Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Quasi-metagenomischen Analyse Salmonella aus Lebensmitteln und Umweltproben

doi: 10.3791/58612 Published: October 25, 2018

Summary

Hier präsentieren wir ein Protokoll, um DNA-Proben von Lebensmitteln und ökologischen Mikrobiome abgestimmte Erkennung und Subtypisierung von Salmonellen durch Sequenzierung Quasimetagenomic vorzubereiten. Der kombinierte Einsatz von Kultur Bereicherung, Immunomagnetic Separation (IMS) und mehrfache Verschiebung Verstärkung (MDA) ermöglicht wirksame Konzentration der Salmonellen genomische DNA aus Lebensmitteln und Umweltproben.

Abstract

Quasi-Metagenomik Sequenzierung bezieht sich auf die Sequenzierung basierende Analyse der veränderten Mikrobiome von Lebensmitteln und Umweltproben. In diesem Protokoll soll Microbiome Modifikation genomischer DNA ein Ziel durch Lebensmittel übertragene Erreger Kontaminanten, die Erkennung zu erleichtern und Subtypisierung des Erregers in einem Workflow zu konzentrieren. Hier, wir erklären und zeigen die Probe Vorbereitungsschritte für die quasi-Metagenomik Analyse Salmonella Enterica aus repräsentativen Lebensmitteln und Umweltproben einschließlich Alfalfasprossen, gemahlener schwarzer Pfeffer, Hackfleisch, Hähnchen Brust und ökologischen Tupfer. Proben werden zuerst die Kultur Anreicherung von Salmonellen für eine verkürzte und einstellbare Dauer (4 – 24 h) unterzogen. Salmonellen -Zellen sind dann selektiv aus der Bereicherung Kultur von Immunomagnetic Trennung (IMS) erfasst. Zu guter Letzt wird mehrere Verschiebung Verstärkung (MDA) durchgeführt, um DNA aus IMS erfasst Zellen verstärken. Die DNA-Ausgabe dieses Protokolls kann von Hochdurchsatz-Sequenzierung Plattformen sequenziert werden. Eine optionale quantitativen PCR-Analysen kann durchgeführt werden, um Sequenzierung für Salmonellen -Nachweis zu ersetzen oder die Konzentration von Salmonellen DNA vor der Sequenzierung zu bewerten.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Metagenomik Sequenzierung ermöglicht theoretisch abgestimmte Erkennung und Subtypisierung von lebensmittelbedingten Krankheitserregern. Jedoch Herausforderungen Lebensmittelproben auf die Analyse der Erreger durch direkte Sequenzierung von Essen Microbiome. Erstens sind lebensmittelbedingten Krankheitserregern häufig auf einem niedrigen Niveau in Lebensmittelproben. Die meisten im Handel erhältlichen Schnellnachweis Methoden noch benötigen 8 – 48 h Kultivierung Erreger Zellen nachweisbar Ebene1zu bereichern. Zweitens: viele Lebensmittel enthalten reichlich Mikroflora Zellen und/oder Essen DNA, damit durch Lebensmittel übertragene Erreger-DNA einen kleinen Bruchteil der Nahrung Metagenom und ein schwer erreichbares Ziel für Erkennung und Subtypisierung durch metagenomische Sequenzierung direkte.

Änderung der Nahrung Mikrobiome wurde berichtet, dass erhebliche Konzentration Foodborne pathogens DNA-Sequenzierung-basierte Erkennung von Shiga Toxin-produzierenden Escherichia coli2,3 und zu erleichtern Salmonella Enterica4. Weil Essen geändert Mikrobiome sind noch Mischungen aus verschiedenen Mikrobenarten, ihre Sequenzierung wird als quasi-metagenomischen Analyse4bezeichnet. Microbiome Modifikation kann durch Kultur Bereicherung allein2,3 oder in Kombination mit Immunomagnetic Trennung (IMS) und mehrfache Verschiebung Verstärkung (MDA)4,5durchgeführt werden. IMS können selektiv Erreger Zellen aus der Bereicherung Kultur über Antikörper-beschichtete magnetische Beads erfassen. MDA kann ausreichende Mengen von genomischer DNA Sequenzierung durch die hocheffiziente ɸ29 DNA-Polymerase6generieren. IMS-MDA hat kulturunabhängig Erregernachweis aus klinischen Proben7, und Verkürzung der Kultur Bereicherung für quasi-metagenomische Erkennung und Subtypisierung von Salmonellen in Lebensmitteln Proben4erlaubt.

Das übergeordnete Ziel dieser Methode ist es, quasi metagenomic DNA von Lebensmittelproben erlauben gezielte Konzentration von Salmonellen genomischer DNA und anschließenden Erkennung und Subtypisierung von Salmonellen Verunreinigung durch Sequenzierung vorzubereiten. Im Vergleich zu standard-Methoden für Salmonellen Erkennung8,9 und10Subtypisierung, kann der Quasimetagenomic Ansatz die Bearbeitungszeit von kontaminierten Lebensmitteln und Umweltproben, erheblich verkürzen. molekularen Subtypen des Erregers durch die Vereinheitlichung der beides in der Regel getrennt Analysen in einem Workflow. Diese Methode eignet sich besonders für Anwendungen wie lebensmittelbedingten Ausbrüchen und andere Spur zurück Untersuchungen, wo robuste Erreger Subtypisierung neben Erregernachweis erforderlich ist und schnelle analytische Turnaround ist wichtig.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. die Probenvorbereitung

Hinweis: Lebensmittelproben auf Voranreicherung nach Mikrobiologie Labor Guidebook (MLG) der US-Abteilung Landwirtschaft Lebensmittelsicherheit und Inspection Service (USDA-FSIS)11 und bakteriologische analytische Handbuch (BAM) der U.S. Food vorbereitet sind und Drug Administration (FDA)12.

  1. Aseptisch legen Sie eine 25 g Portion Schnupperprobe wie schwarzer Pfeffer, Hähnchenbrust, Hackfleisch, und Alfalfasprossen oder eine ökologische Tupfer in einen sterilen Labor-Mixer-Beutel mit einem eingebauten Filter. Bereiten Sie eine ökologische Tupfer von aseptisch Befeuchtung einen Schwamm mit Anreicherung Brühe (Rappaport Vassiliadis, RV). Dann ziehen Sie den Tupfer über vollflächig oder vorgegebenen Bereich und legen Sie sie in ein Labor-Mixer-Tasche.

Figure 1
Abbildung 1: repräsentative Lebensmitteln und Umweltproben für quasi-Metagenomik Erkennung und Subtypisierung von Salmonellen. Proben werden in Sterilfilter Stomacher Beutel zusammen mit RV Brühe gelegt. Klicken Sie bitte hier, um eine größere Version dieser Figur.

  1. Mischen Sie jede 25 g Probe mit 225 mL RV Bereicherung Brühe mit einer Labor-Mixer oder Hand-Massage für 30 s.
    Hinweis: Varianten der RV Brühe von MLG und BAM können je nach Art der Probe verwendet werden.
  2. Inkubieren Sie Probe-Anreicherung-Brühe-Gemisch in einem Labor-Inkubator für 4-24 h bei 42 ° C.
  3. Nach der Inkubation sammeln Sie eine 50 mL Teilstichprobe der Bereicherung Brühe aus der gefilterten Seite der Tasche in eine separate 50 mL Zentrifugenröhrchen.
  4. Zentrifugieren Sie das Rohr 100 X g für 10 min bis zum festen Ablagerungen in der Homogenat zu entfernen.
  5. Wiederherstellen Sie den Überstand sorgfältig, um eine neue 50 mL Röhrchen Zentrifugieren und Zentrifugieren der Rohre bei 3.000 – 6.000 x g für 10 min. Zelle Pellet wiederherstellen.
  6. (Optional) Verwerfen Sie den Überstand und waschen Sie das Pellet durch Resuspension in 5 mL des gepuffert Pepton Wasser (BPW) und Zentrifugieren Sie die Rohre bei 3.000 – 6.000 × g für 10 min.
    Hinweis: BPW können von auflösenden 10 g Pepton, 5 g Natrium-Chlorid, 3,5 g Binatrium Phosphat, und 1,5 g Monopotassium Phosphat in 1 L von destilliertem Wasser. Der endgültige pH-Wert sollte angepasst werden, um 7,2 ± 0,2 bei 25 ° C. Autoklaven bei 121 ° c für 15 min. im Handel erhältlichen BPW kann auch verwendet werden.
  7. Verwerfen Sie überstand und erneut aussetzen Sie das Pellet in 5 mL von BPW.

2. Immunomagnetic Separation (IMS) und mehrere Displacement Amplification (MDA)

Hinweis: Zur Vermeidung von Kreuzkontaminationen zwischen Proben arbeiten in eine biologische Kabinett, Pipettenspitzen für jedes Rohr zu ändern, berühren Sie das Rohr mit der Pipette und stellen nicht Rohre dicht beieinander im Magnetstativ während der Waschschritt.

  1. Tauen Sie den Probenpuffer und der Reaktion Puffer aus dem MDA-Kit auf Eis oder bei 4 ° C im Voraus.
  2. Mix 1 mL neu suspendierten Zelle pellet in BPW mit 20 μl Anti -Salmonellen Perlen in 1,5 mL Mikrozentrifugenröhrchen und legen Sie es auf der rotierenden Mischer für 30 min bei Raumtemperatur.
    Hinweis: Wettbewerbsfähige Flora, Fett Partikel und Proteine im Pellet resuspendierte IMS stören. Verdünnung der neu suspendierten Zelle Pellet in BPW ist hilfreich, den Verlust der Wulst -Salmonellen -komplexe aus Magnetstativ während Waschschritten zu verringern.
  3. Stecken Sie die Rohre in die Magnetstativ und erlauben Sie 3 min für die ordnungsgemäße Verwertung von Perlen durch Umdrehen des Racks mehrmals, die Perlen in einem Pellet auf der Seite der Röhre zu konzentrieren.
  4. Halten Sie die Rohre auf die Magnetstativ. Aspirieren Sie und entsorgen Sie des Überstands aus jedem Röhrchen sowie die restliche Flüssigkeit in jedem Röhrchen Kappe.
    Hinweis: Achten Sie darauf, das Pellet von IMS Perlen an der Seitenwand des Rohres gegen den Magneten stören.
  5. Entfernen Sie den Schlauch aus der Magnetstativ und fügen Sie 1 mL Waschpuffer (PBS mit 0,05 % (V/V) Polysorbat 20) und invertieren Sie mehrmals zu unspezifisch bindende Bakterien aus der Anlage zu entfernen.
  6. Wiederholen Sie die Schritte 2,3 bis 2,5 zweimal.
  7. Führen Sie nach der Wäsche 3rd die endgültige magnetische Trennung der Perlen durch Wiederholen der Schritte 2,3 – 2,4. Rohre aus magnetischen Rack entfernen und legen Sie sie in eine Microfuge für 1 s, Perlen zu spinnen. Dann setzen Sie die Rohre in die magnetische Rack für 3 min vor dem Entfernen Rückstände Waschpuffer.
  8. Wieder aussetzen Sie der Wulst -Salmonellen -komplexe in 9 μl Probenpuffer und inkubieren Sie bei 95 ° C für 3 min für Denaturierung.
  9. Nach dem Abkühlen auf 4 ° C auf dem Eis, kombinieren mit 9 μL der Reaktion Puffer plus 1 μL des Enzyms mischen und halten Sie auf dem Eis.
  10. Inkubieren Sie in einem Thermocycler Rohre bei 30 ° C für 2 h für Verstärkung, gefolgt durch Erhitzen bei 65 ° C für 10 min um inaktivieren das Enzym und auf 4 ° C auf Eis abkühlen.
  11. Die Quantität und Qualität der MDA-Produkte durch Messen der DNA-Konzentration und Reinheit (260/280 Verhältnis > 1.8) auf ein Fluorospectrometer Instrument zu beurteilen.
    Hinweis: Wegen der unspezifischen Bindung von IMS Perlen, genomischer DNA aus anderen Organismen als Salmonellen ist wahrscheinlich in den MDA-Produkten präsent zu sein, aber es hat keinen Einfluss auf nachgelagerte Analyse.
  12. Speichern Sie die Endprodukte (20 μl) bei-20 ° C bis zum Einsatz für Real-Time PCR und/oder Bibliothek Vorbereitung für Quasimetagenomics-Sequenzierung.

(3) Real-Time PCR

Hinweis: Dieser Schritt ist optional für 1) Erkennung von Salmonellen ohne Subtypisierung, und (2) Bewertung von Sample-Qualität vor Quasimetagenomics Sequenzierung.

  1. Vorbereitung 18 μl des PCR Mischung pro Probe, mit Universal PCR Master Mix (10 μl), die nach vorne Grundierung (2 μL, 900 nM), reverse Primer (2 μL, 900 nM), Sonde (2 μl, 250 nM), und molekulare Grade Wasser (2 μL).
    Hinweis: Salmonellen-spezifische Oligonukleotid-Primer (nach vorne: CTCACCAGGAGATTACAACATGG, Rückseite: AGCTCAGACCAAAAGTGACCATC) und Sonde wurden konzipiert, um verstärken eine 94-bp-Sequenz im Ttr -gen (GenBank Beitritt nein. AF 282268)13.
  2. Mischen Sie das MDA-Produkt aus Schritt 2.12 durch sanft nach oben und unten Wulst -Salmonellen komplexe zusammen mit Flüssigkeit zu einer Suspension pipettieren. Fügen Sie 2 μL der Suspension in 18 μl des PCR Mischung.
  3. Real-Time PCR mit eine optimierte Echtzeit-PCR-Protokoll ausführen, Angabe von zwei Haltefristen, bei 50 ° C für 2 min und bei 95 ° C für 10 min, gefolgt von 40 Zyklen von 95 ° C für 15 s und 60 ° C für 60 s.
  4. Berechnen Sie den Schwellenwert-Zyklus (Ct), ist die Anzahl der Zyklen für die Fluoreszenz der amplifizierten DNA erforderlich, um die Schwelle-Linie zu kreuzen.
    Hinweis: Die Schwelle-Linie befindet sich in der linearen Phase zwischen Grundlinie und Plateau der Verstärkung Grundstücke von Proben. Negative Ergebnisse entsprechen Ct-Werte über 40 oder Proben mit Ct-Werte höher als die der Negativkontrolle.

(4) Bibliothek Vorbereitung für Quasimetagenomic-Sequenzierung

Hinweis: Die MDA-Produkte können sowohl kurze und lange gelesen (Nanopore) Sequenzierung Plattformen sequenziert werden. Verwenden Sie die neueste Version von DNA Bibliothek Prep-Kits zur Verfügung gestellt von den Herstellern der Sequenzierung Plattformen. Durchführen Sie DNA-Bibliothek Vorbereitung nach Hersteller Anleitung. Verwenden Sie das 2D Low-Eingang genomische DNA-Protokoll Bibliothek Vorbereitung für die lange lesende Sequenzierung Plattform5. Für die Bibliothek Vorbereitung für die kurze lesende Sequenzierung-Plattform sind geringfügige Änderungen des Herstellers Protokolls unten angegeben.

  1. Folgen Sie Standardbibliothek Zubereitungsmethoden durch Zugabe von Reagenzien und Pufferlösungen, MDA-Produkte. Übertragen Sie 40 μl der Sequenzierung vorbereitet MDA Produkte auf eine neue Platte zu, und fügen Sie 20 μl des PCR-Reinigung-Perlen in jede Vertiefung.
  2. Inkubieren Sie die Platte bei Raumtemperatur für 10 min ohne schütteln.
  3. Waschen Sie die Perlen mit 80 % igem Ethanol und trocknen Sie die Perlen für 12 min.
  4. Wieder getrocknete Perlen in 53 μL der Wiederfreisetzung Puffer und 2 min inkubieren Sie, ohne schütteln.
  5. Verdünnen und Bibliotheken nach Anweisungen des Herstellers zu bündeln.
    Hinweis: Ein 22:00 gebündelt und denaturierte Bibliothek ist nun bereit, sequenziert werden.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vor Quasimetagenomic Sequenzierung können die allgemeine Menge und Reinheit der IMS-MDA-Produkte von Fluorospectrometer (Tabelle 1) ausgewertet werden.

Anreicherung-Zeit (h) CT-Wert Konzentration (ng/Ul) Reinheit (260/280)
Marke A 4 24,71 812.91 1,89
8 25.80 900.36 1,87
12 15.41 753.88 1,84
Marke B 4 20.63 872.61 1,87
8 22.61 993.41 1,87
12 19.08 954.44 1,87

Tabelle 1: qualitative und quantitative Bewertung von DNA-Proben für die quasi-metagenomische Sequenzierung. Salmonellen -Zellen geimpft wurden in 25 g rohes Hähnchenbrustfilet von zwei Marken zu 1 KBE/g Inoculated Proben wurden in RV für 4, 8 und 12 h vor IMS-MDA bereichert.

Gezielte Menge Bewertung von Salmonellen DNA kann durch Echtzeit-PCR (Tabelle 1 und Abb. 2), dient auch als Alternative für Salmonellen -Nachweis ggf. Subtypisierung nicht durchgeführt werden.

Figure 2
Abbildung 2: Real-Time PCR für Salmonellen -Erkennung oder Muster Beurteilung für die quasi-Metagenomik Sequenzierung. Verstärkung-Kurven von Real-Time PCR von Salmonellen DNA in IMS-MDA-Produkte nach 4, 8 und 12 h Bereicherung Zeit werden angezeigt. Eine Probe nach nur 2 h Bereicherung ist ebenfalls enthalten. Salmonellen -Zellen (0,27 KBE/g) wurden beimpften 25 g rohe Hähnchenbrust von beiden Marken A und B. Klicken Sie bitte hier, um eine größere Version dieser Figur.

Fluorospectrometer Messwerte erlauben Erstbewertung der Probenvorbereitung. Konzentration von IMS-MDA-Produkten zubereitet von Salmonella kontaminierte Hähnchenbrust Proben reichten von 701.54, 945.86 ng/µL, was darauf hindeutet, dass die Probe DNA verstärkt worden. Nach Anleitung des Herstellers ist DNA-Probe die Mindestkonzentration für kurze und lange gelesen Sequenzierung 0,2 ng/µL und 1 µg. Das 260/280 Verhältnis reichte von 1,85 bis 1,88 (Tabelle 1), zeigt die hohen Reinheit des DNA-Proben mit niedrigem Protein Verschmutzung.

Niedriger Ct-Werte bedeuten höhere Konzentrationen von Salmonellen genomischer DNA in der Probe. Wie in Tabelle 1 und Abbildung 2gezeigt, verringern Ct-Werte von IMS-MDA-Produkte als Bereicherung Zeit erhöht. In unserem früheren Studie4, bei der Ct-Werte unter 25, die meisten lagen (> 50 %) der SE war Genom sequenziert werden voraussichtlich und Serotyp Vorhersage von rohen Sequenzierung lautet war erfolgreich.

Erfolglose Kultur Bereicherung oder IMS führt zu einer relativ hohen Ct-Werte, die niedrigen Konzentration von Salmonellen genomischer DNA in die endgültige Stichprobe angibt, wie in Abbildung 2dargestellt. Dies kann trotz einer hohen DNA-Konzentration und Reinheit der IMS-MDA-Produkte wie Fluorospectrometer Lesungen vorgeschlagen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aufgrund der oft niedrigen Fülle und in homogenen Vorkommen von Salmonellen in Lebensmitteln und Umweltproben ist Kultur Bereicherung vor IMS-MDA zum Nachweis von Salmonellen und Subtypisierung weiterhin erforderlich; Es ist daher ein wichtiger Schritt des Protokolls. Um optimale Bedingungen für die Fülle von Salmonellen relativ zum Beispiel Hintergrund Flora erhöhen zu identifizieren, können verschiedene Bereicherung Medien für bestimmte Proben ausgewertet werden. Nach MLG und BAM selektiven Medium wie RV Brühe und nicht-selektiven Medium wie gepufferten Pepton Wasser und Laktose Brühe für Salmonellen Anreicherung von Lebensmittelproben einsetzbar. In unserem vorherigen Studie4 für Salmonellen Anreicherung von rohem Hühnerfleisch, Eisbergsalat und schwarze Pfefferkörner, Quasimetagenomic Analyse des Erregers zu unterstützen ist die Verwendung von RV bei 42 ° C ausgewertet worden. Laut FDA BAM und AOAC precollaborative8,9und gemeinsamer Studien14,15wird RV für die Analyse von hohen mikrobiellen und geringe Keimbelastung Lebensmittel empfohlen.

Die optimale Dauer der Kultur Bereicherung hängt von mehreren Faktoren ab, z. B. Probenart, Höhe der Kontamination mit Salmonellen und den physiologischen Zustand der Salmonellen -Schadstoff. Zum Beispiel, wenn niedrige Konzentrationen von Salmonellen (z. B.< 1 KBE/g) Zellen befinden sich in einer Fleisch-Probe und unter Kühlung Stress, Anreicherung länger (z.B. > 12 h) wieder zu beleben und bereichern Salmonellen Zellen erforderlich sein. Genügend Fülle von Salmonellen in der modifizierten Microbiome führt zu angemessenen Sequenzierung Abdeckung des Genoms Salmonellen Kontaminanten, die Belastungsstufe Einzel-Nukleotid Polymorphie (SNP)4Eingabe ermöglichen kann. Kürzere Bereicherung der Kultur (z. B. weniger als 12 h) ist möglich für schnelle Erkennung5 oder Serotypisierung von Salmonellen4.

Höhere Ebenen der Kontamination mit Salmonellen und/oder längere Kultur Anreicherung von kontaminierten Lebensmittelproben kann in höheren Konzentrationen von Salmonellen genomische DNA in veränderter Lebens-Mikrobiome, die Ct-Werte von niedrigeren führen führen die Echtzeit-PCR-Analyse. CT-Werte zeigen eine negative Korrelation mit Sequenzierung Abdeckung der Salmonellen Verunreinigung Genom4und können daher für die Optimierung und Modifikation des Workflows verwendet werden. Unserer Erfahrung nach ist Kultur Bereicherung, vor allem die Länge, oft im Mittelpunkt der Bemühungen zur Fehlerbehebung. Beispielsweise war die Ct-Werte der IMS-MDA Ware aus eine rohe Hühnerbrust Probe relativ hoch bei 35.94 (Abbildung 1). In diesem Beispiel wurde mit 2,5 KBE/g SE Zellen beimpft und inkubiert in BPW bei 37 ° C für 2 h Sequenzierung dieses Beispiels nicht bieten ausreichende Deckung des SE Genoms Serotyp Vorhersage ermöglichen. Im Vergleich dazu wurden die Proben mit 4 h oder länger Bereicherung erfolgreich aus Quasimetagenomic Sequenzierung (Daten nicht gezeigt) serotypisiert.

Nach der Sequenzierung empfiehlt es sich, mit Kraken16 um Salmonellen zu identifizieren für Bioinformatik Analysen liest. CFSAN SNP Pipeline17 und SeqSero18 können für SNP Typisierung und Serotypisierung Vorhersage von rohen Sequenzierung lautet, bzw. verwendet werden.

Diese Quasimetagenomic Technik hat einige Einschränkungen. DNA-Konzentration und Reinheit des IMS-MDA-Produkte durch ein Fluorospectrometer gemessen sollte zunächst nur als vorläufige Indikator für ordnungsgemäße Probenvorbereitung verwendet werden. Aufgrund der hohen Effizienz der MDA können Spuren von Eingabe DNA verstärkt werden, um ganze Genom-Sequenzierung19ausreichen. Hohe Qualität und Quantität DNA-Proben können daher noch erzeugt werden, auch wenn Kultur Bereicherung oder IMS nicht wirksam Salmonellen Zellen konzentrieren. Die optionale Echtzeit-PCR-Analyse bietet eine gezielte und informative Bewertung des gesamten Probe Vorbereitung Workflows. Zweite, schwer zu Kultur Salmonellen Zellen, wie z. B. lebensfähig aber Nonculturable (VBNC) Bakterien20, kann nicht wachsen während Kultur Bereicherung. Diese Zellen können daher nicht mit unserer Methode erkannt werden.

Zusammenfassend lässt sich sagen im Vergleich zu traditionellen Methoden, unsere Vorbereitung Beispielmethode und quasi-Metogenomic Sequenzierung Ansatz können erhebliche Reduzierung des analytischen Turnaround von Salmonellen-kontaminierten Lebensmitteln und Umweltproben, robuste Subtypisierung der Salmonellen Verunreinigungen. Neben Salmonellenhat diese Technik das Potenzial für schnelle und abgestimmte Erkennung und Subtypisierung andere Foodborne Krankheitserreger sein.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass sie keine finanziellen Interessenkonflikte.

Acknowledgments

Die Autoren möchten Danke Mark Harrison und Gwen Hirsch von der University of Georgia freundlicherweise dafür den Bakterienstamm und sonstige Unterstützung zu dieser Studie.

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
Quasi-metagenomischen Analyse <em>Salmonella</em> aus Lebensmitteln und Umweltproben
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter