kültürlenemeyen (VBNC) bakteriler20, büyümek değil kültür zenginleştirme sırasında. Bu nedenle, bu hücreler bizim yöntemi tarafından tespit edilmedi.

Özet olarak, geleneksel yöntemlere göre bizim örnek hazırlama yöntemi ve yarı metogenomic sıralama yaklaşım analitik dönüş önemli azalma Salmonellaizin verebilirsiniz-kontamine gıda ve çevre örnekleri sağlam Salmonella kirletici subtyping. Salmonellaek olarak, bu tekniği uygulanan hızlı ve uyumlu algılama ve diğer gıda kaynaklı patojenler subtyping olmak potansiyeline sahiptir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar onlar rakip hiçbir mali çıkarları var bildirin.

Acknowledgments

Yazar Mark Harrison ve Gwen Hirsch Georgia Üniversitesi nazikçe bakteriyel zorlanma ve bu çalışma için diğer destek sağlamak için teşekkür etmek istiyorum.

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
Metagenomic yarı analiz <em>Salmonella</em> gıda ve çevre örnekleri
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter