Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Cel gebaseerde analyses van SINEUP niet-coderende RNAs die specifiek mRNA vertaling kunnen verbeteren

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs zijn synthetische antisense niet-coderende RNAs, die bevatten een bindend domein (BD) en een effector domein (ED) en up-reguleren vertaling van mRNA richten. Hier beschrijven we detectiemethoden voor SINEUPs in gekweekte cellijnen, analyse van hun vertaling-bevordering van activiteiten door Western-blot en een semi-automatische hoge doorvoer imaging systeem.

Abstract

Verhoging van de gerichte-eiwit is van belang niet alleen voor de studie van biologische processen, maar ook voor therapeutische en biotechnologische toepassingen. Hier presenteren we een methode voor selectief up-reguleren eiwit expressie van gewenste genen in gekweekte cellen door middel van synthetische antisense niet-coderende RNAs bekend als SINEUPs. Deze positieve controle van de genexpressie is op post-transcriptional niveau en uitgeoefend door een omgekeerde korte afgewisseld nucleaire element (sinus) herhalen op het einde van de 3ʹ van de SINEUPs die bestaat uit het effector domein (ED). SINEUPs kunt specifiek binden aan een eiwit-codeert mRNA van keuze via zijn bindend domein (BD), een regio die is ontworpen als aanvulling op de reeks binnen de 5ʹ niet-vertaalde regio (5ʹ UTR) en rond de start codon van het mRNA. Doelgroepen gerichte SINEUPs ontworpen op deze manier zijn transfected naar gekweekte cellen en eiwitten en RNA voor downstream analyses, in het algemeen 24-48 h na transfectie worden geëxtraheerd. SINEUP-geïnduceerde proteïne up-verordening wordt gedetecteerd door analyse van de Western-blot en RNA expressie is gemeten met behulp van real-time kwantitatieve omgekeerde transcriptie PCR. Wij hebben waargenomen dat BD design essentieel is voor het bereiken van optimale SINEUP activiteit en dat testen verschillende BD maten en posities met betrekking tot de start codon van het streefcijfer dat mRNA wordt aanbevolen. Daarom beschrijven we hier een semi-automatische high-throughput beeldvorming methode gebaseerd op de detectie van de fluorescentie die kan worden geïmplementeerd op target die mRNA gefuseerd met groen fluorescente proteïne (GFP). SINEUPs verbeteren specifiek vertaling binnen normale fysiologische bereik van de cel, zonder dat het streefniveau van transcript. Deze methode is met succes werkzaam zijn tegen een aantal endogene en exogene doelen, in een breed scala aan mens, muis en insecten cellijnen samen met in-vivo systemen. Bovendien zijn SINEUPs gemeld bij verhogen van de productie van het antilichaam en werken als een RNA therapeutische tegen haploinsufficient genen. Het veelzijdige en modulaire karakter van SINEUPs maakt ze een geschikt hulpmiddel voor gen-specifieke vertalende controle.

Introduction

In de post genomic era, veel inzichten zijn opgedaan in de gene regelgevende rol van niet-coderende antisense afschriften als gevolg van de ontwikkeling van next-generation sequencing technologieën1,2,3 en gen-bewerkingsgereedschap. Deze categorie van afschriften, die werd eerder beschouwd als "transcriptionele trash", is nu opgericht als belangrijke speler van genetische verordening. Antisense afschriften worden gemeld aan het moduleren van de chromatine en de stabiliteit van de controle en de uitdrukking van hun cognaat eiwit-codeert zin mRNA4,5. In de meeste gevallen dit soort verordening is negatief en antisense afschriften stilte hun tegenhangers van de zin t/m6,7van de interacties van de RNA-RNA. Deze eigenschap van natuurlijke antisense afschriften is gebruikt aan downregulate gewenst genen in de vorm van synthetische Klein Mengend RNA (siRNA), microRNA (miRNA) en antisense oligos (ASO)8,9,10 ,11 verlaten van een technologische leegte voor up-genregulatie gericht.

Een intrigerende studie veranderde de kijk van de antisense RNA-veld door aan te tonen dat lang niet-coderende RNAs antisense (als lncRNAs) van de genen Uchl1 (ubiquitin C-terminal hydrolase L1) en Uxt (overal uitgedrukt transcript) positief reguleren vertaling van hun cognate zin mRNA op het post-transcriptional niveau in muizen12. Het einde van de 5ʹ van deze lncRNAs overlapt met verschillende bases in de 5ʹ niet-vertaalde regio (5ʹ UTR) van hun overeenkomstige zin afschriften en niet-overlappende 3ʹ bevat een omgekeerde herhaling van een retrotransposon die behoren tot de korte afgewisseld nucleaire element (sinus) familie. Interessant, vonden we dat de belangrijkste drijvende kracht achter deze translationeel up-verordening is de ingesloten sinus herhalen en het is niet beperkt tot muis die sinus alleen herhaalt. Menselijke Alu herhalen-bevattende naam zoals lncRNAs ook vertaling van doel zin mRNAs verbeterde, versterking van het idee van een nieuwe klasse van sinus-gedreven regelgevende antisense niet-coderende RNAs, toepasselijke SINEUPs13. Recente studies is gebleken dat het potentieel van de natuurlijke SINEUPs bewaard in synthetische SINEUPs ontworpen aan doel specifiek verschillende endogene en exogene genen gebleven is14,15. SINEUPs hebben twee belangrijke kenmerken: eerste de "bindend domein" (BD) die is over het algemeen de 5ʹ einde regio ter aanvulling van de sequentie omvat de primaire start codon van een eiwit-codeert mRNA, en ten tweede het "effector domein" (ED) als het omvat een omgekeerde herhaling van SINE die een voorwaarde is om SINEUP functie14 (Figuur 1). SINEUPs kan worden aangepast voor het ontwerpen van een BD die specifiek gericht zijn op een gen van keuze. Dit kan vervolgens worden ingezet om de functie van een bepaald gen in een biologische pathway, ontleden als een beter alternatief dan een conventionele mRNA overexpressie strategie. Bovendien, dit veelzijdig instrument kan worden toegepast om te stimuleren van de productie van het antilichaam, en als een drug voor de behandeling van haploinsufficient ziekten veroorzaakt door onvoldoende doseringen van functionele eiwitten16,17,18, 19,20,21.

De voordelen van SINEUP technologie zijn divers. Het verandert niets aan de uitdrukking van de doelgroep op het transcriptional niveau. Langere BDs bieden meer specificiteit SINEUPs, terwijl niet inducerende een dsRNA-afhankelijke stress reactie15. De eiwit-inductie wordt gehandhaafd binnen het normale fysiologische bereik van de cel, het voorkomen van eventuele schadelijke gevolgen als gevolg van afwijkende of buitensporige eiwit expressie. SINEUPs zijn compatibel met een breed scala aan muis, menselijke, en hamster gekweekte cellijnen, bijvoorbeeld, HEK293T/17, HepG2, HeLa, CHO, MN9D en veel meer12,13,14,15,18 ,19. SINEUPs kunt efficiënt richten endogene genen, Transient overexpressie genen en vlag-gelabeld of luciferase-fusion genen, eliminerend de behoefte van gen-specifieke antilichamen14,18. De basisanalyse van de SINEUP vereist routine celcultuur, transfectie, natrium dodecyl sulfaat-polyacrylamide gelelektroforese (SDS-PAGE), real-time kwantitatieve omgekeerde transcriptie-polymerase kettingreactie (qRT-PCR) instrumenten en instellingen, en deskundigheid kan worden bereikt in een korte tijd.

Hier beschrijven we een methode voor het targeten van genen met synthetische SINEUPs tot up-reguleren vertaling, een effect in de strijd met andere technologieën, zoals RNA interferentie9 en ASO gapmers11,22,23. Een veel gebruikte methode voor RNA-geleide gene activering is geclusterde regelmatig interspaced korte palindromische herhalingen gebaseerde activering (CRISPRa), waar de genexpressie wordt geactiveerd op het transcriptional niveau24. Deze methode, maar eenvoudig en snel, moet meerdere één gids RNAs (sgRNAs) gericht op het zelfde gen voor hogere efficiëntie, waardoor de kans op uit-target bindende25. Bovendien, het sleutelenzym van het CRISPRa-systeem, de catalytically dood CRISPR-geassocieerde proteïne 9 (dCas9) heeft lage bindende specificiteit en sgRNAs gericht op bidirectionele promotor regio's niet-specifiek up-in de buurt van genen25 reguleren kunnen. Omgekeerd, SINEUPs binden aan de doelgroep van mRNA in een enkele bindende regio met hoge specificiteit en hebben geen invloed op de expressie van genen die in de buurt. We bespreken de basisstappen die betrokken zijn bij SINEUP ontwerp, transfectie, eiwitten en RNA expressie analyses. Bovendien presenteren we een semi-automatische, hoge-doorvoer imaging systeem naar screen meerdere SINEUPs tegelijk, wat handig is voor de detectie van optimale SINEUPs.

Protocol

1. ontwerp van BDs van bouwt SINEUP voor Target mRNAs

  1. Controleer transcriptie startende site (TSS) en de beginnende site vertaling van doel mRNAs in de cellen van belang. Verwerven van TSS gegevens uit zowel de ENCODE en de FANTOM projecten (GLB analyse van genexpressie, CAGE) (ZENBU: http://fantom.gsc.riken.jp/zenbu/).
  2. De browser openen, zoeken van genen van belang en TSS controleren door kooi pieken.
  3. De analyse voorbeeld van cel- en weefseltransplantaties specifieke TSS van Parkinson ziekte proteïne 7 (PARK7) raadplegen mRNA afgebeeld in Figuur 2.
  4. Ontwerp BD sequenties van verscheidene verschillende lengtes die overeenkomt met 40 baseert "upstream" en 32 honken stroomafwaarts van de eerste methionine (AUG), 72 nt in totaal.
  5. Aangepaste bestel de ontworpen BDs in SINEUP expressie vector (Zie Tabel van materialen).
    Opmerking: Controleer de specificiteit van de sequentie door fundamentele lokale uitlijning search tool (BLAST) om te voorkomen dat af-target effecten26.

2. cel cultuur en SINEUP transfectie

  1. Zaad-cellen van belang in een 6 goed-plaat of 24 goed-plaat voor 24u voor transfectie van SINEUPs. In het geval van menselijke embryonale nier cellijn (HEK293T/17) (Zie Tabel of Materials), zaad 0,5 x 106 cellen per putje van een 6 cellen goed-plaat of 1.5 x 105 per putje een poly-D-lysine gecoate 24 well-plate (Zie Tabel van materialen). Wordt 70% heuvels na 24 h.
  2. Wijzigen na 24 h, het medium 1,5 mL verse voedingsbodem voor een 6 goed-plaat of 0.4 mL verse voedingsbodem voor een 24 goed-plaat. In het geval van SINEUP-GFP, transfect 0,6 µg voor pEGFP-C2 (Zie Tabel van materialen) en 3.4 µg voor SINEUP-GFP in een put van een 6, well-plate of 130 ng van pEGFP-C2 en 670 ng van SINEUP-GFP in een put een 24 well-plate met transfectiereagens (10 µL in 6 goed-plaat en 3 µ L in 24 well-plate) door het volgen van de instructies van de fabrikant (Zie Tabel of Materials), en Incubeer bij 37 ° C in een 5% CO2 incubator gedurende 24 uur.
  3. Cellen met 2 mL fosfaat buffer zoutoplossing (PBS) (37 mM NaCl, 8 mM Na2HPO4, 2,6 mM KCl en 1,5 mM KH2PO4) in elk putje een 6 well-plate of 0,5 mL PBS in elk putje een 24 well-plate wassen. Alleen voor poly-D-lysine gecoate 24 well-plate, voeg 25 µL van 0,05% gewicht per volume trypsine, broeden in een 5% CO2 incubator voor 5 min en voeg 275 µL van cel medium per putje. In het geval van 6 well-plate, voeg toe 2 mL PBS in elk putje. Pipetteer omhoog en omlaag om de oogst van 3/4 cellen (1,5 mL voor een 6 well-plate) of 225 µL van een 24-goed-plaat van 1 goed voor eiwit extractie (Ga naar protocol 3 voor eiwit extractie) en 1/4 cellen (0,5 mL van een 6-goed-plaat) of 75 µL van een 24-goed-plaat voor RNA extractie en centrifugeer bij 6.000 x g gedurende 5 min bij 4 ° C (Ga naar stap 5 voor RNA extractie).
    Opmerking: Analyseren het effect van SINEUP-GFP in een poly-D-lysine gecoate 24 goed-plaat door imaging. Ga naar stap 7 (imaging analyse).

3. eiwit extractie

  1. Zorgvuldig gecombineerd 1,5 mL PBS en voeg 140 µL van lysis van de oplossing (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM nb2EDTA, 1 mM EGTA, 1% (m/v) Triton, 2.5 mM natrium pyrofosfaat, β-glycerophosphate 1 mM, 1 mM nb3VO4 Leupeptin van 1 μg/mL en 0,005% (g/v) phenylmethylsulfonyl fluoride (PMSF)) (Zie Tabel of Materials) voor een 6 well-plate of 60 µL van een 24-goed-plaat aan de cel pellets.
  2. Meng door pipetteren en meng grondig door te draaien op lage snelheid gedurende 1 uur bij 4 ° C. Verzamelen van supernatant door centrifugeren bij 14.000 x g gedurende 10 minuten bij 4 ° C.
  3. Eiwitconcentratie controleren door colorimetrische bepaling (zie tabel van materialen). Bereiden alle reacties bij kamertemperatuur.
    1. Maak 5 - 6 keer verdunning van bovien serumalbumine (BSA) eiwit standaard in ultrazuiver water met concentraties variërend van 0.2 tot 1,5 mg/mL eiwit. Bereiden van verse normen elke keer.
    2. Bereid werken reagens Aʹ door het mengen van 1 mL reagens een (alkalische koperen tartraatoplossing) met 20 µL van het reagens S (oppervlakteactieve stof oplossing).
    3. Laden 5 µL van water (negatieve controle), BSA standaard (eiwit standaard en positieve controles) of eiwitSteekproef in ieder putje van een 96-well-plate.
    4. Voeg 25 µL van reagens Aʹ in elk putje. Voeg voorzichtig 200 µL van het reagens B (reagens volgens Folin-reagens) per goed het vermijden van de vorming van een zeepbel. De afdekplaat met aluminiumfolie en wacht 5-10 min.
    5. Meet de extinctie van de eiwitten bij 750 nm met een spectrofotometer. De absorptie is stabiel gedurende ten minste 1 uur.
    6. Bereiden standaard curve door plotting BSA standaard eiwit concentratie (mg/mL) op de x-as en hun respectieve extinctie op de y-as. Berekenen steekproef eiwitconcentratie door toepassing van standaard kromme vergelijking.
      Opmerking: Onderbreken van het protocol bij deze stap indien nodig of gaat u naar stap 4. Voor langdurige opslag bevriezen module EiwitSteekproeven in vloeibare stikstof en winkel bij-80 ° C.

4. eiwit scheiding door SDS-pagina en opsporing van Target eiwitten met antilichamen (Western-blot analyse)

  1. Toevoegen van een volume van 2 x laden kleurstof (0,1 M Tris-HCl (pH 6.8), 4% SDS, 20% glycerol, 2-mercaptethanol 1,42% en 0,2% bromophenol blauw) op elk volume van eiwitSteekproef uit stap 3.3. Verhit bij 90 ° C gedurende 5 minuten en onmiddellijk koel op ijs voor 1 min.
  2. Laden van 10-20 µg EiwitSteekproeven aan 10% SDS poly-acrylamide gel en scheiden op 100-150 V) (Zie Tabel van materialen).
  3. Eiwit uit gel overbrengen in nitrocellulose membraan van 0,45 µm (Zie Tabel van materialen) door semi-droge overdracht instrument met overdracht buffer (25 mM Tris, 192 mM glycine en 20% methanol) bij 25 V voor 30 min.
  4. Toevoegen van blokkerende oplossing (5% non-fat droge melk in 1 x TBST buffer (137 mM NaCl, 20 mM Tris-HCl (pH 7,6), 0,1% Tween-20)) (Zie Tabel van materialen) naar de container tot het membraan is helemaal doorweekt en na het bebroeden bij kamertemperatuur gedurende 30 minuten.
  5. In het geval van SINEUP-GFP, kruisen het eiwit met anti-GFP antilichaam (verdunde 1:2000 in het blokkeren van de oplossing) (Zie Tabel van materialen) door het membraan voor 30 min met schudden bij kamertemperatuur incuberen. Als een interne controle eiwit, β-actine eiwit te detecteren door kwekers met Anti-β-actine antilichaam (verdunde 1:2000 in het blokkeren van de oplossing) (Zie Tabel of Materials) voor 30 min met schudden bij kamertemperatuur.
  6. Voeg 1 x TBST buffer naar de container totdat het membraan helemaal doorweekt en wassen voor 5 minuten bij kamertemperatuur is. Herhaal de wassen stap twee meer tijden (een totaal van drie wasbeurten).
  7. GFP eiwitten aan verdunde (1:1000 in het blokkeren van de oplossing) te vermengen anti-konijn antilichaam geconjugeerd met mierikswortelperoxidase (HRP), en vermengen van β-actine eiwitten aan verdund (1:1000 in het blokkeren van de oplossing) anti-muis antilichaam geconjugeerd met HRP op het membraan voor 30 min met schudden bij kamertemperatuur.
  8. Membraan met 1 x TBST buffer gedurende 5 minuten wassen bij kamertemperatuur. Herhaal de wassen stap twee meer tijden (een totaal van drie wasbeurten).
  9. Meng gelijke hoeveelheid HRP-Verbeterde Chemiluminescentie (ECL) detectie reagens 1 en 2 (Zie Tabel van materialen). Het membraan overbrengen in 2 mL ECL reagens mix, betrekking hebben op de doos met aluminiumfolie en laat het Incubeer gedurende 1-2 minuten bij kamertemperatuur. Verwijder het membraan van ECL reagens mix voorzichtig en bloot met behulp van een luminescentie imaging instrument.

5. RNA extractie en DNase behandeling

  1. Uittreksel totaal RNA volgende de standaard protocol voor RNA extractie uit cellen gekweekt in een enkelgelaagde27 of als alternatief het gebruik van een commercieel beschikbare RNA extractie kit (Zie Tabel van materialen). Om in het kort, voeg een monofasische lysis reagens (MLR) van guanidine isothiocyanaat en fenol aan de geoogste cellen in stap 2.3 (1 mL MLR per ~ 5 miljoen cellen)27.
    Opmerking: Handschoenen vaak worden gewijzigd. Gebruik van de reagentia RNase-vrij, en diethylpyrocarbonate (DEPC)-kunststof aardewerk en glaswerk om te voorkomen dat de aantasting van het RNA behandeld. Onderbreken van het protocol bij deze stap indien nodig. Winkel geëxtraheerd RNA bij-80 ° C.
  2. 0,1 volume van 10 x DNase buffer en 2 U van DNase aan het gezuiverde RNA toevoegen vanaf stap 5.1 (Zie Tabel van materialen).
  3. Stel het volume van de reactie op 50 µL met nuclease-gratis water en meng voorzichtig. Incubeer bij 37 ° C gedurende 30 minuten.
  4. Voeg 0,1 hoeveelheid opnieuw gesuspendeerde DNase inactivatie reagens toe en meng goed (Zie Tabel van materialen). Incubeer gedurende 5 minuten bij kamertemperatuur met zacht schudden.
  5. Centrifugeer bij 10.000 x g gedurende 90 s. overdracht het supernatant (DNA-vrije RNA) tot een verse RNase-vrije 1,5 mL koker. Wees voorzichtig niet aan te raken de pellet, omdat dit kan leiden tot overdracht van DNase die lastig voor downstream stappen is.
  6. RNA te kwantificeren door het meten van een260 en een260/A280 verhouding (voor zuivere RNA, het bereik is 1.8-2.0) in een UV spectrofotometer.

6. eerste onderdeel cDNA synthese en qRT-PCR analyse

  1. Uitvoeren van eerste strand cDNA synthese volgens een standaard cDNA synthese protocol als hieronder (zie tabel van materialen).
    1. Meng 0,75 µM oligo dT primer, 4.3 µM willekeurige primer, dNTPs (elke 10 mM) met 200-500 ng totaal RNA (van stappen 5-8) in 10 µL van totale reactie volume. Incubeer bij 65 ° C gedurende 5 minuten en zet dan onmiddellijk op het ijs.
    2. Meng 1 x reverse-transcriptase buffer, 1 U van RNase remmer, 10 U van reverse-transcriptase, en voeg aan 10 µL RNA-primer mix van 6.1.1.
    3. Zet het volume van de totale reactie naar 20 µL met nuclease-gratis water indien nodig. Meng voorzichtig en Incubeer de reactie mix bij 30 ° C gedurende 10 min, dan bij 42 ° C gedurende 60 min, en ten slotte bij 95 ° C gedurende 5 min naar de inactivering van het enzym. Koel de buizen op ijs.
      Opmerking: RNA monsters en alle de reagentia op ijs ontdooien en bereiden van de mix van de reactie op het ijs. Als doel RNAs alleen RNAs polyA, gebruikt oligo dT primer alleen (2,5 µM). Onderbreek het protocol indien nodig. Winkel gesynthetiseerd cDNA bij-20 ° C.
  2. QRT-PCR uitvoeren in technische triplicates (n = 3, Cт standaard afwijking > 0,2) en binnen biologische replicatieonderzoeken (n ≥ 3) met behulp van 1 µL van 10 ng cDNA, 0.4 µL van omgekeerde primer (10 µM), 0.4 µL voorste primer (10 µM), 10 µL van het mengsel oplossing van polymerase van DNA , 0.4 µL van dubbel-streng DNA kleuring van kleurstof, 10 µL van nuclease-gratis water (reactie volume was 20 µL) te detecteren van PCR producten gebruiken na voorwaarden; houden van de fase (1 cyclus) voor 30 bij 95 ° C, podium (40 cycli) voor 5 fietsen s s bij 95 ° C en 30 bij 60 ° C, s smelten kromme fase. Primer voorbeelden zijn van menselijke Gapdh_Fw: TCTCTGCTCCTCCTGTTC, menselijke Gapdh_Rv: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, SINEUP-GFP_Fw: CTGGTGTGTATTATCTCTTATG en SINEUP-GFP_Rv: CTCCCGAGTCTCTGTAGC. Zie tabel met materialen. Analyseren van kwantitatieve RNA expressie met 2- ∆∆Ct ± SD methode28.

7. imaging analyse van SINEUPs door semi-automatische detectiemethode

  1. Cellen met 0,5 mL PBS voor één goed een 24 well-plate wassen.
  2. Toevoegen van 2.0 μg Hoechst 33342 (Zie Tabel van materialen) (ontbinding in 500 μL van PBS) aan elk van de 24-well-plate goed en Incubeer bij 37 ° C gedurende 20 minuten om de kern vlek cellen.
  3. Maatregel Hoechst gekleurd cellen om te tellen het totale aantal cellen bij blauwe emissie maximaal 461 nm, en de intensiteit van de groene fluorescentie te tellen aantal GFP positieve cellen op groene emissie maximaal 510 nm met behulp van een high-throughput micro-well afbeelding cytometer ( Zie Tabel van materialen). Analyseren eiwit up-regulerende effect van de SINEUPs door het berekenen van GFP geïntegreerd intensiteit, die de som van alle pixel intensiteiten signaal in gesegmenteerde objecten berekend voor elk kanaal is, met behulp van Imaging software29weer te geven.
  4. Oogsten van cellen te controleren van RNA expressie (terug naar stap 5 en 6).

Representative Results

SINEUP-GFP is een synthetische SINEUP met beide een optimale BD (-28 / + 4 overlappen naar GFP mRNA) en een ED (omgekeerde sinus B2 van AS -Uchl1) die kunnen up-reguleren GFP mRNA vertaling (figuur 3A en 3B) zonder dat de expressie van GFP mRNA (Figuur 3 c en 3D). Om het scherm optimaal BDs en EDs voor SINEUPs, ontwikkelden we een protocol van semi-automatische beeldanalyse die verbeterde detectie tijd en verhoogd het aantal monsters tegelijk vertoond in vergelijking met een conventionele analyse van Western-blot15. Zoals blijkt uit Figuur 4, duurde dit high-throughput imaging systeem 3 dagen (westelijke vlekkenanalyse duurde 2 weken voor 48 SINEUPs). Hebben aangetoond dat SINEUP-GFP GFP vertaling verhoogt, wij GFP geïntegreerd intensiteit gedetecteerd door de cytometer van de afbeelding. De optimale BD SINEUP-GFP veroorzaakte een 1.4-fold verhoging van GFP eiwit expressie. Hoewel we compressie van signalen van 2.6-fold waargenomen (analyse van de Western-blot, Zie figuur 3A) naar 1.4-fold (Imaging analyse, Zie Figuur 5), het verschil zou kunnen te wijten zijn aan het kalibreren van het instrument imagingsoftware. Wij ontdekt echter aanzienlijk hogere niveaus van GFP fluorescentie in vergelijking met het besturingselement (figuur 5A en 5B).

Figure 1
Figuur 1: basisontwerp van de synthetische SINEUPs. BD = bindend domein te richten op mRNA, ED = effector domein met een omgekeerde volgorde van de sinus. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: Transcriptie sites (TSSs) van menselijke Parkinson-ziekte eiwit 7 (PARK7) starten mRNA in specifieke weefsels en cellen opgespoord door een analyse van de kooi. (A) A snapshot waaruit een zoekresultaat TSS voor menselijke PARK7 mRNA omics gegevensintegratie en interactieve visualisatie systeem30gebruiken. De horizontale groene pijl in de Entrez gene hg19 track geeft aan de genomic positie van de verwijzing menselijke PARK7 mRNA en de groene verticale balken in de FANTOM5 kooi 1 en 2 nummers geven de som van TSSs (gemeten als afschriften per miljoen (tpm)) van 1,829 soorten weefsels en cellen. (B) Zoom in van de gemarkeerde regio van het TSS in deelvenster A (1/354 schaal: 35.4 kb tot 100 bp). Grijs gearceerde gebied in de kooi van de FANTOM5 fase 1 en 2 tracks geeft aan de TSS 6 specifieke cellen uit de totale 1,829, die aan de onderkant van de afbeelding worden vermeld. De nummers (11.369, 4.998 4.304, 3.509, 3.477 en 3.055) overeenkomt met deze lijst cellen geven afschriften per miljoen voor elke specifieke cel op de grijs gearceerde posities van de TSS. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: analyse van de Western-blot bevestiging van up-regulatie van vertaling door SINEUP-GFP. (A) SINEUP-GFP werd onderzocht door Western-blot met anti-GFP antilichaam. (B) resultaten waren genormaliseerd naar de intensiteit van de β-actine eiwit band. (C) GFP mRNA en (D) SINEUP RNAs expressie werden ontdekt door qRT-PCR. p < 0.0005, n = 3, de tweezijdige student t-test, foutbalken zijn standaarddeviatie. Dit cijfer is gewijzigd van Takahashi et al.15. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: schematische van SINEUP semi-automatische beeldanalyse. Dag 1: Zaad cellen van belang in een 24 goed-plaat. Dag 2: Transfect GFP en SINEUP-GFP. Dag 3: Analyseren het effect van SINEUPs door het meten van de intensiteit van het GFP geïntegreerd. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: High-throughput analyse van vertaling up-verordening door SINEUP-GFP. (A) vergelijking van GFP fluorescentie tussen controle- en SINEUP-GFP transfected cellen15. Schaal bar = 2 mm. (B) GFP geïntegreerde intensiteit was genormaliseerd naar het nummer van de cel Totaal geteld door nucleaire kleuring met Hoechst 33342. p < 0.0005, n = 3, de tweezijdige student t-test, foutbalken zijn standaarddeviatie. FOV: gezichtsveld. Dit cijfer is gewijzigd van Takahashi et al.15. Klik hier voor een grotere versie van dit cijfer.

Discussion

We beschreven hier een protocol om specifiek eiwitproductie van een doel mRNA door middel van een sinus-bevattende niet-coderende RNA, genaamd SINEUPs. Als een voorbeeld van een vertegenwoordiger is aangetoond dat optimale synthetische SINEUP-GFP omhoog-regelen de vertaling van GFP mRNA 2.6-fold zoals gemeten door de Western-blot analyse.

Ontwerpen van een optimale BD is van cruciaal belang om ervoor te zorgen SINEUP specificiteit en potentie (mate van eiwit up-verordening). Eerder, we 17 BDs van SINEUP-GFP gescreend door Western-blot analyse15 en vond dat de optimale BD de AUG-KOZAK sequentie van GFP mRNA, overlapt hoewel het wellicht niet het geval met andere mRNAs en dient te worden geverifieerd voor elk geval. Een andere onafhankelijke groep onderzocht ook de BD gebruikt een andere methode-31. Als vele BDs screening kan heel tijdrovend en omslachtig, introduceerden we een high-throughput SINEUP detectiemethode hier. Deze methode meet relatieve veranderingen in dichtheid van het GFP geïntegreerd in SINEUP transfected-cellen ten opzichte van de controle vector transfected-cellen. Om ervoor te zorgen dat de cellen in een bepaalde put van een cultuur plaat even zijn transfected en GFP signaal niet alleen een bepaalde regio van de put geconcentreerd is, is het zeer belangrijk voor het distribueren van de cellen even in de putjes in stap 2.1. Voor dit doel, zachtjes schudden de plaat 10 keer heen en weer (↑↓) na het zaaien van de cellen binnen een schone bankje en herhalen in de 5% CO2 incubator voordat de incubatie.

Een andere belangrijke stap is de berekening van de eiwitconcentratie in stap 3.3. Misrekeningen hier kunnen leiden tot het laden van een onjuiste hoeveelheid eiwit tijdens de Western-blot analyse, bijgevolg voorkomen van detectie van kleine veranderingen in eiwit expressie door een aantal van de zwakke SINEUPs of het genereren van valse positieven van overbelasting. Het is aanbevolen om vers bereiden de eiwit standaard curve elke keer, om ervoor te zorgen dat gelijke hoeveelheden van normen en EiwitSteekproeven worden gemeten in stap 3.3.3. Het protocol beschreven hier richt zich op SINEUP-GFP, maar de Western-blot analyse kan worden gebruikt voor een doel van mRNA van belang. De incubatietijd en de concentratie van de antistoffen moeten worden geoptimaliseerd voor elke doelstelling om het beste resultaat te krijgen.

Een van de unieke kenmerken van SINEUPs is dat doel-mRNA uitdrukking niveau onaangetast blijft. Het is belangrijk voor de behandeling van RNA met DNase om ontdekking te voorkomen van transfected SINEUPs en genomic DNA door qRT-PCR. SINEUP RNAs en doel mRNA uitdrukking moeten worden gemeten door qRT-PCR te bevestigen het succes van zowel transfectie en SINEUP activiteit. SINEUPs bevatten een sinus-reeks, die overvloedig in zowel de menselijke is en muis genomen. Om te voorkomen dat niet-specifieke detectie van sinus sequenties, is het niet aanbevolen om qRT-PCR inleidingen in de sinus reeks ontwerpen.

In dit protocol gebruikten we menselijke cellijnen, maar SINEUPs zijn doeltreffend in een aantal cellijnen van verschillende soorten12,13,14,18,19. De cel cultuur en transfectie voorwaarden kunnen worden gewijzigd volgens verschillende cellijnen, zolang deze een transfectie van de vectoren SINEUP efficiënte. Bovendien, alternatieve methoden voor RNA extractie, cDNA synthese en controleren van de concentratie van de eiwitten kunnen worden toegepast, gezien het feit dat ze de vereiste kwaliteit van de RNA en eiwitten voor qRT-PCR en Western-blot analyse behouden. Terwijl we een specifieke high-throughput micro-well cytometer, waardoor opsporing van GFP fluorescentie over het gehele goed gebruikt, kunnen andere cytometers met een soortgelijke registratiebereik gebruikte31. Moet worden opgemerkt dat als de verdeling van de cellen en transfectie gelijk in een goed zijn, het is niet nodig voor het scannen van de hele put voor GFP fluorescentie: de helft of een kwart van de oppervlakte van een goed misschien wel genoeg te onderscheiden SINEUP effect afhankelijk van experiment al de vaardigheden.

Tot oprichting van een high-throughput protocol voor de detectie van de SINEUP zorgt voor gelijktijdige screening van meerdere BDs gericht op een bepaalde mRNA in gekweekte cellen. Dit is belangrijk omdat de regels voor optimale richten door de BD nog onduidelijk zijn. Dergelijke een multiplex screening systeem voorziet in grootschalige testen van vele SINEUPs tegen verschillende genen, nuttig voor het targeten van meerdere genen betrokken bij een bepaalde signalering traject bijvoorbeeld. Bovendien kan het gebruikt worden om uit te breiden van de zoektocht naar doeltreffende SINEUPs gericht op verschillende mRNAs, ontwerpen van verschillende SINEUP BDs rond AUG-Kozak regio (Zie Figuur 1), co transfecting volle lengte doel mRNAs (5ʹ UTR-CDS-3ʹ UTR) gefuseerd met GFP mRNA in gekweekte cellen te vinden van de optimale SINEUPs, en vervolgens testen BD kandidaten tegen endogene mRNA in gekweekte cellen en in vivo model dieren, van mensen en muizen naar andere soorten dieren en planten.

Dit protocol screening is erg snel. We hoeven niet te repareren en verzamelen van cellen, maar hoeft alleen maar te plaatsen van de levende cel cultuur plaat in de beeldvorming instrument. Wij willen deze high-throughput screening-protocol gebruiken om te selecteren van optimale BDs van SINEUPs en evalueren van potentiële kandidaten door analyse van de Western-blot. Geselecteerde kandidaten met optimale BDs kunnen dus worden toegepast om te verhogen van antilichaam productie18,19,21. Het RNA therapeutische gebied groeit momenteel dramatisch. Bijvoorbeeld, zijn siRNA, ASO, mRNA en CRISPR RNA therapieën, algemeen werkzaam om controle van mRNA uitdrukking van hun respectieve doelstellingen9,32. In dit verband, SINEUPs zijn in de kinderschoenen, maar tot nu toe geen van de bestudeerde SINEUPs uitdrukking van doel mRNAs veranderd. Daarnaast SINEUPs Bewerk niet gericht mRNA, maar alleen omhoog-regelen vertaling van mRNA. Bovendien kunnen verlies-van-functie ziekten ten gevolge van haploinsufficiency worden gericht door SINEUP therapie, een 2-fold inductie van de gebrekkige eiwitten17,33te bereiken. Hoewel uit-target effecten verder worden bestudeerd moeten, richten SINEUPs potentieel en specifiek op een enkele, uitgedrukt mRNA met een bijkomende opeenvolging aan de BD.

Een beperking van deze high-throughput protocol is dat het niet geschikt om scherm BDs van SINEUPs in in vivo Muismodellen omdat het protocol maatregelen het GFP geïntegreerd intensiteit alleen. SINEUPs zijn natuurlijke antisense lncRNAs, die post-transcriptionally handelen, kunnen niet ze worden toegepast wanneer de doelstelling mRNA in de cellen of de weefselmonsters ontbreekt.

Echter kan SINEUPs worden toegepast op winst-of-function studies, ter verbetering van de productie van het antilichaam, en als een RNA-therapie tot up-reguleren uiting van gebrekkige eiwitten binnen het bereik van 1,5-3.0-Vouw. De hier beschreven methoden presenteren een nuttige gids vormt om te richten en sporen van SINEUP-geïnduceerde vertaling verhoging van de gewenste mRNA en voorzien van een nieuw instrument voor post-transcriptional genregulatie.

Disclosures

De overeenkomstige auteur Piero Carninci is een van de oprichters van TransSINE Technologies Co. Ltd., die in het bezit van intellectuele eigendom op filed octrooi (EP2691522A4 en JP2017169573A), en verleende octrooi (US9353370B2) voor SINEUP technologie.

Acknowledgments

Deze studie werd gedeeltelijk ondersteund door de fundamentele wetenschap en het programma van de technologie van het Platform voor innovatieve biologische geneeskunde, no. 17 ben 0301014, uit het Japan Agency voor medisch onderzoek en ontwikkeling (AMED), onderzoeksbeurs van MEXT naar het midden van de RIKEN voor het leven Wetenschap technologieën en een onderzoeksbeurs van MEXT bij RIKEN IMS. Wij danken de leden van de PC-lab en van het SINEUP-netwerk (SISSA, Universiteit van Eastern Piemonte en RIKEN) voor nadenken stemmende discussies. Wij danken Dr Matthew Valentine voor proeflezen.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
Cel gebaseerde analyses van SINEUP niet-coderende RNAs die specifiek mRNA vertaling kunnen verbeteren
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter