Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

음식과 환경 샘플에서 살 모 넬 라 의 준 metagenomic 분석

doi: 10.3791/58612 Published: October 25, 2018

Summary

여기, 선물이 공동된 검색 및 quasimetagenomic 시퀀싱을 통해 살 모 넬 라의 동등에 대 한 음식과 환경 microbiomes에서 DNA 샘플을 준비 하는 프로토콜. 사용 문화 농축, immunomagnetic 분리 (IMS), 및 다중 변위 증폭 (MDA) 음식과 환경 샘플에서 살 모 넬 라 genomic DNA의 효과적인 농도 하실 수 있습니다.

Abstract

준 metagenomics 시퀀싱 음식과 환경 샘플의 수정 된 microbiomes의 시퀀싱 기반 분석을 말합니다. 이 프로토콜에서 미생물 수정 대상 foodborne 병원 체 오염 물질의 탐지를 촉진 하기 위하여 genomic DNA와 단일 워크플로에 병원 체의 동등을 집중 하도록 설계 되었습니다. 여기, 우리가 설명 대표 음식과 알 팔 파 콩나물을 포함 하 여 환경 샘플에서 살 모 넬 라 enterica 준 metagenomics 분석에 대 한 샘플 준비 단계 지상 검은 후추, 갈은 쇠고기, 닭고기 가슴 보여주는 그리고 환경 면봉입니다. 샘플 먼저 동안 단축 및 조절 (4-24 h) 살 모 넬 라 의 문화 강화를 받게 됩니다. 살 모 넬 라 셀 다음 선택적으로 캡처됩니다 농축 문화에서 immunomagnetic 분리 (IMS)에 의해. 마지막으로, 다중 변위 증폭 (MDA)는 IMS 캡처한 세포에서 DNA를 증폭 하는 수행 됩니다. 이 프로토콜의 DNA 출력 높은 처리량 시퀀싱 플랫폼으로 시퀀싱 될 수 있습니다. 살 모 넬 라 검출에 대 한 시퀀싱을 대체 하거나 시퀀싱 전에 살 모 넬 라 DNA의 농도 평가 하는 선택적 정량 PCR 분석을 수행할 수 있습니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Metagenomics 시퀀싱은 이론적으로 공동된 탐지 및 foodborne 병원 체의 동등 수 있습니다. 그러나, 음식 샘플 식품 미생물의 직접적인 연속 병원 체 분석 과제를 제시합니다. 첫째, foodborne 병원 체 들은 현재 수준 낮은 음식 샘플에 있습니다. 여전히 상용 신속한 검출 방법의 대부분 8-48 h 감지 레벨1로 병원 체 세포를 풍부 하 게 재배 해야 합니다. 둘째, 풍부한 microflora 셀 및 음식 만들기 foodborne 병원 체 DNA 음식 metagenome 및 애매 한 대상의 극히 metagenomic 시퀀싱 직접 검색 및 동등에 대 한 DNA 포함 하는 많은 음식.

음식 microbiomes의 foodborne 병원 체 시가 독 소 생산 대장균2,3 , 의 시퀀싱 기반 탐지를 촉진 하기 위하여 DNA의 내용이 풍부한 농도 수 있도록 보고 되었습니다. 살 모 넬 라 enterica4. 변형 식품 때문에 microbiomes는 여전히 다른 미생물 종의 혼합물, 그들의 시퀀싱은 준 metagenomic 분석4으로 불린다. 미생물 수정 문화 농축 혼자2,3 또는 다중 변위 증폭 (MDA)4,5immunomagnetic 분리 (IMS)와 함께에서 수행할 수 있습니다. IMS는 선택적으로 항 체-코팅 된 자석 구슬을 통해 농축 문화에서 병원 체 세포를 캡처할 수 있습니다. MDA는 고효율 ɸ29 DNA 중 합 효소6시퀀싱에 대 한 게놈 DNA의 충분 한 양을 생성할 수 있습니다. IMS-MDA는 임상 샘플7, 준 metagenomic 검색 문화 농축의 단축 및 식품 샘플4 살 모 넬 라 의 동등에서 문화권 병원 체 탐지를 허용 했다.

이 방법의 전반적인 목표 음식 샘플에서 살 모 넬 라 genomic DNA와 후속 검색의 타겟된 농도 및 시퀀싱에 의해 살 모 넬 라 오염 물질의 동등 하 준 metagenomic DNA를 준비 하는 것입니다. 살 모 넬 라 검출8,9 에 대 한 표준 방법에 비해와10동등, quasimetagenomic 접근 실질적으로 오염 된 음식과 환경 샘플에서 처리 시간을 단축 수 있습니다. 일반적으로 두 가지를 통합 하 여 병원 체의 분자 하위 단일 워크플로우로 분석을 분리. 이 메서드는 식중독 발발 응답 및 다른 추적 다시 조사 병원 체 검출 이외에 필요한은 강력한 병원 체 동등 그리고 신속한 분석 처리 중요 한 특히 유용 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 샘플 준비

참고: 음식 샘플 사전 농축 미생물학 실험실 가이드북 (MLG)에 따르면 미국 부의 농업 식품 안전 및 검사 서비스 (FSIS USDA)11 및 미국 식품의 세균 분석 매뉴얼 (BAM)의 준비는 하 고 약 청 (FDA)12.

  1. Aseptically 내장 필터와 살 균 실험실 블렌더 가방에 후추, 닭 가슴살, 쇠고기, 그리고 알 팔 파 새싹 또는 환경 면봉 등 음식 샘플 25 g 부분 장소. Aseptically 농축 국물 (라파 Vassiliadis, RV)와 스폰지를 습 하 게 하 여 환경 면봉을 준비 합니다. 그런 다음, 면봉 전체 표면 또는 미리 정해진된 영역 끌어서 실험실 블렌더 가방에 그것을 배치.

Figure 1
그림 1: 대표 음식과 준 metagenomics 감지 및 살 모 넬 라의 동등에 대 한 환경 샘플. 샘플은 RV 국물 함께 살 균 필터 stomacher 가방에 배치 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

  1. 철저 하 게 혼합 각 25 g 샘플 RV 농축의 225 mL 국물 실험실 믹서 또는 핸드 마사지를 사용 하 여 30 s.
    참고: RV 국물 MLG와 BAM 권장의 변종 샘플 유형에 따라 사용할 수 있습니다.
  2. 4-24 h에 대 한 42 ° C에서 실험실 인큐베이터에서 샘플 농축 수프 혼합물을 품 어.
  3. 부 화, 이후 별도 50 mL 원심 분리기 튜브에서 가방 필터링에서 농축 국물의 50 mL subsample를 수집 합니다.
  4. homogenate에서 고체 파편을 제거 하는 10 분 x 100g에 튜브 원심
  5. 새로운 50 mL 원심 튜브와 튜브 셀 펠 릿 복구를 10 분 동안 3000-6000 x g에서 원심을 신중 하 게 상쾌한을 복구 합니다.
  6. (선택 사항) 삭제는 상쾌한 5 mL 버퍼링 펩 물 (BPW)에 다시 정지 하 여 펠 릿을 세척 하 고 10 분 동안 3000-6000 × g에서 튜브 원심.
    참고: BPW 수 준비 펩, 염화 나트륨의 5 g의 녹이는 10 g disodium의 3.5 g 인산 염, 및 1.5 g monopotassium 인산 염의 1 L의 증류수. 25 ° c.에 7.2 ± 0.2에 최종 pH는 조정 한다 15 분 상용 BPW 위한 121 ° C에서 압력솥도 사용할 수 있습니다.
  7. 상쾌한 삭제 하 고 다시 BPW의 5 ml에서는 펠 릿을 일시 중단.

2. Immunomagnetic 분리 (IMS) 및 다중 변위 증폭 (MDA)

참고: 샘플 간의 교차 오염을 방지 하기 위해, biosafety 내각에서 일, 각 관에 대 한 피 펫 팁, 피 펫, 함께 튜브를 만지지 마십시오 변화와에 배치 하지 마십시오 튜브 가깝게 마그네틱 스탠드 세척 단계 동안.

  1. 샘플 버퍼와 MDA 키트 또는 얼음에 4 ° C에서 반응 버퍼를 사전에 해 동.
  2. 다시 일시 중단 된 셀의 믹스 1 mL BPW에 안티-살 모 넬 라 1.5 mL microcentrifuge 튜브에 구슬의 20 μ와 작은 실 온에서 30 분 동안 회전 믹서에 넣습니다.
    참고: 경쟁, 지방 입자, 식물과 resuspended 펠 릿에 있는 단백질 수 방해할 IMS. BPW 펠 릿 다시 일시 중단 된 셀의 희석 단계를 세척 하는 동안 자석 스탠드에서 구슬-살 모 넬 라 단지의 손실을 줄이기 위해 도움이 됩니다.
  3. 마그네틱 스탠드에 튜브를 삽입 하 고 튜브의 측면에 펠 릿에 비즈를 집중 하는 랙 여러 번 반전 하 여 구슬의 적절 한 복구를 위해 3 분을 허용.
  4. 마그네틱 스탠드에 튜브를 유지. 발음 및 각 관, 각 관의 모자에 남은 액체에서 상쾌한 삭제.
    주: 수는 자석에 대 한 튜브의 측면 벽에 IMS 구슬의 펠 렛을 방해 하지 않도록 주의 하십시오.
  5. 마그네틱 스탠드에서 튜브 홀더를 제거 하 고 워시 버퍼 (PBS 포함 하는 0.05% (v/v) 폴 20) 1 mL를 추가 복잡 한에서 비 특정 바인딩 박테리아를 제거 하는 여러 번 반전.
  6. 2.3-2.5 단계를 두 번 반복 합니다.
  7. 3rd 세척 후 단계 2.3-2.4를 반복 하 여 구슬의 최종 자력 분리를 수행 합니다. 마그네틱 선반에서 튜브를 제거 하 고 1 microfuge에 구슬 아래로 회전 하는 s. 다음, 모든 잔여 워시 버퍼를 제거 하기 전에 3 분 자기 랙에서 튜브를 놓습니다.
  8. 샘플 버퍼의 9 μ에서 다시 구슬-살 모 넬 라 단지를 일시 중단 하 고 변성에 대 일 분 동안 95 ° C에 품 어.
  9. 얼음에 4 ° C에 냉각 후 반응 버퍼의 9 μ와 결합 플러스 1 μ 효소의 혼합 하 고 얼음에 계속.
  10. 열 cycler에서 뒤에 얼음에 4 ° C에 냉각 한다 효소 비활성화를 10 분 동안 65 ° C에서 난방 확대를 위한 2 h 30 ° C에서 튜브를 품 어.
  11. DNA 농도 및 순도 (260/280 비율 > 1.8) fluorospectrometer 계기에 측정 하 여 수량 및 MDA 제품의 품질을 평가 합니다.
    참고: IMS 구슬의 비 특정 바인딩 때문에 살 모 넬 라 다른 유기 체에서 게놈 DNA MDA 제품에 있을 것 이지만 다운스트림 분석에는 영향을 주지 않습니다.
  12. 실시간 PCR에 대 한 사용 및/또는 quasimetagenomics 시퀀싱에 대 한 라이브러리 준비까지-20 ° C에서 최종 제품 (20 μ)를 저장 합니다.

3. 실시간 PCR

참고:이 단계는 1) 동등 하지 않고 살 모 넬 라 검출을 위한 선택 사항 2) quasimetagenomics 시퀀싱 전에 샘플 품질 평가 및.

  1. 18 μ 유니버설 PCR 마스터를 포함 하는 샘플 당 PCR 혼합물의 준비 믹스 (10 μ), 뇌관을 전달 (2 μ, 900 nM), 뇌관을 리버스 (2 μ, 900 nM), 프로브 (2 μ, 250 nM), 및 분자 학년 물 (2 μ).
    참고: 살 모 넬 라-특정 oligonucleotide 뇌관 (앞으로: CTCACCAGGAGATTACAACATGG, 역: AGCTCAGACCAAAAGTGACCATC)와 조사 (은행 취득 아니오 ttr 유전자 내 94-bp 시퀀스를 증폭 하도록 설계 되었습니다. 어 282268)13.
  2. 부드럽게 구슬-액체 정지를 만드는 데 함께살 모 넬 라 단지 위아래로 pipetting으로 단계 2.12에서에서 MDA 제품 믹스. PCR 혼합물의 18 μ에는 서 스 펜 션의 2 μ를 추가 합니다.
  3. 95 ° C의 40 주기 다음 두 보유 기간, 2 분 동안 50 ° C에와 10 분 동안 95 ° C에 지정 하는 최적화 된 실시간 PCR 프로토콜을 사용 하 여 실시간 PCR를 실행 15 s와 60에 대 한 60 ° C에 대 한 s.
  4. 임계값 주기 (Ct), 임계값 줄을 교차 하는 증폭 된 DNA에서 형광에 필요한 사이클 수를 계산 합니다.
    참고: 임계값 선 베이스 라인 및 샘플의 확대 음모의 고원 사이 선형 단계에서 설정 됩니다. 부정적인 결과 40 또는 부정적인 컨트롤의 보다 높은 Ct 값 샘플 Ct 값에 해당합니다.

4. 라이브러리 준비 Quasimetagenomic 시퀀싱에 대 한

참고: MDA 제품 모두 짧은 오래 읽고 (nanopore) 시퀀싱 플랫폼 시퀀싱 될 수 있습니다. DNA 라이브러리 준비 키트 시퀀싱 플랫폼의 제조 업체에 의해 제공의 최신 버전을 사용 합니다. 제조업체의 지시에 따라 DNA 도서관 준비를 수행 합니다. 5긴 읽기 시퀀싱 플랫폼 라이브러리 준비를 위한 2D 낮은 입력 genomic DNA 프로토콜을 사용 합니다. 짧은 읽기 시퀀싱 플랫폼 라이브러리 준비, 제조업체의 프로토콜에 대 한 사소한 수정 아래 제공 됩니다.

  1. 버퍼 솔루션 및 시 약 MDA 제품에 추가 하 여 표준 라이브러리 준비 방법에 따라. 새로운 접시를 준비 하는 시퀀싱 MDA 제품의 40 μ를 전송 하 고 각 우물에 PCR 정화 구슬의 20 μ를 추가 합니다.
  2. 동요 하지 않고 10 분 동안 실내 온도에 격판덮개를 품 어.
  3. 80% 에탄올과 비즈를 세척 하 고 건조 일 분 동안 구슬.
  4. 다시 물의 resuspension 버퍼의 53 μ에 말린된 구슬을 일시 중단 하 고 동요 하지 않고 2 분 동안 품 어.
  5. 희석 하 고 제조업체의 지시에 따라 라이브러리를 풀.
    참고: 오후 10 시 풀링 그리고 변성된 라이브러리는 이제 시퀀싱 할 준비가.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Quasimetagenomic 시퀀싱, 이전 fluorospectrometer (표 1)에 의해 전체 수량 및 IMS MDA 제품의 순도 평가할 수 있습니다.

농축 시간 (h) Ct 값 농도 (ng/ul) 순도 (260/280)
브랜드 A 4 24.71 812.91 1.89
8 25.80 900.36 1.87
12 15.41 753.88 1.84
브랜드 B 4 20.63 872.61 1.87
8 22.61 993.41 1.87
12 19.08 954.44 1.87

표 1: DNA의 품질 및 수량 평가 준 metagenomic 시퀀싱에 대 한 샘플. 살 모 넬 라 셀 주사 했다 1 CFU/g. Inoculated에서 두 브랜드의 원시 닭 가슴살의 25 g에 샘플 4, 8, 및 12 h IMS MDA 전에 RV에 농축 했다.

또한 살 모 넬 라 검출을 위한 대안 역할 동등 필요 하지 않은 경우 실시간 PCR (표 1그림 2)에 의해 살 모 넬 라 DNA의 타겟된 수량 평가 수행할 수 있습니다.

Figure 2
그림 2: 준 metagenomics 시퀀싱에 대 한 살 모 넬 라 검출 또는 샘플 평가 대 한 실시간 PCR. 4, 8 및 12 h 농축 시간 후 IMS MDA 제품에 살 모 넬 라 DNA의 실시간 PCR의 증폭 곡선 표시 됩니다. 만 2 h 농축 후 샘플 포함 되어 있습니다. 살 모 넬 라 셀 (0.27 CFU/g) 원시 닭 가슴살 두 브랜드 A와 B에서에서의 접종된 25 g 했다 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Fluorospectrometer 읽기 샘플 준비의 초기 평가 하실 수 있습니다. 살 모 넬 라 945.86 ng / µ L, 701.54에서 배열 했다 오염 된 닭 가슴살 샘플 샘플 DNA 증폭 되었습니다 제안에서 준비 하는 IMS MDA 제품의 농도. 제조업체의 지침에 따라 짧은 긴 시퀀싱을 읽고에 대 한 최소 DNA 샘플 농도 이며 0.2 ng / µ L 1 µ g, 각각. 260/280 비율 1.88 (표 1), 1.85에서 ranged 단백질 오염 낮은 수준의 DNA 샘플의 순도 보여주는.

Ct 값 샘플에서 살 모 넬 라 genomic DNA의 높은 농도 나타냅니다. 표 1그림 2에서 같이, IMS MDA 제품의 Ct 값 농축 시간 증가로 감소. 우리의 이전 연구4, Ct 값은 25 일 대부분 보다 낮은 경우 (> 50%) SE의 게놈 시퀀싱 할 것 이었고 serotype 예측 원시 연속 읽기에서 성공적 이었다.

실패 한 문화 농축 또는 인스턴트 메시지에 그림 2와 같이 최종 샘플에서 살 모 넬 라 genomic DNA의 낮은 농도 나타내는 상대적으로 높은 Ct 값 발생할 수 있습니다. 이 신호는 fluorospectrometer에 의해 제안 된 IMS MDA 제품의 순도 높은 DNA 농도도 불구 하 고 발생할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

종종 로우 풍부 음식과 환경 샘플에서 살 모 넬 라 의 동질적인 존재 때문에, IMS MDA 전에 문화 농축은 여전히 살 모 넬 라 검출 및 동등; 따라서 프로토콜의 중요 한 단계 이다. 샘플 배경 식물을 기준으로 살 모 넬 라 를 풍부 하 게 증가 하는 최적의 조건을 식별 하기 위해 다른 농축 미디어 특정 샘플에 대 한 평가 될 수 있습니다. MLG와 BAM, 음식 샘플에서 살 모 넬 라 농축 RV 국물 같은 선택적인 매체와 버퍼링된 펩 물과 유 당 국물 같은 비 선택적인 매체를 사용할 수 있습니다. 42 ° C에서 RV 사용 하 여 원시 닭고기, 빙산 양상추와 병원 체의 quasimetagenomic 분석을 지원 하기 위해 검은 후추에서 살 모 넬 라 농축에 대 한 우리의 이전 연구4 에 평가 했다. FDA BAM 및 AOAC precollaborative8,9및 공동 연구14,15, RV 높은 미생물 및 미생물 부하 식품의 분석에 대 한는 것이 좋습니다.

문화 농축의 최적의 기간 샘플 유형, 살 모 넬 라 오염 수준 및 살 모 넬 라 오염 물질의 생리 상태 등, 여러 요인에 따라 달라 집니다. 예를 들어 때 낮은 수준 살 모 넬 라 (예를 들어, < 1 CFU/g)의 세포는 냉동 스트레스와 고기 샘플에, 더 이상 농축 시간 (예를 들어, > 12 h)을 회복 하 고 풍요롭게 살 모 넬 라 셀 필요할 수 있습니다. 수정 된 미생물에서 살 모 넬 라 의 충분 한 풍부한 긴장 수준 단일 염기 다형성 (SNP)4입력을 허용할 수 있는 살 모 넬 라 오염 게놈의 적절 한 시퀀싱 범위 이끌어 낸다. 짧은 문화 농축 (예를 들어, 미만 12 h) 가능한 신속한 검출5 또는 살 모 넬 라4의 serotyping 이다.

상부 살 모 넬 라 오염 또는 오염 된 식품 샘플의 더 이상 문화 농축 Ct 값 낮은 이어질 변형된 식품 microbiomes에 살 모 넬 라 genomic DNA의 높은 농도 귀 착될 수 있다는 실시간 PCR 분석입니다. Ct 값은 살 모 넬 라 오염 게놈4, 시퀀싱 범위와 부정적인 상관 관계를 표시 하 고 최적화 및 워크플로 수정 사용할 수 있습니다. 우리의 경험에의 하면 문화 풍부, 특히, 그것의 길이 종종 노력을 문제 해결의 초점 이다. 예를 들어 원시 닭 가슴살 샘플에서 IMS MDA 제품의 Ct 값 35.94 (그림 1)에서 상대적으로 높았다. 이 샘플 SE 셀의 2.5 CFU/g 주사 되었고 incubated BPW 2 h. 위해 37 ° C에서에이 샘플의 시퀀싱 serotype 예측 수 있도록 SE 게놈의 충분 한 적용 제공 하지 않았다. 비교에서는, 모든 다른 샘플 4 h 또는 더 이상 농축을 성공적으로 quasimetagenomic 시퀀싱 데이터 (데이터 표시 되지 않음)에서 serotyped 했다.

시퀀싱, 후 생물 정보학 분석 추가 읽고 크 라 켄16 살 모 넬 라 를 식별 하기 위해 사용 하는 것이 좋습니다. CFSAN SNP 파이프라인17 , SeqSero18 입력 하 고 각각 예측 원시 연속 읽기에서 serotyping SNP에 대 한 사용할 수 있습니다.

이 quasimetagenomic 기술에는 몇 가지 제한이 있습니다. 첫째, DNA의 농도 및 순도 fluorospectrometer에 의해 측정 하는 IMS MDA 제품의 적절 한 샘플 준비의 예비 지표로 사용 되어야 한다. MDA의 높은 효율으로 인해 입력된 DNA의 상당량 전체 게놈 시퀀싱19충분 증폭 될 수 있다. 문화 농축 또는 IMS 효과적으로 살 모 넬 라 셀을 집중 실패 하는 경우에 따라서, 높은 품질과 수량 DNA 샘플의 생성할 수 아직도 있습니다. 옵션 실시간 PCR 분석 전체 샘플 준비 워크플로의 더 많은 타겟이 명확 하 고 유익한 평가 제공합니다. 둘째, 어려운 문화 살 모 넬 라 셀와 같은 nonculturable (VBNC) 박테리아만 가능한20, 수 있습니다 하지 문화 농축 동안 성장 했습니다. 따라서,이 세포 우리의 방법에 의해 감지 되지 않을 수 있습니다.

요약 하면, 전통적인 방법에 비해, 우리의 샘플 준비 방법 및 준 metogenomic 시퀀싱 접근을 허용할 수 있다 분석 처리의 상당한 감소에서 살 모 넬 라-오염 된 음식과 환경 샘플을 살 모 넬 라 오염 물질의 강력한 동등입니다. 살 모 넬 라, 뿐만 아니라이 기술을 신속 하 고 공동 적용된 감지 하 고 다른 foodborne 병원 체 동등 하는 잠재력이 있다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자 들은 아무 경쟁 금융 관심사 선언 합니다.

Acknowledgments

저자 마크 해리슨과 세균성 긴장 및 다른 지원이이 연구에 친절 하 게 제공에 대 한 조지아 대학의 그웬 허쉬 감사 하 고 싶습니다.

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
음식과 환경 샘플에서 <em>살 모 넬 라</em> 의 준 metagenomic 분석
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter