Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Cell Based Assays di Non-codificazione RNAs che specificamente può migliorare la traduzione degli mRNA aumentandone

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs sono sintetici antisenso non-codificazione RNAs, che contengono un dominio di legame (BD) e un dominio effector (ED) e up-regolare la traduzione di mRNA di destinazione. Qui, descriviamo i metodi di rilevamento per SINEUPs in linee cellulari coltivate, analisi della loro attività di promozione di traduzione mediante Western-blot e un throughput elevato semi-automatizzato sistema di imaging.

Abstract

Potenziamento mirato-proteina è di importanza non solo per lo studio dei processi biologici, ma anche per applicazioni terapeutiche e biotecnologiche. Qui, presentiamo un metodo per selettivamente up-regolare l'espressione della proteina di geni desiderati in cellule coltivate mediante antisenso sintetica conosciuta come SINEUPs RNA non codificanti. È questo controllo positivo dell'espressione genica a livello post-trascrizionale ed esercitata da un invertito breve elemento nucleare sparpagliato (SINE) ripetizione alla fine di 3ʹ di SINEUPs che comprende il suo dominio effector (ED). SINEUPs in particolare possibile associare a qualsiasi mRNA codificanti per proteine di scelta attraverso il suo dominio di associazione (BD), un'area progettata per completare la sequenza all'interno della regione non tradotta (UTR 5ʹ) di 5ʹ e dintorni il codone di inizio del mRNA. Target-specifici SINEUPs progettato in questo modo transfected alle cellule coltivate, e proteine e RNA sono estratte per analisi successive, generalmente la post-transfezione 24-48 h. Proteina indotta da aumentandone up-regolazione viene rilevato mediante Western-blot ed espressione di RNA viene misurata utilizzando la trascrizione d'inversione quantitativa Real-Time PCR. Abbiamo osservato che il BD design è fondamentale per il raggiungimento ottimale aumentandone l'attività e che testando diverse BD dimensioni e posizioni per quanto riguarda il codone di inizio della destinazione del che mRNA è raccomandato. Di conseguenza, descriviamo qui un metodo di imaging ad alta velocità semi-automatizzato basato sulla rilevazione della fluorescenza che può essere implementata a target che mRNA fusa con la proteina fluorescente verde (GFP). SINEUPs in particolare migliorare la traduzione all'interno di gamma normale fisiologica della cellula, senza alterare il livello di trascrizione di destinazione. Questo metodo è stato impiegato con successo contro una gamma di obiettivi endogeni ed esogeni, in un'ampia varietà di umani, mouse e linee cellulari dell'insetto con sistemi in vivo. Inoltre, SINEUPs sono stati segnalati per aumentare la produzione di anticorpi e lavorare come un terapeutico contro haploinsufficient geni del RNA. La natura versatile e modulare di SINEUPs li rende uno strumento adatto per controllo traduzionale gene-specifico.

Introduction

Nell'era post-genomica, molte intuizioni sono state acquisite nei ruoli normativi gene di non-codificazione trascritti antisenso dovute all'evoluzione delle tecnologie di sequenziamento di nuova generazione1,2,3 e strumenti di modifica del gene. Questa categoria di trascrizioni, che precedentemente è stata considerata come "trascrizionale spazzatura", è ormai affermata come un giocatore chiave di regolazione genetica. Trascritti antisenso sono segnalati per modulare la cromatina e controllo stabilità ed espressione della loro cognate proteina-codificazione senso mRNA4,5. Nella maggior parte dei casi, questa modalità di regolamento è negativa e trascritti antisenso silenzio loro controparti di senso attraverso interazioni RNA-RNA6,7. Questo tratto di trascritti antisenso naturale è stato utilizzato ai geni downregulate desiderato sotto forma di sintetico Short interfering RNA (siRNA), microRNA (miRNA) e oligo antisenso (ASO)8,9,10 ,11 , lasciando un vuoto tecnologico per mirati su-regolamento del gene.

Uno studio intrigante ha cambiato la prospettiva del campo di RNA antisenso dimostrando che antisenso lungo RNA non codificanti (come lncRNAs) dei geni Uchl1 (ubiquitina C-terminale Idrolasi L1) e Uxt (trascrizione espresso ubiquitariamente) regolano positivamente traduzione di loro cognate senso mRNA a livello post-trascrizionale in topi12. Alla fine di 5ʹ di questi lncRNAs si sovrappone con diverse basi nella regione non tradotta 5ʹ (5ʹ UTR) delle loro corrispondenti trascrizioni di senso, e alla fine di 3ʹ non sovrapposte contiene una ripetizione invertita di un retrotrasposone appartenendo a breve sparpagliato nucleare famiglia di elemento (SINE). È interessante notare che, abbiamo scoperto che la principale forza motrice dietro questo up-regolazione traduzionale è ripetere il seno incorporato e non è limitato al mouse che sine ripete solo. Umano ripetizione Alu-contenenti come lncRNAs rafforzata anche la traduzione di mRNA bersaglio senso, rafforzando l'idea di una nuova classe di SINE-driven antisenso di regolamentazione non-codificazione RNAs, opportunamente denominata SINEUPs13. Recenti studi hanno dimostrato che il potenziale di SINEUPs naturale è conservato in SINEUPs sintetico progettato specificamente per mirare vari geni endogeni ed esogeni14,15. SINEUPs hanno due caratteristiche importanti: prima il "dominio di legame" (BD) che generalmente è la regione di fine 5ʹ complementare alla sequenza che comprende il primario avviare codone di un mRNA codificanti per proteine e secondo il "dominio effector" (ED) come incorpora un invertito ripetizione del seno che è un prerequisito per aumentandone funzione14 (Figura 1). SINEUPs può essere personalizzato per progettare un BD mira specificamente un gene di scelta. Questo può quindi essere sfruttato per sezionare la funzione di un particolare gene coinvolto in una via biologica, come un'alternativa migliore per una strategia di sovraespressione di mRNA convenzionali. Inoltre, questo strumento versatile può essere applicato per incrementare la produzione di anticorpi e come una droga per trattare haploinsufficient malattie causate da insufficienti dosaggi di proteine funzionali16,17,18, 19,20,21.

I vantaggi della tecnologia aumentandone sono molteplici. Non altera l'espressione del bersaglio al livello trascrizionale. BDs più fornire maggiore specificità ai SINEUPs, mentre non induce una risposta di stress di dsRNA-dipendente15. L'induzione della proteina è mantenuta entro l'intervallo fisiologico normale della cellula, impedendo qualsiasi effetto deleterio a causa di espressione della proteina aberrante o eccessivo. SINEUPs sono compatibili con una vasta gamma di mouse, umano, e criceto coltivate varietà di cellula, per esempio, HEK293T/17, HepG2, HeLa, CHO, MN9D e molte altre12,13,14,15,18 ,19. SINEUPs efficientemente possibile target geni endogeni, geni transitoriamente iperespresso e geni Bandierina-etichettate o luciferasi-fusion, eliminando la necessità di anticorpi di gene-specific14,18. L'analisi di base aumentandone richiede coltura cellulare ordinaria, trasfezione, elettroforesi del gel di sodio dodecil solfato-poliacrilammide (SDS-PAGE), tempo reale della trascrizione-polimerasi inversa quantitativa reazione a catena (qRT-PCR) strumenti e impostazioni, e perizia può essere acquisita in breve tempo.

Qui, descriviamo un metodo per il targeting geni con SINEUPs sintetico di up-regolare la traduzione, un effetto incompatibile con altre tecnologie come RNA interferenza9 e ASO gapmers11,22,23. Un metodo ampiamente utilizzato per l'attivazione del gene RNA-guida è cluster breve regolarmente intercapedine palindromico attivazione basata su ripetizioni (CRISPRa), dove l'espressione genica viene attivato al livello trascrizionale24. Questo metodo, anche se semplice e veloce, richiede più guida singola RNAs (sgRNAs) targeting per lo stesso gene per una maggiore efficienza, aumentando la probabilità di associazione fuori bersaglio25. Inoltre, l'enzima chiave del sistema CRISPRa, la proteina cataliticamente morto CRISPR-collegata 9 (dCas9) ha specificità obbligatoria bassa e sgRNAs targeting regioni promotrici di bi-direzionale possono non specifico up-regolare è vicino a geni25. Al contrario, SINEUPs legano agli mRNA alla regione singola associazione di destinazione con alta specificità e non influenzano l'espressione dei geni vicini. Discutiamo i passaggi di base coinvolti nella progettazione aumentandone, trasfezione, proteina e analisi di espressione di RNA. Inoltre, vi presentiamo un semi-automatico, ad alta velocità sistema di imaging per schermo SINEUPs multipli in una sola volta, che è utile per il rilevamento di SINEUPs ottimale.

Protocol

1. design di BDs di aumentandone costruisce per mRNA bersaglio

  1. Controllare il sito di inizio della trascrizione (TSS) e il sito iniziale traduzione di mRNA bersaglio nelle cellule di interesse. Acquisizione dei dati di TSS dai progetti l'ENCODE e il FANTOM (cap analisi dell'espressione genica, gabbia) (ZENBU: http://fantom.gsc.riken.jp/zenbu/).
  2. Aprire il browser, cercare geni di interesse e verifica TSS da cime di gabbia.
  3. Consultare l'esempio di analisi di cellule e tessuti specifici TSS di Parkinson malattia proteina 7 (PARK7) mRNA illustrato nella Figura 2.
  4. Progettazione di sequenze di BD di diverse lunghezze, corrispondente a 40 basi basi a Monte e 32 a valle della prima metionina (agosto), 72 nt in totale.
  5. Personalizzato ordinare il BDs progettato nel vettore di espressione aumentandone (Vedi Tabella materiali).
    Nota: Verificare la specificità di sequenza da strumento di ricerca di base di allineamento locale (BLAST) per evitare effetti di fuori bersaglio26.

2. cultura e aumentandone la transfezione delle cellule

  1. Celle di seme di interesse in una piastra a 6 pozzetti o piastra a 24 pozzetti per 24 h prima di transfezione di SINEUPs. Nel caso di varietà di cellula embrionali umane del rene (HEK293T/17) (Vedi Tabella materiali), seme 0,5 x 106 cellule per pozzetto di un 6-pozzetti o 1.5 x 105 cellule per pozzetto di una poli-D-lisina rivestite con ben 24-piastra (Vedi Tabella materiali). Diventa 70% confluenti dopo 24 h.
  2. Dopo 24 h, è necessario modificare il mezzo in 1,5 mL di terreno nuovo per una piastra a 6 pozzetti o 0,4 mL di terreno nuovo per una piastra a 24 pozzetti. In caso di aumentandone-GFP, transfect 0,6 µ g di pEGFP-C2 (Vedi Tabella materiali) e 3,4 µ g di aumentandone-GFP in un pozzetto di un 6-pozzetti o 130 ng di pEGFP-C2 e 670 ng di aumentandone-GFP in un pozzetto di una piastra a 24 pozzetti con reagente di transfezione (10 µ l in 6-pozzetti e 3 µ L a 24 pozzetti) seguendo le istruzioni del produttore (Vedi Tabella materiali) e incubare a 37 ° C in un incubatore a CO2 al 5% per 24 h.
  3. Lavare le cellule con 2 mL di soluzione salina tampone fosfato (PBS) (37 mM NaCl, 8 mM Na2HPO4, 2,6 mM KCl e 1,5 mM KH2PO4) in ciascun pozzetto di una piastra a 6 pozzetti o 0,5 mL di PBS in ciascun pozzetto di una piastra a 24 pozzetti. Solo per poli-D-lisina rivestite con ben 24-piastra, aggiungere 25 µ l di 0,05% in peso per volume di tripsina, Incubare in un incubatore di 5% CO2 per 5 min e 275 µ l di terreno di cellule per pozzetto. In caso di 6-piastra, aggiungere 2 mL di PBS in ciascun pozzetto. Dispensare su e giù per raccogliere 3/4 delle cellule (1,5 mL per una piastra a 6 pozzetti) o 225 µ l per una piastra a 24 pozzetti da 1 pozzetto per estrazione della proteina (Vai al protocollo n. 3 per l'estrazione proteica) e 1/4 delle cellule (0,5 mL per una piastra a 6 pozzetti) o 75 µ l per una piastra a 24 pozzetti per Estrazione del RNA e centrifugare a 6.000 x g per 5 min a 4 ° C (passare al punto 5 per l'estrazione di RNA).
    Nota: Analizzare l'effetto di aumentandone-GFP in un poli-D-lisina rivestite con ben 24-piatto da formazione immagine. Andare al passaggio 7 (analisi di imaging).

3. estrazione di proteine

  1. Attentamente aspirare 1,5 mL di PBS e 140 µ l di soluzione di lisi (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% (p/v) Triton, pirofosfato di sodio 2,5 mM, 1 mM β-glicerofosfato, 1 mM Na3VO4 1 μg/mL leupeptina e fluoruro di phenylmethylsulfonyl 0,005% (p/v) (PMSF)) (Vedi Tabella materiali) per un 6-pozzetti o 60 µ l per una piastra a 24 pozzetti per il pellet cellulare.
  2. Mescolare pipettando e poi mescolare accuratamente ruotando a bassa velocità per 1 h a 4 ° C. Raccogliere il surnatante mediante centrifugazione a 14.000 x g per 10 min a 4 ° C.
  3. Controllare la concentrazione nella proteina dall'analisi colorimetrica (Vedi tabella materiali). Preparare tutte le reazioni a temperatura ambiente.
    1. Preparare la diluizione di 5 - 6 volte di proteina albumina di siero bovino (BSA) standard in acqua ultrapura con concentrazioni che variano da 0.2-1.5 mg/proteina di mL. Preparare gli standard freschi ogni volta.
    2. Preparare il reattivo di lavoro Aʹ con 1 mL di reagente A (soluzione di tartrato di rame alcalino) con 20 µ l di reagente S (soluzione di tensioattivo).
    3. Caricare 5 µ l di acqua (controllo negativo), standard di BSA (proteina standard e positivo controllo) o campione della proteina in ciascun pozzetto di una piastra a 96 pozzetti.
    4. Aggiungere 25 µ l di reagente Aʹ in ciascun pozzetto. Con attenzione aggiungere 200 µ l di reagente B (reagente di Folin) per bene evitando qualsiasi formazione di bolle. Coprire la piastra con carta stagnola e attendere 5-10 min.
    5. Misurare l'assorbanza di proteina a 750 nm con uno spettrofotometro. L'assorbanza è stabile per almeno 1 h.
    6. Preparare la curva standard da tracciato concentrazioni di proteina standard BSA (mg/mL) su asse x e loro rispettivo assorbanza sull'asse y. Calcolare la concentrazione di proteine del campione applicando l'equazione della curva standard.
      Nota: Sospendere il protocollo a questo punto, se necessario, o andare al passaggio 4. Per l'archiviazione a lungo termine, snap congelare campioni proteici in azoto liquido e conservare a-80 ° C.

4. proteine separazione tramite SDS-PAGE e la rilevazione di proteine con anticorpi (analisi di Western-blot)

  1. Aggiungere un volume di 2 x della tintura di caricamento (0.1 M Tris-HCl (pH 6,8), 4% SDS, 20% glicerolo, 1,42% 2-mercaptethanol e blu di bromofenolo 0,2%) per ogni volume di campione della proteina dal punto 3.3. Riscaldare a 90 ° C per 5 minuti e raffreddare immediatamente in ghiaccio per 1 min.
  2. Caricare 10-20 µ g di campioni di proteine da gel di poliacrilammide di 10% SDS e separare a 100-150 V) (Vedi Tabella materiali).
  3. Trasferimento di proteine dal gel alla membrana di nitrocellulosa da 0,45 µm (Vedi Tabella materiali) dallo strumento di trasferimento semi-secco con tampone di trasferimento (25 mM Tris, glicina 192 mM e 20% metanolo) a 25 V per 30 min.
  4. Aggiungere la soluzione bloccante (5% senza grassi del latte secco nel 1 x TBST buffer (137 mM NaCl, 20 mM Tris-HCl (pH 7.6), 0.1% Tween-20)) (Vedi Tabella materiali) per il contenitore fino a quando la membrana è completamente bagnata e incubare a temperatura ambiente per 30 min.
  5. Nel caso di aumentandone-GFP, ibridare le proteine con anticorpo anti-GFP (diluito 1: 2000 nella soluzione di blocco) (Vedi Tabella materiali) incubando la membrana per 30 min con agitazione a temperatura ambiente. Come una proteina di controllo interno, rilevare la proteina β-actina da ibridare con l'anticorpo Anti-β-actina (diluito 1: 2000 nella soluzione di blocco) (Vedi Tabella materiali) per 30 min con agitazione a temperatura ambiente.
  6. Aggiungere 1 x TBST buffer al contenitore fino a quando la membrana è completamente bagnata e lavare per 5 min a temperatura ambiente. Ripetere il passaggio di lavaggio due volte (un totale di tre lavaggi).
  7. Ibridare proteina GFP a diluito (1: 1000 in soluzione bloccante) anti-coniglio anticorpo coniugato con perossidasi di rafano (HRP) e si ibridano proteina β-actina a diluito (1: 1000 in soluzione bloccante) anti-anticorpo coniugato con HRP sulla membrana per 30 min con agitazione a temperatura ambiente.
  8. Lavare la membrana con 1 x TBST buffer per 5 min a temperatura ambiente. Ripetere il passaggio di lavaggio due volte (un totale di tre lavaggi).
  9. Mescolare uguale volume di reagente di rilevamento avanzata HRP chemiluminescenza (ECL) 1 e 2 (Vedi Tabella materiali). Trasferire la membrana alla miscela reagente 2 mL ECL, coprire la scatola con carta stagnola e lasciarlo Incubare per 1-2 min a temperatura ambiente. Rimuovere la membrana da agitare ECL delicatamente ed esporre mediante una luminescenza strumento di imaging.

5. RNA estrazione e trattamento della dnasi

  1. Segue di RNA totale estratto lo standard di protocollo per l'estrazione di RNA da cellule cresciute in un monostrato27 o in alternativa utilizzare un estrazione di RNA disponibili in commercio kit (Vedi Tabella materiali). Per dichiarare in breve, aggiungere qualsiasi reagente di lisi monofasica (MLR) di guanidina isotiocianato e fenolo per le cellule prelevate in passo 2,3 (1ml MLR a 5 milioni di cellule)27.
    Nota: Cambiare spesso i guanti. Utilizzare i reagenti RNAsi-libera e dietilpirocarbonato (DEPC)-trattato di oggetti in plastica e articoli in vetro per evitare la degradazione del RNA. Se necessario, mettere in pausa il protocollo a questo passaggio. Archivio Estratto RNA a-80 ° C.
  2. Aggiungere 0,1 volume di tampone di dnasi 10x e 2 U di dnasi il RNA purificato dal passaggio 5.1 (Vedi Tabella materiali).
  3. Impostare il volume di reazione a 50 µ l con acqua priva di nucleasi e mescolare delicatamente. Incubare a 37 ° C per 30 min.
  4. Aggiungere 0,1 volume di reagente di inattivazione della dnasi ri-sospensione e mescolare bene (Vedi Tabella materiali). Incubare per 5 min a temperatura ambiente con agitazione delicata.
  5. Centrifugare a 10.000 x g per 90 s. trasferimento il surnatante (privo di DNA RNA) in una nuova provetta da 1,5 mL RNAsi-libera. Fare attenzione a non toccare il pellet, perché ciò può causare il riporto di dnasi che è fastidioso per la procedura a valle.
  6. Quantitate RNA misurando un260 e un rapporto di280 260/A (per RNA puro, la gamma è di 1.8-2.0) in uno spettrofotometro UV.

6. prima sintesi del cDNA di Strand e analisi qRT-PCR

  1. Eseguire la prima sintesi di cDNA di filo seguendo un protocollo di sintesi di cDNA standard come sotto (Vedi tabella materiali).
    1. Mescolare 0,75 µM oligo dT primer, 4,3 casuale dell'iniettore µM, dNTP (10 mM) con 200-500 ng RNA totale (da passaggi 5-8) a 10 µ l di volume di reazione totale. Incubare a 65 ° C per 5 min e poi immediatamente mettere il ghiaccio.
    2. Mescolare 1 tampone di trascrittasi inversa di x, 1 U di RNAsi inibitore, 10 U di trascrittasi inversa e aggiungere 10 µ l mix di primer di RNA da 6.1.1.
    3. Se necessario, impostare il volume di reazione totale di 20 µ l con acqua priva di nucleasi. Mescolare delicatamente e incubare il mix di reazione a 30 ° C per 10 min, poi a 42 ° C per 60 min e infine a 95 ° C per 5 min inattivare l'enzima. Lasciare raffreddare le provette sul ghiaccio.
      Nota: Scongelare i campioni di RNA e tutti i reagenti sul ghiaccio e preparare la miscela di reazione sul ghiaccio. Se la destinazione RNAs sono solo polyA RNAs, utilizzare solo primer oligo dT (2,5 µM). Se necessario, mettere in pausa il protocollo. Memorizzare il cDNA sintetizzato a-20 ° C.
  2. Eseguire qRT-PCR in triplici copie tecniche (n = 3, Cт deviazione standard > 0,2) e all'interno di repliche biologiche (n ≥ 3) utilizzando 1 µ l di 10 ng cDNA, 0,4 µ l di primer reverse (10 µM), 0,4 µ l di primer forward (10 µM), 10 µ l di soluzione di miscela della DNA polimerasi , 0,4 µ l di DNA double-strand macchiatura tintura, 10 µ l di acqua priva di nucleasi (volume di reazione è stata di 20 µ l) per rilevare i prodotti PCR utilizzando i seguenti condizioni; tenere il palco (1 ciclo) per 30 s a 95 ° C, ciclismo stadio (40 cicli) per 5 s a 95 ° C e per 30 s a 60 ° C, si fondono fase di curva. Sono esempi di primer per Gapdh_Fw umano: TCTCTGCTCCTCCTGTTC, Gapdh_Rv umano: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, aumentandone-GFP_Fw: CTGGTGTGTATTATCTCTTATG e aumentandone-GFP_Rv: CTCCCGAGTCTCTGTAGC. Vedere la tabella dei materiali. Analizzare l'espressione quantitativa di RNA con 2- ∆∆Ct ± SD metodo28.

7. analisi di SINEUPs di metodo di rilevazione semi-automatizzato di imaging

  1. Lavare le cellule con 0,5 mL di PBS per un pozzetto di una piastra a 24 pozzetti.
  2. Aggiungere 2,0 μg di Hoechst 33342 (Vedi Tabella materiali) (dissoluzione in 500 μL di PBS) a ciascuno di piastra a 24 pozzetti ed incubare le cellule a 37 ° C per 20 min a macchiare il nucleo.
  3. Misura Hoechst macchiato le cellule per contare il numero totale delle cellule ad un massimo di emissione blu di 461 nm e l'intensità di fluorescenza verde per contare il numero di cellule positive GFP a un massimo di emissione verde di 510 nm utilizzando un alto-rendimento micro-pozzo immagine citometro ( Vedi Tabella materiali). Analizzare il effetto up-regolamentazione della proteina del SINEUPs calcolando GFP integrato intensità, che è la somma di tutte le intensità di pixel visualizzati da segnale in oggetti segmentati calcolati per ogni canale, utilizzando Imaging software29.
  4. Raccogliere le cellule per controllare l'espressione del RNA (torna ai punti 5 e 6).

Representative Results

AUMENTANDONE-GFP è un aumentandone sintetico contenente entrambi un BD ottimale (-28 / + 4 si sovrappongono a GFP mRNA) e un ED (invertito SINE B2 da AS -Uchl1) che possa up-regolare traduzione degli mRNA GFP (Figura 3A e 3B) senza cambiare l'espressione della GFP mRNA (Figura 3 e 3D). Per schermo ottimale BDs ed EDs per SINEUPs, abbiamo sviluppato un protocollo di analisi di immagine semi-automatizzato che migliorato il tempo di rilevamento e aumentato il numero di campioni contemporaneamente proiettato rispetto a un convenzionale Western-blot analisi15. Come illustrato nella Figura 4, questo sistema di imaging ad alta velocità ha preso 3 giorni (analisi Western blot ha preso 2 settimane per 48 SINEUPs). Avendo dimostrato che aumentandone-GFP aumenta traduzione di GFP, abbiamo rilevato la GFP integrato intensità dal citometro di immagine. Il BD ottimale aumentandone-GFP ha indotto un 1.4-fold aumento nell'espressione della proteina GFP. Anche se abbiamo osservato la compressione dei segnali da 2,6 (analisi Western-blot, Vedi Figura 3A) a 1.4-fold (Imaging analisi, Vedi Figura 5), la differenza potrebbe essere dovuto la calibratura del software dello strumento di imaging. Tuttavia, abbiamo rilevato i livelli elevati significativamente di fluorescenza di GFP rispetto al controllo (Figura 5A e 5B).

Figure 1
Figura 1: disegno di base del sintetico SINEUPs. BD = dominio di legame per mRNA, ED di destinazione = dominio effector contenente una sequenza SINE invertita. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Trascrizione a partire siti (TSSs) di proteina per la malattia di Parkinson umana 7 (PARK7) mRNA in specifici tessuti e cellule rilevate tramite analisi gabbia. (A) A snapshot mostrando un risultato di ricerca di TSS per mRNA PARK7 umano utilizzando un'integrazione dei dati omics e visualizzazione interattiva sistema30. La freccia verde orizzontale della traccia di Entrez gene hg19 indica la posizione di genomica del riferimento umano PARK7 mRNA e le barre verticali verdi in FANTOM5 gabbia 1 e 2 tracce indicano la somma di TSSs (misurata come trascrizioni per milione (tpm)) da 1.829 tipi di tessuti e cellule. (B) Zoom in regione contrassegnato del TSS in pannello A (scala 1/354: 35,4 kb a 100 bp). Grey area ombreggiata nella fase FANTOM5 gabbia tracce 1 e 2 indica il TSS di 6 cellule specifiche fuori il totale 1.829, che sono elencati nella parte inferiore della figura. I numeri (11.369, 4.998, 4.304, 3.509, 3.477 e 3.055) corrispondenti a queste celle elencate indicano le trascrizioni per milioni di euro per ogni cella specifica presso il grigio sfumato posizioni del TSS. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: analisi di Western-blot confermando la up-regolazione della traduzione da aumentandone-GFP. (A) aumentandone-GFP è stato esaminato mediante Western blot con l'anticorpo anti-GFP. (B) risultati sono stati normalizzati per l'intensità della banda della proteina β-actina. (C) GFP mRNA e l'espressione di RNA aumentandone (D) sono stati rilevati mediante qRT-PCR. p < 0.0005, n = 3, test t di student a due code, barre di errore sono deviazione standard. Questa figura è stata modificata da Takahashi et al.15. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: schematica dell'analisi semi-automatico immagine aumentandone. Giorno 1: Seme celle di interesse in una piastra a 24 pozzetti. Giorno 2: Transfect GFP e aumentandone-GFP. Giorno 3: Analizzare l'effetto di SINEUPs misurando intensità GFP integrato. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: analisi di alto-rendimento di traduzione up-regolazione di aumentandone-GFP. (A) confronto della fluorescenza di GFP tra controllo e aumentandone-GFP transfettate cellule15. Barra della scala = 2 mm. (B) GFP integrato intensità è stato normalizzato al numero totale delle cellule contate dalla macchiatura nucleare con Hoechst 33342. p < 0.0005, n = 3, test t di student a due code, barre di errore sono deviazione standard. FOV: campo di vista. Questa figura è stata modificata da Takahashi et al.15. Clicca qui per visualizzare una versione più grande di questa figura.

Discussion

Abbiamo descritto qui un protocollo per migliorare in particolare la produzione di proteine di un target di mRNA per mezzo di una SINE-contenente non-codificanti RNA, chiamato SINEUPs. Come un esempio rappresentativo, ottimale aumentandone sintetico-GFP è mostrato di up-regolare la traduzione di mRNA GFP 2,6 come misurato da analisi Western blot.

Progettare un BD ottimale è fondamentale per garantire la specificità aumentandone e potenza (misura di up-regolazione della proteina). In precedenza, abbiamo proiettato 17 BDs di aumentandone-GFP di Western-blot analisi15 e abbiamo trovato che il BD ottima si sovrappone la sequenza di KOZAK AUG di mRNA GFP, anche se potrebbe non essere il caso con altri mRNA e deve essere verificata per ogni singolo caso. Un altro gruppo indipendente proiettato anche il BD utilizzando un metodo diverso di31. Come molti BDs di screening può essere piuttosto lungo e ingombrante, abbiamo introdotto un metodo di rilevazione ad alta velocità aumentandone qui. Questo metodo misura relativi cambiamenti nella densità GFP integrato in cellule trasfettate con aumentandone rispetto al transfettati per il controllo vettoriale. Per garantire che ugualmente transfected le cellule in un particolare bene di una piastra di coltura e segnale GFP non è concentrata solo una determinata regione del pozzo, è molto importante distribuire le cellule ugualmente in pozzi nel punto 2.1. Per questo scopo, agitare la piastra 10 volte avanti e indietro (↑ ↓) dopo la semina le cellule all'interno di un banco pulito delicatamente e ripetere nell'incubatrice 5% CO2 prima di iniziare l'incubazione.

Un altro punto critico è il calcolo della concentrazione nella proteina in fase 3.3. Il caricamento di una quantità errata di proteine durante l'analisi di Western-blot, di conseguenza impedire rilevamento di piccoli cambiamenti nell'espressione della proteina da alcuni il SINEUPs debole o generare falsi positivi da sovraccarico può causare errori di calcolo qui. Si consiglia di preparare appena la curva standard di proteine ogni volta, assicurandosi che uguali quantità di norme e campioni proteici sono misurati al punto 3.3.3. Il protocollo descritto qui si concentra su aumentandone-GFP, ma analisi Western-blot può essere utilizzato per qualsiasi destinazione mRNA di interesse. Il tempo di incubazione e la concentrazione degli anticorpi deve essere ottimizzati per ogni destinazione ottenere il miglior risultato.

Una delle caratteristiche uniche di SINEUPs è che il livello di espressione di mRNA bersaglio rimane inalterato. È importante per il trattamento di RNA con dnasi per evitare il rilevamento di SINEUPs trasfettate e DNA genomico mediante qRT-PCR. AUMENTANDONE RNAs e l'espressione del mRNA bersaglio dovrebbe essere misurate mediante qRT-PCR per confermare il successo di transfezione e di attività aumentandone. SINEUPs contengono una sequenza SINE, che è abbondante in tutto sia l'essere umano e del mouse genomi. Per evitare il rilevamento non specifici delle sequenze di SINE, non è consigliabile per disegnare qRT-PCR primers per la sequenza SINE.

In questo protocollo abbiamo utilizzato linee cellulari umane, ma SINEUPs sono efficaci in una serie di linee cellulari da parecchie specie diverse12,13,14,18,19. Le condizioni di cultura e di transfezione delle cellule possono essere modificate secondo diverse linee cellulari, purché questi mantengono l'efficienza di trasfezione dei vettori aumentandone. Inoltre, possono essere impiegati metodi alternativi di estrazione RNA, sintesi del cDNA e il controllo della concentrazione di proteine, dato che conservano la qualità richiesta di RNA e proteine per qRT-PCR e Western-blot analisi. Mentre abbiamo usato un cytometer di micro-pozzo alto-rendimento specifico, che attivato il rilevamento della fluorescenza di GFP attraverso l'intero ben, altri citometri con una simile gamma di rilevazione possono essere usate31. Deve essere notato che se la distribuzione di cellule e transfezione è uguale in tutto un bene, quindi non è necessario eseguire la scansione l'intero pozzo per fluorescenza GFP: metà o un quarto della zona di un pozzo potrebbe essere sufficiente a discernere effetto aumentandone secondo esperimento Competenze di al.

Stabilire un protocollo di rilevamento aumentandone di alto-rendimento consente la selezione simultanea di più BDs targeting un determinato mRNA in cellule coltivate. Questo è importante perché le norme che disciplinano il targeting ottimale per il BD non sono ancora chiare. Tale un multiplex sistema di screening permette di testare su larga scala di molti SINEUPs contro diversi geni, utili per il targeting di molteplici geni coinvolti in una particolare via di segnalazione per esempio. Inoltre, può essere utilizzata per espandere la ricerca di efficaci SINEUPs targeting alcuni mRNA, progettando diversi aumentandone BDs intorno AUG-Kozak regione (Vedi Figura 1), co-trasfettando integrale mRNA bersaglio (5ʹ UTR-CD-3ʹ UTR) fusi con GFP mRNA in cellule coltivate per trovare la SINEUPs ottimale e successivamente test BD candidati contro endogeno mRNA in cellule coltivate e animali modello in vivo, da esseri umani e topi ad altre specie animali e vegetali.

Questo protocollo di screening è molto veloce. Non abbiamo bisogno di difficoltà e raccogliere le cellule, ma solo bisogno di inserire la vita delle cellule piastra di coltura in strumento di imaging. Ci proponiamo di utilizzare questo protocollo di screening ad alta resa ottimale BDs di SINEUPs di selezionare e valutare potenziali candidati mediante Western-blot. Quindi, i candidati selezionati con BDs ottimale possono essere applicati per aumentare la produzione di anticorpi18,19,21. Attualmente, il campo terapeutico di RNA è drammaticamente in crescita. Per esempio, siRNA, ASO, mRNA e terapie CRISPR RNA, sono largamente impiegate per controllare l'espressione di mRNA dei loro rispettivi target9,32. In questo contesto, SINEUPs sono nella loro infanzia, ma finora nessuno l'ha studiato SINEUPs cambiato espressione di mRNA bersaglio. Inoltre, non modificare i SINEUPs mRNA di destinazione, ma solo su-regolare la traduzione di mRNA. Inoltre, perdita di funzione malattie derivanti dal haploinsufficiency possono essere mirate per terapia aumentandone, ottenendo una volta 2 induzione della proteina carente17,33. Anche se fuori bersaglio effetti devono essere ulteriormente studiati, SINEUPs, potenzialmente e specificamente di destinazione un mRNA singolo, espresso con una sequenza complementare al BD.

Una limitazione del presente protocollo ad alta velocità è che non è adatto a schermo BDs di SINEUPs in modelli di topo in vivo poiché le misure del protocollo la GFP integrato intensità solo. Come SINEUPs sono lncRNAs antisenso naturali che agiscono appaiamento, non possono essere applicati quando la destinazione mRNA è mancante nelle cellule o i campioni di tessuto.

Tuttavia, SINEUPs può essere applicato agli studi di guadagno di funzione, per migliorare la produzione di anticorpi e come terapia RNA di up-regolare l'espressione di proteine carenti all'interno della gamma di 1.5-3.0-fold. I metodi descritti qui presentano una guida utile per indirizzare e rilevare potenziamento indotto da aumentandone traduzione di mRNA desiderata e fornire un nuovo strumento per la regolazione genica post-trascrizionale.

Disclosures

L'autore corrispondente Piero Carninci è uno dei fondatori della TransSINE Technologies Co., Ltd. che detiene la proprietà intellettuale sul brevetto archiviato (EP2691522A4 e JP2017169573A) e concesso brevetto (US9353370B2) per tecnologia aumentandone.

Acknowledgments

Questo studio è stato sostenuto in parte dalla scienza di base e piattaforma tecnologia Program per medicina biologica innovativa, Nr. 17 am 0301014, dall'Agenzia giapponese per la ricerca medica e sviluppo (AMED), assegno di ricerca dal MEXT al RIKEN Center for Life Tecnologie di scienza e un assegno di ricerca dal MEXT a IMS RIKEN. Ringraziamo i membri del laboratorio PC e della rete aumentandone (SISSA, Università del Piemonte orientale e RIKEN) per discussioni stimolanti. Ringraziamo il dottor Matthew Valentine per correzione di bozze.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
Cell Based Assays di Non-codificazione RNAs che specificamente può migliorare la traduzione degli mRNA aumentandone
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter