Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Quasi-metagenomic analyses van Salmonella uit voedsel en milieu voorbeelden

doi: 10.3791/58612 Published: October 25, 2018

Summary

Hier presenteren we een protocol ter voorbereiding van de DNA-monsters van het voedsel en milieu microbiomes voor gezamenlijke detectie en subtypering van Salmonella via quasimetagenomic sequencing. Het gecombineerd gebruik van cultuur verrijking, immunomagnetic scheiding (IMS) en meerdere verplaatsing mogelijk versterking (MDA) van de effectieve concentratie van Salmonella genomic DNA van voedsel en milieu monsters.

Abstract

Quasi-metagenomics sequencing verwijst naar de volgorde gebaseerde analyse van gewijzigde microbiomes van voedsel en milieu monsters. In dit protocol is microbiome wijziging ontworpen om genomic DNA van een target foodborne pathogen verontreinigingen te vergemakkelijken van de opsporing en subtypering van het pathogene agens in een afzonderlijke workflow concentreren. Hier, we uitleggen en demonstreren de sample voorbereiding stappen voor de analyse van de quasi-metagenomics van Salmonella enterica uit representatieve voedsel en milieu monsters, met inbegrip van alfalfa spruiten, gemalen zwarte peper, gemalen rundvlees, kip borst en milieu-swabs. Monsters worden eerst onderworpen aan de verrijking van de cultuur van Salmonella gedurende een verkorte en verstelbaar (4-24 h). Salmonella cellen worden vervolgens selectief opgevangen uit de cultuur van verrijking door immunomagnetic scheiding (IMS). Ten slotte, meerdere verplaatsing versterking (MDA) wordt uitgevoerd om te vergroten van DNA uit cellen IMS-gevangen. De output van de DNA van dit protocol kan worden sequenced door hoge doorvoer sequencing platformen. Een optionele kwantitatieve PCR analyse kan worden uitgevoerd ter vervanging van de volgorde van Salmonella detectie of beoordelen van de concentratie van Salmonella DNA alvorens sequencing.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Metagenomics sequencing kan theoretisch gezamenlijke detectie en subtypering van door voedsel overgedragen ziekteverwekkers. Echter presenteren voedsel monsters uitdagingen voor de pathogeen-analyse door het directe rangschikken van de voedsel-microbiome. Ten eerste, foodborne ziekteverwekkers zijn vaak aanwezig op een laag niveau in monsters van levensmiddelen. De meeste van de commercieel beschikbare snelle detectie-methoden nog vereisen 8-48 h kweken om te verrijken pathogen cellen tot een aantoonbaar niveau1. Ten tweede, veel voedingsmiddelen bevatten overvloedige microflora cellen en/of voedsel DNA, waardoor foodborne pathogen DNA een klein deel van de voedsel-metagenome en een ongrijpbare doel voor detectie en subtypering door metagenomic sequencing directe.

Wijziging van voedsel microbiomes is gemeld dat een aanzienlijke concentratie van foodborne pathogen DNA te vergemakkelijken sequencing gebaseerde detectie van Shiga-toxine-producerende Escherichia coli2,3 en Salmonella enterica4. Omdat gemodificeerde levensmiddelen microbiomes zijn nog steeds mengsels van verschillende soorten van microbiële, hun volgorde wordt genoemd als quasi-metagenomic analyses4. Wijziging van de Microbiome kan worden uitgevoerd door cultuur verrijking alleen2,3 , of in combinatie met immunomagnetic scheiding (IMS) en meerdere verplaatsing versterking (MDA)-4,5. IMS kunt selectief pathogen cellen uit de cultuur van de verrijking via magnetische kralen antilichaam beklede vastleggen. MDA kan het genereren van voldoende hoeveelheden genomic DNA voor het rangschikken tot en met de zeer efficiënte ɸ29 polymerase van DNA6. IMS-MDA heeft cultuur-onafhankelijke pathogen detectie van klinische monsters7, verkorting van de verrijking van de cultuur voor quasi-metagenomic detectie en subtypering van Salmonella in levensmiddelen monsters4toegestaan.

Het algemene doel van deze methode is om voor te bereiden van quasi-metagenomic DNA van voedsel monsters dat gerichte concentratie van Salmonella genomic DNA en latere detectie en subtypering van de Salmonella -verontreiniging door sequentiebepaling. Vergeleken met standaardmethoden voor Salmonella detectie8,9 en10subtypering, kan de aanpak van de quasimetagenomic de doorlooptijd van besmet voedsel en milieu monsters aanzienlijk verkorten moleculaire subtypen van het pathogene agens door het verenigen van de twee meestal gescheiden analyses in een enkele workflow. Deze methode is vooral handig voor toepassingen zoals door voedsel overgedragen uitbraak reactie en andere trace terug onderzoeken waar robuuste pathogen subtypering is vereist naast pathogen detectie en snelle analytische ommekeer is belangrijk.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. de monstervoorbereiding

Opmerking: Voedsel monsters zijn voorbereid voor pre verrijking volgens microbiologie laboratorium Guidebook (MLG) van het Amerikaanse ministerie van landbouw voedselveiligheid en Inspection Service (USDA-FSIS)11 en bacteriologische analytische handleiding (BAM) van de Amerikaanse Food en Drug Administration (FDA)12.

  1. Aseptisch plaatsen een 25 g deel van voedsel monster zoals zwarte peper, kipfilet, rundergehakt, en alfalfa spruiten of een milieu doekje in een steriele laboratorium blender zak met een ingebouwde filter. Bereid een milieu doekje door aseptisch bevochtigen van een spons met verrijking Bouillon (Rappaport-Vassiliadis, RV). Vervolgens het staafje over het gehele oppervlak of het vooraf bepaalde gebied sleept en plaatst u deze in een laboratorium blender zak.

Figure 1
Figuur 1: vertegenwoordiger voedsel en milieu monsters voor quasi-metagenomics detectie en subtypering van Salmonella. Monsters worden geplaatst in steriele filter stomacher zakken samen met RV Bouillon. Klik hier voor een grotere versie van dit cijfer.

  1. Grondig Meng elk 25 g monster met RV verrijking 225 mL bouillon met behulp van een laboratorium blender of hand massage voor 30 s.
    Opmerking: Varianten van RV Bouillon zoals aanbevolen door MLG en BAM kunnen afhankelijk van de typen monster worden gebruikt.
  2. Incubeer monster-verrijking Bouillon mengsel in een laboratorium incubator bij 42 ° C gedurende 4-24 uur.
  3. Na incubatie, een 50 mL deelsteekproef van verrijking Bouillon van de gefilterde kant van de tas in een centrifugebuis aparte 50 mL te verzamelen.
  4. Centrifugeer de buis bij 100 x g gedurende 10 minuten te verwijderen van solide puin in het homogenaat.
  5. Herstellen het supernatant zorgvuldig om een nieuwe 50 mL Centrifugeer buis en centrifugeer de buizen bij 3000-6000 x g gedurende 10 minuten om te herstellen van de cel pellet.
  6. (Optioneel) Verwijder het supernatant en de pellet door resuspensie in 5 mL van gebufferd pepton Water (BPW) wassen en centrifugeren van de buizen bij 3000-6000 × g gedurende 10 minuten.
    Opmerking: BPW kan bereid door oplossen pepton, 5 g natriumchloride, 10 g 3.5 g Dinatrium fosfaat, en 1.5 g van Monokalium fosfaat in 1 L van gedestilleerd water. De definitieve pH moet worden aangepast aan 7.2 ± 0,2 bij 25 ° C. Autoclaaf bij 121 ° c gedurende 15 minuten verkrijgbare BPW kan ook worden gebruikt.
  7. Verwijder supernatant en resuspendeer de pellet in 5 mL BPW.

2. Immunomagnetic scheiding (IMS) en meerdere Displacement Amplification (MDA)

Opmerking: Voorkom kruisbesmetting tussen monsters en werken in een kabinet bioveiligheid, wijzigen Pipetteer tips voor elke buis, raak de buis met het pipet en plaats geen buizen dicht bij elkaar in magnetische stand tijdens het wassen stap.

  1. Ontdooi de monster-buffer en de buffer van de reactie van de MDA kit op ijs of bij 4 ° C op voorhand.
  2. Meng 1 mL van cel opnieuw gesuspendeerde pellet in BPW met 20 μL van anti -Salmonella kralen in 1,5 mL microcentrifuge buizen en plaats deze op de roterende mixer gedurende 30 minuten bij kamertemperatuur.
    Opmerking: Concurrerende flora, vet deeltjes en eiwitten in de geresuspendeerde pellet kunnen interfereren met IMS. Verdunning van cel opnieuw gesuspendeerde pellet in BPW is handig om het verlies van de kraal -Salmonella complexen van de magnetische staan tijdens het wassen stappen.
  3. Invoegen van de buizen in de magnetische stand en laat 3 min voor het juiste herstel van kralen door het omkeren van het rek meerdere malen te concentreren van de kralen in een pellet aan de kant van de buis.
  4. Houd de buizen op de magnetische stand. Gecombineerd en verwijder het supernatant van elke buis, evenals de resterende vloeistof in GLB van elke buis.
    Opmerking: Wees voorzichtig niet te verstoren de pellet van IMS parels op de zijwand van de buis tegen de magneet.
  5. Verwijderen van de houder van de buis van de magnetische stand en voeg 1 mL was buffer (PBS met 0,05% (v/v) Polysorbaat 20) en omkeren van meerdere keren te verwijderen van niet-specifiek bindende bacteriën van het complex.
  6. Herhaal stap 2.3-2.5 tweemaal.
  7. Voer de laatste magnetische scheiding van parels herhalende stappen 2.3-2.4 na de 3rd wash. Verwijder buizen uit magnetische rek en plaats hen in een microfuge voor 1 s te draaien naar beneden kralen. Dan de buizen in de magnetische rek voor 3 min voordat het verwijderen van alle resterende was buffer te plaatsen.
  8. Resuspendeer de kraal -Salmonella complexen in 9 μL van monster buffer en Incubeer bij 95 ° C gedurende 3 min voor denaturatie.
  9. Na afkoelen tot 4 ° C op ijs, combineren met 9 μL van reactie buffer plus 1 μL van enzym mengen en houd op ijs.
  10. In een thermische cycler, incubeer buizen bij 30 ° C gedurende 2 h voor amplificatie, gevolgd door de verwarming bij 65 ° C gedurende 10 minuten om de inactivering van het enzym en laat afkoelen tot 4 ° C op ijs.
  11. Het beoordelen van de kwantiteit en kwaliteit van de producten van MDA door het meten van de DNA-concentratie en zuiverheid (260/280 verhouding > 1.8) op een fluorospectrometer instrument.
    Opmerking: Vanwege niet-specifieke binding van IMS kralen, genomic DNA van andere organismen dan Salmonella is waarschijnlijk in de MDA producten aanwezig te zijn, maar doet geen afbreuk aan downstream-analyse.
  12. Bewaren de eindproducten (20 μL) bij-20 ° C tot gebruik voor PCR in real time en/of bibliotheek voorbereiding voor het rangschikken van de quasimetagenomics.

3. real-Time PCR

Opmerking: Deze stap is optioneel voor het 1) het opsporen van Salmonella zonder subtypering, en 2) beoordeling van de kwaliteit van de steekproef vóór quasimetagenomics sequencing.

  1. Bereiden van 18 μL van PCR mengsel per monster, met universele PCR Master Mix (10 μL), toekomen primer (2 μL, 900 nM), omkeren primer (2 μL, 900 nM), sonde (2 μL, 250 nM), en moleculaire rang water (2 μL).
    Opmerking: Salmonella-specifieke oligonucleotide inleidingen (uit: CTCACCAGGAGATTACAACATGG, omgekeerde: AGCTCAGACCAAAAGTGACCATC) en sonde zijn ontworpen om aan te vullen een 94-bp-reeks binnen de ttr -gen (GenBank toetreding neen. AF 282268)13.
  2. Meng de MDA product uit stap 2.12 door zachtjes op en neerSalmonella complexen kraal - samen met de vloeistof te maken van een schorsing pipetteren. 2 μL van de schorsing in 18 μL van PCR mengsel toevoegen.
  3. Uitvoeren van PCR in real time via een geoptimaliseerde real-time PCR protocol, waarin twee bedrijf tijdvakken, één bij 50 ° C gedurende 2 minuten en een ander bij 95 ° C gedurende 10 min, gevolgd door 40 cycli van 95 ° C voor 15 s en 60 ° C gedurende 60 s.
  4. Berekening van de drempel-cyclus (Ct), die het aantal cycli dat nodig is voor de fluorescentie van de versterkte DNA is aan de lijn van de drempel te overschrijden.
    Opmerking: De drempel regel is ingesteld in de lineaire fase tussen de basislijn en het plateau van de percelen van de versterking van de monsters. Negatieve resultaten komen overeen met de Ct-waarden over 40 of monsters met Ct-waarden hoger dan die van de negatieve controle.

4. bibliotheek voorbereiding-Quasimetagenomic Sequencing

Opmerking: De MDA producten kunnen sequenced worden door zowel korte en lange sequencing platformen Lees (nanopore). Gebruik de nieuwste versie van DNA bibliotheek prep kits die door fabrikanten van de sequencing-platforms. DNA bibliotheek voorbereiding volgens fabrikanten instructie uitvoeren Het 2D lage-input genomic DNA-protocol gebruiken voor de voorbereiding van de bibliotheek voor de lange-lezen sequencing platform5. Voor de voorbereiding van de bibliotheek voor het korte-lezen sequencing-platform, zijn kleine wijzigingen van de fabrikant protocol vindt u hieronder.

  1. Volg standaard bibliotheek bereidingswijzen door bufferoplossingen en reagentia aan MDA producten toe te voegen. 40 μL van de sequencing klaargestoomd MDA producten overdragen aan een nieuwe plaat en 20 μL van PCR zuivering kralen toevoegen aan elk putje.
  2. Incubeer de plaat bij kamertemperatuur gedurende 10 minuten zonder schudden.
  3. Wassen van de kralen met 80% ethanol en droog de kralen voor 12 min.
  4. Resuspendeer gedroogde kralen in 53 μL van resuspensie buffer en incubeer gedurende 2 min zonder schudden.
  5. Verdun en bundelen van bibliotheken volgens instructies van de fabrikant.
    Opmerking: Een 10 pM gebundeld en gedenatureerde bibliotheek is nu klaar om te worden gesequentieerd.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Voorafgaand aan de quasimetagenomic sequencing, kunnen de totale hoeveelheid en zuiverheid van de IMS-MDA producten worden geëvalueerd door de fluorospectrometer (tabel 1).

Verrijking tijd (h) Waarde van de CT Concentratie (ng/ul) Zuiverheid (260/280)
Merk A 4 24.71 812.91 1.89
8 25.80 900.36 1.87
12 15.41 753.88 1,84
Merk B 4 20.63 872.61 1.87
8 22.61 993.41 1.87
12 19.08 954.44 1.87

Tabel 1: beoordeling van de kwaliteit en kwantiteit van DNA monsters voor quasi-metagenomic sequencing. Salmonella cellen waren geënt in 25 g rauwe kipfilet van twee merken op 1 CFU/g. Inoculated monsters werden verrijkt met RV voor 4, 8 en 12 h voor IMS-MDA.

Gerichte hoeveelheid beoordeling van Salmonella DNA kan worden uitgevoerd door PCR in real time (tabel 1 en Figuur 2), die ook als een alternatief voor de opsporing van Salmonella fungeert als subtypering is niet nodig.

Figure 2
Figuur 2: PCR in real time voor Salmonella detectie of monster beoordeling voor quasi-metagenomics sequencing. Curven van de amplificatie van PCR in real time van Salmonella DNA in de IMS-MDA producten na 4, 8 en 12 h verrijking tijd worden weergegeven. Een monster na slechts 2 h verrijking is ook opgenomen. Salmonella cellen (0,27 CFU/g) werden geënte 25 g rauwe kipfilet van twee merken A en B. Klik hier voor een grotere versie van dit cijfer.

Fluorospectrometer lezingen toestaan initiële beoordeling van de bereiding van de monsters. Concentratie van IMS-MDA producten bereid met Salmonella besmette kipfilet monsters varieerden van 701.54 tot 945.86 ng/µL, suggereren dat het DNA-monster heeft versterkt. Volgens de oriëntatie van de fabrikant is de minimumconcentratie voor DNA-monster voor korte en lange Lees sequencing 0,2 ng/µL en 1 µg, respectievelijk. De 260/280 verhouding varieerden van 1,85 tot 1,88 (tabel 1), hoge zuiverheid van de DNA-monsters met lage niveaus van proteïne besmetting tonen.

Lagere Ct-waarden geven aan hogere concentraties van Salmonella genomic DNA in het monster. Zoals blijkt uit tabel 1 en Figuur 2, afnemen Ct waarden van IMS-MDA producten als verrijking tijd toeneemt. In onze vorige studeren4, wanneer de Ct-waarden lager dan 25, de meeste waren (> 50%) van de SE genoom was waarschijnlijk worden sequenced en serotype voorspellingen op basis van rauwe sequencing leest was succesvol.

Mislukte cultuur verrijking of IMS kan resulteren in een relatief hoge Ct-waarden waarmee lage concentratie van Salmonella genomic DNA in het uiteindelijke monster zoals afgebeeld in Figuur 2. Dit kan gebeuren ondanks een hoog DNA-gehalte en de zuiverheid van de IMS-MDA producten zoals voorgesteld door fluorospectrometer lezingen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vanwege de vaak lage overvloed en in-homogene aanwezigheid van Salmonella in levensmiddelen en milieu monsters, cultuur verrijking voor IMS-MDA is nog steeds noodzakelijk voor Salmonella detectie en subtypering; het is daarom een belangrijke stap van het protocol. Om optimale omstandigheden te verhogen van de overvloed van Salmonella ten opzichte van monster achtergrond flora, kan verschillende verrijking media voor specifieke monsters worden geëvalueerd. Volgens MLG en BAM, kunnen zowel selectieve medium zoals RV Bouillon en niet-selectieve medium zoals gebufferd pepton water en lactose Bouillon worden gebruikt voor Salmonella verrijking van monsters van de levensmiddelen. Het gebruik van RV bij 42 ° C is geëvalueerd in onze eerdere studie4 voor Salmonella verrijking van rauw kippenvlees, ijsbergsla en zwarte peperkorrels ter ondersteuning van de quasimetagenomic analyse van het pathogene agens oplevert. Volgens FDA BAM en AOAC precollaborative8,9en gezamenlijke studies14,15, wordt RV aanbevolen voor de analyse van hoge microbiële en lage belasting van microbiële voedingsmiddelen.

De optimale duur van cultuur verrijking, is afhankelijk van meerdere factoren, zoals monster type, mate van Salmonella besmetting en de fysiologische toestand van de verontreiniging van Salmonella . Bijvoorbeeld, wanneer lage niveaus van Salmonella (bijvoorbeeld< 1 CFU/g) cellen aanwezig in een monster van vlees en onder koeling stress zijn, verrijking langer (b.v., > 12u) kan nodig zijn om te doen herleven en verrijken van Salmonella cellen. Voldoende overvloed van Salmonella in de gewijzigde microbiome leidt tot dekking van de voldoende sequentiebepaling van het genoom van Salmonella verontreinigingen, die stam-niveau single nucleotide polymorphism (SNP)4typen kan toestaan. Kortere verrijking van cultuur (bijvoorbeeld minder dan 12 h) is mogelijk voor snelle detectie5 of serotypering van Salmonella4.

Hogere niveaus van Salmonella besmetting en/of langere cultuur verrijking van besmet voedsel monsters kan resulteren in hogere concentraties van Salmonella genomic DNA in microbiomes van de gemodificeerde levensmiddelen, die leiden tot lagere Ct waarden uit de Real-time PCR analyse. CT-waarden weergeven een negatieve correlatie met dekking van de sequentiebepaling van het genoom van Salmonella verontreinigingen4, en daarom kunnen worden gebruikt voor optimalisatie en wijziging van de workflow. Volgens onze ervaring is cultuur verrijking, met name de lengte ervan, vaak de focus van het oplossen van problemen met inspanningen. Bijvoorbeeld, was de waarde van de Ct van de IMS-MDA product uit een rauwe kipfilet monster relatief hoog op 35.94 (Figuur 1). In dit voorbeeld was geënt met 2,5 CFU/g SE cellen en geïncubeerd in BPW bij 37 ° C gedurende 2 h. sequentiebepaling van dit voorbeeld niet voldoende dekking van het SE genoom dat serotype voorspelling hebben verstrekt. In vergelijking, werden alle andere monsters met 4 uur of langer verrijking met succes serotyped uit quasimetagenomic sequencing gegevens (niet afgebeeld).

Na sequencing, is het raadzaam voor verdere bioinformatics analyses met behulp van Kraken16 te identificeren van Salmonella leest. CFSAN SNP pijpleiding17 en18 van de SeqSero kunnen worden gebruikt voor SNP te typen en serotypering voorspellingen op basis van rauwe sequencing leest, respectievelijk.

Deze quasimetagenomic-techniek heeft verscheidene beperkingen. Eerst, DNA-concentratie en zuiverheid van de producten van de IMS-MDA gemeten door een fluorospectrometer dient alleen als een voorlopige indicator van juiste monstervoorbereiding. Als gevolg van de hoge efficiëntie van MDA, kunnen sporen van input DNA worden versterkt om het hele genoom sequencing19volstaan. Hoge kwaliteit en kwantiteit DNA-monsters kunnen dus nog steeds worden gegenereerd, zelfs als cultuur verrijking of IMS niet effectief concentreren Salmonella cellen. De optionele real-time PCR analyse biedt een meer gerichte en informatieve beoordeling van de gehele steekproef voorbereiding workflow. Tweede, moeilijk-aan-cultuur Salmonella cellen, zoals levensvatbare maar nonculturable (VBNC) bacteriën20, kan niet groeien in cultuur verrijking. Deze cellen kunnen dus niet worden herkend door onze methode.

Kortom, in vergelijking met traditionele methoden, onze steekproef voorbereiding methode en quasi-metogenomic sequencing aanpak kunnen aanzienlijke vermindering van de analytische ommekeer van Salmonella-besmet voedsel en milieu monsters robuuste subtypering van de Salmonella -verontreinigingen. Naast Salmonellaheeft deze techniek de potentie die worden toegepast op snelle en gecoördineerde detectie en andere door voedsel overgedragen ziekteverwekkers subtypering.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat zij geen concurrerende financiële belangen hebben.

Acknowledgments

De auteurs bedank Mark Harrison en Gwen Hirsch van de Universiteit van Georgia voor het vriendelijk verstrekken de bacteriële stam en andere steun aan deze studie.

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
Quasi-metagenomic analyses van <em>Salmonella</em> uit voedsel en milieu voorbeelden
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter