Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Cellen basert analyser av SINEUP ikke-koding RNAs som spesielt kan forbedre mRNA oversettelse

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs er syntetiske antisense ikke-koding RNAs, som inneholder en bindende domene (BD) og et effektor domene (ED) og opp-regulere oversettelse av målrette mRNA. Her beskriver vi gjenkjenningsmetoder for SINEUPs i kulturperler cellelinjer, analyse av deres oversettelse-fremme ved Western blot og en semi-automatisert høy gjennomstrømning tenkelig system.

Abstract

Mål-protein ekstrautstyr er viktig ikke bare for studiet av biologiske prosesser, men også for terapeutisk og bioteknologisk. Her presenterer vi en metode for å selektivt opp-regulere protein uttrykk for ønsket gener i kulturperler celler ved hjelp av syntetisk antisense ikke-koding RNAs kjent som SINEUPs. Denne positive kontrollen av genuttrykk på post-transcriptional nivå og utøves av en invertert kort avbrutt kjernefysiske element (SINE) gjenta nederst 3ʹ SINEUPs som omfatter sitt effektor domene (ED). SINEUPs kan spesielt bindes til et protein-koding mRNA gjennom sin bindende domene (BD), et område som er utformet for å utfylle sekvensen i 5ʹ uoversatt regionen (5ʹ UTR) og rundt start codon av mRNA valg. Mål-spesifikke SINEUPs utviklet på denne måten er transfekterte kulturperler celler, og protein og RNA pakkes for nedstrøms analyser, vanligvis 24-48 h etter hva. SINEUP-indusert protein opp-regulering oppdages av Western blot analyse og RNA uttrykk måles med sanntid kvantitative omvendt transkripsjon PCR. Vi har observert at BD design er avgjørende for å oppnå optimal SINEUP aktivitet og som tester ulike BD størrelsene og plasseringen med hensyn til start codon til målet mRNA anbefales. Derfor beskriver vi her en halvautomatisk høy gjennomstrømming bildebehandling metode basert på fluorescens oppdagelse som kan gjennomføres mot mRNA smeltet sammen med grønne fluorescerende protein (GFP). SINEUPs forbedre spesielt oversettelsen innenfor normale fysiologiske cellen, uten å endre transkripsjon målnivået. Denne metoden har vært vellykket ansatt mot en rekke endogene og ytre mål, i en rekke menneskelige, musen og insekt linjer sammen med i vivo systemer. Videre er SINEUPs rapportert å øke antistoffproduksjon og fungere som en RNA terapeutiske mot haploinsufficient gener. Allsidig og modulære natur SINEUPs gjør dem et egnet verktøy for gen-spesifikke translasjonsforskning kontroll.

Introduction

I post-genom tid, mange innsikt har fått i genet regulatoriske rollene til ikke-koding antisense utskrifter på grunn av utviklingen av neste generasjons sekvensering teknologi1,2,3 og Gen-redigeringsverktøy. Denne kategorien av transkripsjoner, som ble tidligere regnet som "transcriptional trash", er nå etablert som en sentral aktør i genetisk forskriften. Antisense utskrifter rapporteres å modulere chromatin og kontroll stabilitet og uttrykk for deres beslektet protein-koding følelse mRNA4,5. I de fleste tilfeller denne modusen for regulering er negativ og antisense utskrifter stillhet papirformat følelse gjennom RNA-RNA interaksjoner6,7. Denne egenskap av naturlige antisense transkripsjoner blitt benyttet til downregulate ønsket gener i form av syntetiske lite forstyrrende RNA (siRNA), microRNA (miRNA) og antisense oligos (ASO)8,9,10 ,11 forlate et teknologisk tomrom for målrettet genet opp-regulering.

En spennende studie forandret perspektivet til feltet for antisense RNA ved å demonstrere det antisense lenge ikke-koding RNAs (som lncRNAs) av genene Uchl1 (ubiquitin C-terminalen hydrolase L1) og Uxt (overalt uttrykt utskriften) positivt regulere oversettelse av deres beslektet forstand mRNA på post-transcriptional nivå i mus12. 5ʹ slutten av disse ispedd lncRNAs overlapper flere baser i 5ʹ uoversatt regionen (5ʹ UTR) i sine tilsvarende følelse transkripsjoner, og ikke-overlappende 3ʹ slutten inneholder en invertert gjentakelse av en retrotransposon tilhører kort kjernefysiske element (SINE) familie. Interessant, fant vi at den viktigste drivkraften bak denne translasjonsforskning opp-forskriften er innebygd sinus gjenta og det er ikke begrenset til musen sinus gjentar bare. Menneskelige Alu gjenta inneholder navnet som lncRNAs også forbedret oversettelse av målet fornuftig mRNAs, forsterker ideen om en roman klasse av sinus-drevet regulatoriske antisense ikke-koding RNAs, passende SINEUPs13. Studier viste at potensialet i naturlige SINEUPs beholdes i syntetisk SINEUPs designet spesielt mot ulike endogene og eksogene gener14,15. SINEUPs har to viktige funksjoner: første "bindende domene" (BD) hvilke er vanligvis 5ʹ slutten regionen utfyllende til sekvensen omfatter primært start codon av et protein-koding mRNA, og andre "effektor domain" (ED) som opptar en invertert gjentakelse av sinus som er en forutsetning for SINEUP funksjonen14 (figur 1). SINEUPs kan tilpasses for å designe en BD spesielt rettet mot et gen valgfrihet. Dette kan deretter bli brukt til å analysere funksjonen til et bestemt gen involvert i en biologisk sti, som et bedre alternativ til en konvensjonell mRNA overuttrykte strategi. Dessuten, denne allsidige verktøyet kan brukes til å øke antistoffproduksjon, og som et rusmiddel til å behandle haploinsufficient sykdommer forårsaket av utilstrekkelig dosering av funksjonelle proteiner16,17,18, 19,20,21.

Fordelene med SINEUP teknologi er mange. Det endrer ikke uttrykk for målet på transcriptional nivå. Lengre BDs gi mer spesifisitet for SINEUPs, mens ikke indusere en dsRNA-avhengige stress respons15. Protein induksjon opprettholdes innen normale fysiologiske cellen, hindrer noen skadelig effekt på grunn av avvikende eller overdreven protein uttrykk. SINEUPs er kompatible med en rekke musen, menneskelig, og hamster kultivert linjer, for eksempel HEK293T/17, HepG2, jakten, CHO, MN9D og mange flere12,13,14,15,18 ,19. SINEUPs kan effektivt målrette endogene gener, transiently overexpressed gener og flagg-merket eller luciferase-fusion gener, eliminerer behovet av gen-spesifikke antistoffer14,18. Grunnleggende SINEUP analysen krever rutinemessig cellekultur, hva, natrium dodecyl sulfat-polyakrylamid gel geleelektroforese (SDS-side), sanntid kvantitative omvendt transkripsjon-polymerase kjedereaksjon (qRT-PCR) instrumenter og innstillinger, og kompetanse kan oppnås på kort tid.

Her beskriver vi en metode for målretting gener med syntetisk SINEUPs å opp-regulere oversettelse, en effekt i motsetning til andre teknologier som RNA forstyrrelser9 og ASO gapmers11,22,23. En brukte metoden for RNA-guidede genet aktivisering er gruppert regelmessig interspaced kort palindromic gjentar-basert aktivering (CRISPRa), hvor genuttrykk utløses på transcriptional nivå24. Denne metoden, men enkel og rask, krever flere enkelt guide RNAs (sgRNAs) rettet mot det samme genet for høyere effektivitet, og dermed øke sjansene for off-målet bindende25. I tillegg nøkkel enzymet CRISPRa systemet, katalytisk død CRISPR-assosiert protein 9 (dCas9) har lav bindende spesifisitet og sgRNAs rettet mot toveis promoter regioner kan nonspecifically opp-regulere i nærheten gener25. Derimot SINEUPs binde for å målrette mRNA på et enkelt bindende område med høy spesifisitet og påvirker ikke uttrykket av nærliggende gener. Vi diskuterer de grunnleggende trinnene involvert i SINEUP design, hva, protein og RNA uttrykk analyser. Videre, presenterer vi en halvautomatisk, høy gjennomstrømming tenkelig system til skjermen flere SINEUPs samtidig, som er nyttig for påvisning av optimal SINEUPs.

Protocol

1. prosjektert av BDs av SINEUP konstruerer for målet mRNAs

  1. Sjekk transkripsjon Start (TSS) og oversettelse Start område av målet mRNAs i cellene av interesse. Erverve TSS data fra både kode og FANTOM prosjekter (cap analyse av genuttrykk, bur) (ZENBU: http://fantom.gsc.riken.jp/zenbu/).
  2. Åpne nettleseren, søk gener rundt og sjekke TSS av BURET topper.
  3. Se eksempel analyse av celler og vev bestemt TSS av Parkinsons sykdom protein 7 (PARK7) mRNA vist i figur 2.
  4. Design BD sekvenser av flere forskjellige lengder tilsvarer 40 baser oppstrøms og 32 baser nedstrøms av den første metionin (august), 72 nt totalt.
  5. Custom Bestill designet BDs i SINEUP uttrykk vektor (se Tabell for materiale).
    Merk: Sjekk sekvens spesifisitet av grunnleggende lokale justering søkeverktøy (BLAST) å unngå off-målet effekter26.

2. celle kultur og SINEUP Transfection

  1. Frø celler rundt i en 6 vel-plate eller 24 godt-plate for 24 timer før transfection av SINEUPs. Når det gjelder menneskelige embryonale nyre celle linje (HEK293T/17) (se Tabell for materiale), frø 0.5 x 106 celler per brønn en 6 vel-plate eller 1,5 x 105 celler per brønn av en poly-D-lysine belagt 24 godt-plate (se Tabell for materiale). Det blir 70% confluent etter 24 timer.
  2. Etter 24 timer, kan du endre mediet 1,5 mL av fersk medium for en 6 vel-plate eller 0,4 mL av fersk medium for en 24 godt-plate. Ved SINEUP-GFP, transfect 0,6 µg av pEGFP-C2 (se Tabell for materiale) og 3,4 µg av SINEUP-GFP i en brønn en 6 vel-plate eller 130 ng av pEGFP-C2 og 670 ng av SINEUP-GFP i en godt av en 24 godt-plate med transfection reagens (10 µL i 6 vel-plate og 3 μ L 24 godt-tallerken) ved å følge instruksjonene fra produsenten (se Tabell for materiale), og Inkuber på 37 ° C i en 5% CO2 inkubator for 24 timer.
  3. Vask celler med 2 mL fosfat buffer saline (PBS) (37 mM NaCl, 8 mM Na2HPO4, 2.6 mM KCl og 1,5 mM KH2PO4) i hver brønn av en 6 vel-plate eller 0,5 mL PBS i hver brønn av en 24 godt-plate. Bare for poly-D-lysine belagt 24 godt-plate, Legg 25 µL av 0,05% vekt per volum Trypsin, ruge i en 5% CO2 inkubator for 5 min og Legg 275 µL av cellen medium per brønn. Ved 6 vel-plate, kan du legge 2 mL PBS i hver brønn. Pipetter opp og ned å høste 3/4 av celler (1,5 mL for en 6 vel-plate) eller 225 µL for en 24 godt-plate 1 for protein utvinning (gå til protokoll 3 for protein utvinning) og 1/4 av celler (0,5 mL for en 6 vel-plate) eller 75 µL for en 24 godt-plate for RNA utvinning og sentrifuge 6000 x g for 5 min på 4 ° C (gå til trinn 5 for RNA utvinning).
    Merk: Analysere effekten av SINEUP-GFP i en poly-D-lysine belagt 24 godt-plate av tenkelig. Gå til trinn 7 (tenkelig analyse).

3. protein utvinning

  1. Nøye Sug opp 1,5 mL PBS og legge til 140 µL lysis løsning (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% (w/v) Triton, 2,5 natrium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na3VO4 1 μg/mL leupeptin og 0.005% (w/v) phenylmethylsulfonyl fluor (PMSF)) (se Tabell for materiale) for en 6 vel-plate eller 60 µL for en 24 godt-plate til celle pellets.
  2. Blande av pipettering og deretter bland godt av kjører i 1t på 4 ° C. Samle nedbryting av sentrifugering 14.000 x g i 10 min på 4 ° C.
  3. Sjekk protein konsentrasjon av kolorimetrisk analysen (se tabell for materiale). Forberede alle reaksjoner ved romtemperatur.
    1. Forberede 5 - 6 ganger fortynning av bovin serum albumin (BSA) protein i ultrapure vann med konsentrasjonene varierer fra 0,2-1.5 mg/mL protein. Forberede frisk standarder hver gang.
    2. Forbered arbeidet reagens Aʹ ved å blande 1 mL av reagens en (alkaliske kobber tartrate løsning) med 20 µL til reagensen S (surfactant løsning).
    3. Laste 5 µL (negativ kontroll), BSA standard (protein standard og positiv kontroll) eller protein prøve i hver brønn av en 96-brønnen-plate.
    4. Legge til 25 µL til reagensen Aʹ i hver brønn. Nøye legge 200 µL til reagensen B (Folin reagens) per også unngå noen boble-formasjonen. Dekk platen med aluminiumsfolie og vente i 5-10 min.
    5. Måle protein absorbansen på 750 nm med et spektrofotometer. Absorbansen er stabil minst 1t.
    6. Klargjør standardkurve ved inntegningsrekkefølgen BSA standard protein konsentrasjoner (mg/mL) på x-aksen og deres respektive absorbansen på y-aksen. Beregne prøve protein konsentrasjon ved bruk av standardkurve ligningen.
      Merk: Pause protokollen på dette trinnet hvis nødvendig, eller gå til trinn 4. For langvarig lagring, fest fryse protein prøver i flytende nitrogen og store på-80 ° C.

4. protein separasjon av SDS side og deteksjon av mål proteiner med antistoffer (Western blot analyse)

  1. Legge ett volum 2 x lasting fargestoff (0.1 M Tris-HCl (pH 6.8), 4% SDS, 20% glyserol, 1.42% 2-mercaptethanol og 0,2% bromophenol blå) for hvert volum i protein utvalg fra trinn 3.3. Varme ved 90 ° C i 5 min og umiddelbart kule på is 1 min.
  2. Laste inn 10-20 µg av protein prøver å 10% SDS poly-akrylamid gel og separate på 100-150 V) (se Tabell for materiale).
  3. Overføre protein fra gel til 0.45-µm nitrocellulose membran (se Tabell for materiale) av semi-tørr overføring instrument med overføring buffer (25 mM Tris, 192 mM glysin og 20% metanol) på 25 V i 30 min.
  4. Legge til blokkering løsning (5% ikke-fett tørr melk 1 x TBST buffer (137 mM NaCl, 20 mM Tris-HCl (pH 7.6), 0,1% Tween-20)) (se Tabell of Materials) til beholderen til membranen er helt gjennomvåt og Inkuber det ved romtemperatur for 30 min.
  5. I SINEUP-GFP, hybridize protein med anti-GFP antistoff (utvannet 1:2000 i blokkering løsning) (se Tabell for materiale) av rugende membranen i 30 min med skjelvende ved romtemperatur. Som en intern kontroll protein, oppdage β-utgangen protein ved hybridizing med Anti-β-utgangen antistoff (utvannet 1:2000 i blokkering løsning) (se Tabell for materiale) i 30 min med skjelvende ved romtemperatur.
  6. Legge til 1 x TBST buffer i beholderen til membranen er helt gjennomvåt og vask for 5 min ved romtemperatur. Gjenta vask trinn to flere ganger (totalt tre vasker).
  7. Hybridize GFP protein til utvannet (1:1000 i blokkering løsning) anti-kanin antistoff konjugert med pepperrotperoksidase (HRP) og hybridize β-utgangen protein til utvannet (1:1000 i blokkering løsning) anti-musen antistoff konjugert med HRP på membranen i 30 min med skjelvende ved romtemperatur.
  8. Vask membran med 1 x TBST buffer for 5 min ved romtemperatur. Gjenta vask trinn to flere ganger (totalt tre vasker).
  9. Bland like volum av HRP-forbedret chemiluminescence (ECL) oppdagelsen reagensen 1 og 2 (se Tabell for materiale). Overføre membranen til 2 mL ECL reagens blanding, dekke boksen med aluminiumsfolie og la det ruge i 1-2 min ved romtemperatur. Nøye fjerne membranen fra ECL reagens blanding og avsløre bruker en luminescence imaging instrument.

5. RNA utvinning og DNase behandling

  1. Ekstra totale RNA følgende standard protokoll for RNA utvinning fra celler dyrket i en monolayer27 , eller alternativt bruke en kommersielt tilgjengelig RNA utvinning kit (se Tabell for materiale). For å si kort, legge til noen monophasic lysis reagens (MLR) av guanidine isothiocyanate og fenol til høstet cellene i trinn 2,3 (1 mL MLR per ~ 5 millioner celler)27.
    Merk: Endre hansker ofte. RNase-gratis reagenser og diethylpyrocarbonate (DEPC)-behandlet plast ware og glass å hindre RNA degradering. Pause protokollen på dette trinnet hvis nødvendig. Store utdraget RNA for-80 ° C.
  2. Legge til 0,1 volumet av 10 x DNase buffer og 2 U DNase renset RNA fra trinn 5.1 (se Tabell for materiale).
  3. Setter reaksjon volumet til 50 µL med nuclease-fritt vann og bland forsiktig. Ruge på 37 ° C i 30 min.
  4. Legge til 0,1 volumet på nytt suspendert DNase inaktivering reagens og bland godt (se Tabell for materiale). Inkuber i 5 minutter ved romtemperatur med mild risting.
  5. Sentrifuge 10.000 x g for 90 s. overføring nedbryting (DNA-fri RNA) til en frisk RNase-fri 1,5 mL tube. Være forsiktig med å ta pellet fordi dette kan føre til bære-over av DNase som er plagsom for nedstrøms trinnene.
  6. Quantitate RNA ved å måle en260 og260/A280 forholdet (for ren RNA, området er 1,8-2,0) i et UV spektrofotometer.

6. første Strand cDNA syntese og qRT PCR analyse

  1. Utføre første strand cDNA syntese etter en standard cDNA syntese protokoll som under (se tabell for materiale).
    1. Bland 0,75 µM oligo dT primer, 4,3 µM tilfeldig primer, dNTPs (10 mM hver) med 200-500 ng totale RNA (fra trinn 5-8) i 10 µL av totale reaksjon. Inkuber ved 65 ° C i 5 minutter og deretter umiddelbart lagt på is.
    2. Bland 1 x revers transkriptase buffer, 1 U av RNase inhibitor, 10 U revers transkriptase, og legger til 10 µL RNA-primer blanding fra 6.1.1.
    3. Angi totalt reaksjon volumet til 20 µL med nuclease-fritt vann om nødvendig. Bland forsiktig og Inkuber reaksjonen blanding på 30 ° C i 10 min, så ved 42 ° C for 60 min, og til slutt på 95 ° C i 5 min å deaktivere enzymet. Cool rørene på is.
      Merk: Tine RNA prøvene og alle reagenser på is og forberede reaksjonen blanding på is. Hvis målet RNAs er bare polyA RNAs, bruke oligo dT primer bare (2,5 µM). Pause protokollen om nødvendig. Lagre syntetisk cDNA på 20 ° C.
  2. Utføre qRT PCR i teknisk triplicates (n = 3, Cт standardavvik > 0,2) og biologiske replikat (n ≥ 3) med 1 µL av 10 ng cDNA, 0.4 µL av omvendt primer (10 µM), 0.4 µL av fremover primer (10 µM), 10 µL av blanding løsning av DNA polymerase , 0.4 µL av dobbel-strand DNA flekker fargestoff, 10 µL av nuclease-fritt vann (reaksjon var 20 µL) å oppdage PCR produkter med følgende forhold; Hold scenen (1 syklus) for 30 s på 95 ° C, sykling scenen (40 sykluser) for 5 s på 95 ° C og 30 s ved 60 ° C, smelte kurve scenen. Primer eksemplene er for menneskets Gapdh_Fw: TCTCTGCTCCTCCTGTTC, Human Gapdh_Rv: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, SINEUP-GFP_Fw: CTGGTGTGTATTATCTCTTATG og SINEUP-GFP_Rv: CTCCCGAGTCTCTGTAGC. Se tabellen i materialer. Analysere kvantitative RNA uttrykk med 2- ∆∆Ct ± SD metoden28.

7. imaging analyse av SINEUPs av semi-automatisk oppdagelse metode

  1. Vask celler med 0,5 mL PBS for en godt av en 24 godt-plate.
  2. Legge til 2.0 μg av Hoechst 33342 (se Tabell for materiale) (dissolving i 500 μL PBS) til hver godt av 24-vel-plate og ruge cellene på 37 ° C for 20 min stain kjernen.
  3. Mål Hoechst farget celler for å telle antall celler blå utslipp maksimalt 461 nm og intensiteten av grønne fluorescens telle antall GFP positive celler på grønne utslipp maksimalt 510 nm ved hjelp av en høy gjennomstrømming mikro-godt bilde cytometer ( se Tabellen for materiale). Analysere protein opp-regulerende effekt av SINEUPs ved beregning av GFP integrert intensitet, som er summen av alle piksel intensiteter vise signal i segmentert objekter beregnet for hver kanal, bruke bildebehandling programvare29.
  4. Høste celler å sjekke RNA uttrykk (tilbake til trinn 5 og 6).

Representative Results

SINEUP-GFP er en syntetisk SINEUP som inneholder både en optimal BD (-28 / 4 overlapper til GFP mRNA) og en ED (invertert sinus B2 fra AS -Uchl1) som kan opp-regulere GFP mRNA oversettelse (figur 3A og 3B) uten å endre uttrykk for GFP mRNA (Figur 3 c og 3D). Til skjermen optimal BDs og EDs for SINEUPs, utviklet vi protokollen halvautomatisk bildeanalyser som forbedret gjenkjenning tid og økt antall eksempler er samtidig vist sammenlignet med en konvensjonell Western blot analyse15. Som vist i Figur 4, tok denne høy gjennomstrømming tenkelig system tre dager (Western blot analyse tok 2 uker for 48 SINEUPs). Har vist at SINEUP-GFP øker GFP oversettelse, oppdaget vi GFP integrert intensiteten av bilde-cytometer. Den optimale BD SINEUP-GFP fikk en 1.4-fold økning i GFP protein uttrykk. Selv om vi observerte komprimering av signaler fra 2,6 (Western blot analyse, se figur 3A) til 1.4-fold (Imaging analyse, se figur 5), forskjellen kan skyldes kalibrering av tenkelig maskinen programvaren. Likevel oppdaget vi betydelig høyere nivåer av GFP fluorescens sammenlignet med kontrollen (figur 5A og 5B).

Figure 1
Figur 1: grunnleggende utformingen av syntetiske SINEUPs. BD = bindende domene målrettingsland mRNA, ED = effektor domenet som inneholder en invertert sinus sekvens. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: Transkripsjon starter nettsteder (TSSs) av menneskelig Parkinsons sykdom protein 7 (PARK7) mRNA bestemt vev og celler som oppdages av BURET analyse. (A) A øyeblikksbilde viser et TSS søkeresultat for menneskelig PARK7 mRNA bruke omics dataintegrasjon og interaktive visualisering systemet30. Den vannrette grønne pilen i Entrez gene hg19 spor angir genomisk plasseringen av referansen menneskelige PARK7 mRNA og de vertikale grønne linjer i FANTOM5 bur 1 og 2 spor viser summen av TSSs (målt som transkripsjoner per million (tpm)) fra 1,829 typer vev og celler. (B) Zoom inn på området markant TSS i panelet A (1/354 skala: 35,4 kb til 100 bp). Grå skyggelagt område i FANTOM5 bur fase 1 og 2 spor angir TSS i 6 bestemte celler av de totale 1,829, som er oppført i bunnen av figuren. Tallene (11.369, 4.998, 4.304, 3.509, 3.477 og 3.055) svarer til disse oppførte celler indikerer transkripsjoner per million for hver bestemt celle på grå skyggelagt posisjoner av TSS. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: Western blot analyse bekrefter opp-regulering av oversettelse av SINEUP-GFP. (A) SINEUP-GFP ble undersøkt av Western blot med anti-GFP antistoff. (B) resultater var normalisert til intensiteten av β-utgangen protein bandet. (C) GFP mRNA og (D) SINEUP RNAs uttrykk ble oppdaget av qRT PCR. p < 0,0005, n = 3, tosidige student t-test, feilfelt er standardavvik. Dette tallet har blitt endret fra Takahashi et al.15. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: skjematisk av SINEUP semi-automatisert bildeanalyser. Dag 1: Frø celler av interesse i en 24 godt-plate. Dag 2: Transfect GFP og SINEUP-GFP. Dag 3: Analysere effekten av SINEUPs ved å måle GFP integrert intensitet. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: høy gjennomstrømming analyse av oversettelse opp-regulering av SINEUP-GFP. (A) sammenligning av GFP fluorescens mellom kontrollen og SINEUP-GFP transfekterte celler15. Skala bar = 2 mm. (B) GFP integrert intensitet var normalisert til total-celle tall telles etter kjernefysiske farging med Hoechst 33342. p < 0,0005, n = 3, tosidige student t-test, feilfelt er standardavvik. FOV: synsfeltet. Dette tallet har blitt endret fra Takahashi et al.15. Klikk her for å se en større versjon av dette tallet.

Discussion

Vi beskrevet her en protokoll for å forbedre spesielt protein produksjon av et mål mRNA ved hjelp av en sinus-som inneholder ikke-koding RNA, kalt SINEUPs. Som et representativt eksempel er optimal syntetisk SINEUP-GFP vist å opp-regulere oversettelsen av GFP mRNA 2,6 målt ved Western blot analyse.

Utforme en optimal BD er avgjørende for å sikre SINEUP spesifisitet og styrke (omfanget av protein opp-regulering). Tidligere vi vist 17 BDs av SINEUP-GFP av Western blot analyse15 og fant at optimal BD overlapper august-KOZAK sekvensen av GFP mRNA, men ikke kan være tilfelle med andre mRNAs og bør kontrolleres for hvert enkelt tilfelle. En annen uavhengig gruppe også vist BD bruker en annen metode31. Som screening mange BDs kan være ganske tidkrevende og tungvint, innført vi en høy gjennomstrømming SINEUP oppdagelsen metoden her. Denne metoden måler relative endringer i GFP integrert tetthet i SINEUP transfekterte-celler i forhold til kontrollen vektor transfekterte-cellene. For å sikre at celler i en bestemt godt av en kultur plate er transfekterte like og GFP signalet er ikke konsentrert til bare et bestemt område av brønnen, er det svært viktig å distribuere cellene like i brønnene i trinn 2.1. For dette formålet, forsiktig riste platen 10 ganger og tilbake (↑↓) etter seeding cellene i en ren benk og gjenta i 5% CO2 inkubator før inkubasjon.

Et annet viktig skritt er beregningen av protein konsentrasjon i trinn 3.3. Feilberegninger her kan føre til lasting av en feilaktig mengde protein under Western blot analyse, dermed hindre oppdagelsen av små endringer i protein uttrykk av noen av de svake SINEUPs eller generere falske positiver fra overbelastning. Det anbefales å fersk forberede protein standardkurven hver gang, sørge for at like mye standarder og protein prøver måles i trinn 3.3.3. Protokollen beskrevet her fokuserer på SINEUP-GFP, men Western blot analyse kan brukes for alle mål mRNA rundt. Den inkubasjonstiden og konsentrasjonen av antistoffer skal være optimalisert for hvert mål å få det beste resultatet.

En av de unike funksjonene til SINEUPs er at målet-mRNA uttrykk nivå forblir upåvirket. Det er viktig å behandle RNA med DNase å unngå deteksjon av transfekterte SINEUPs og genomisk DNA ved qRT PCR. SINEUP RNAs og mRNA måluttrykk bør måles ved qRT PCR å bekrefte suksessen til både hva og SINEUP aktivitet. SINEUPs inneholder en sinus rekkefølge, som er over både menneskelige og mus genomer. For å unngå ikke-spesifikk SINUSEN sekvenser, anbefales det ikke å designe qRT PCR primere for sinus sekvensen.

Vi brukte humane cellelinjer i denne protokollen, men SINEUPs er effektiv i cellen linjer fra flere ulike arter12,13,14,18,19. Celle kultur og hva vilkårene kan endres etter ulike linjer som disse opprettholde transfection effektivitet av SINEUP vektorer. Videre kan alternative metoder for RNA utvinning, cDNA syntese og protein konsentrasjon kontroll anvendes, gitt at de bevare nødvendig RNA og protein kvaliteten for qRT PCR og Western blot analyse. Mens vi brukte en bestemt høy gjennomstrømming mikro-og cytometer, som aktivert påvisning av GFP fluorescens over hele brønnen, kan andre cytometers med en lignende rekkevidde være brukte31. Det skal bemerkes at hvis distribusjon av celler og hva er like gjennom en godt, så det ikke er nødvendig å skanne hele brønnen for GFP fluorescens: halvparten eller en fjerdedel av en godt kan være nok til å skjelne SINEUP effekten avhengig av eksperimentet Al ferdigheter.

Etablere en høy gjennomstrømming SINEUP oppdagelsen protokollen tillater samtidig screening av flere BDs målretting en gitt mRNA i kulturperler celler. Dette er viktig som reglene som styrer optimal målretting av BD er fortsatt uklart. Slike en multipleks screening systemet gir omfattende testing av mange SINEUPs mot ulike gener, nyttig for målretting flere gener involvert i en bestemt signalveien for eksempel. Videre kan det bli benyttet for å utvide søket etter effektive SINEUPs rettet mot flere mRNAs, designe forskjellige SINEUP BDs rundt august-Kozak regionen (se figur 1), co transfecting full lengde målet mRNAs (5ʹ UTR-CD-3ʹ UTR) smeltet sammen med GFP mRNA i kulturperler celler å finne optimal SINEUPs, og senere testing BD kandidater mot endogene mRNA i kulturperler celler og i vivo modell dyr, mennesker og mus til andre dyre- og plantelivet arter.

Dette screening er veldig rask. Vi trenger ikke å fikse og samle celler, men trenger bare å plassere levende celle kultur plate i tenkelig maskinen. Vi foreslår å bruk denne høy gjennomstrømming screening protokollen å velge optimal BDs av SINEUPs og vurdere potensielle kandidater ved Western blot analyse. Utvalgte kandidater med optimal BDs kan dermed brukes til å øke antistoff produksjon18,19,21. Foreløpig vokser feltet RNA terapeutiske dramatisk. For eksempel er siRNA, ASO, mRNA og CRISPR RNA terapier, viden ansatt til å styre mRNA uttrykk for deres respektive målene9,32. I denne sammenheng, SINEUPs er i sin barndom, men så langt ingen av de studerte SINEUPs endret uttrykk for målet mRNAs. I tillegg SINEUPs ikke Rediger målrette mRNA, men bare opp-regulere oversettelse av mRNA. Videre kan tap-av-funksjon sykdommer som følge av haploinsufficiency bli målrettet av SINEUP terapi, oppnå en 2-fold induksjon av mangelfull protein17,33. Selv om off-målet effekter trenger videre studier, målrette SINEUPs potensielt og spesifikt en enkelt, uttrykte mRNA med en utfyllende sekvens BD.

En begrensning av denne høy gjennomstrømming protokollen er at den ikke passer til skjermen BDs av SINEUPs i vivo musen modeller fordi protokollen tiltak GFP integrert intensitet bare. Som SINEUPs er naturlig antisense lncRNAs som fungerer post-transcriptionally, kan ikke de brukes når målet mRNA mangler i cellene eller vevsprøver.

SINEUPs kan imidlertid brukes til gevinst-av-funksjon studier, å forbedre antistoffproduksjon, og som en RNA therapy å opp-regulere uttrykk for mangelfulle proteiner i størrelsesorden 1,5-3.0-fold. Metodene som er beskrevet her presenterer en guide og oppdage SINEUP-indusert oversettelse forbedring av ønsket mRNA og gir et nytt verktøy for post-transcriptional gene regulering.

Disclosures

Tilsvarende forfatter Piero Carninci er en av grunnleggerne av TransSINE teknologiene Co Ltd som inneholder immaterielle arkivert patent (EP2691522A4 og JP2017169573A), og gitt patent (US9353370B2) SINEUP teknologi.

Acknowledgments

Denne studien var delvis støttet av grunnleggende vitenskap og plattform teknologien Program for nyskapende biologisk medisin, no. 17 er 0301014, fra Japan Direktoratet for medisinsk forskning og utvikling (AMED), forskningsstipend fra MEXT til RIKEN senteret for livet Vitenskapen teknologiene og et forskningsstipend fra MEXT til RIKEN IMS. Vi takker medlemmer av det PC og SINEUP nettverk (SISSA, Universitetet østlige Piemonte og RIKEN) for tankevekkende diskusjoner. Vi takker Dr. Matthew Valentine for korrekturlesing.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
Cellen basert analyser av SINEUP ikke-koding RNAs som spesielt kan forbedre mRNA oversettelse
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter