Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Celular basado en análisis de SINEUP no-codificación RNAs que específicamente pueden mejorar la traducción del mRNA

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs son sintético antisentido no-codificación RNAs, que contienen un dominio de unión a (BD) y un dominio efector (ED) y para arriba-regulan la traducción de mRNA de destino. Aquí, se describen métodos de detección de SINEUPs en líneas de cultivos celulares, análisis de su actividad de promoción de la traducción por Western-blot y un alto rendimiento semi-automático sistema de imagen.

Abstract

Proteína blanco es de importancia no sólo para el estudio de los procesos biológicos, sino también para aplicaciones terapéuticas y biotecnológicas. Aquí, presentamos un método para selectivamente para arriba-regular la expresión de la proteína de los genes deseados en células cultivadas mediante sintético antisense no-codificación RNAs conocidos como SINEUPs. Este control positivo de la expresión génica es a nivel postranscripcional y ejercida por un invertido corto elemento nuclear entremezclado (seno) repetición al final 3ʹ de SINEUPs que contiene su dominio efector (ED). SINEUPs puede atar específicamente a cualquier ARNm codificante de la proteína de elección a través de su dominio (BD), una región diseñada para complementar la secuencia dentro de la región no traducida (UTR 5ʹ) de 5ʹ y en el comienzo codon del mRNA. SINEUPs objetivo específico diseñados de esta manera son transfectados a cultivos de células y proteínas y el ARN se extracción para análisis posteriores, generalmente la transfección tras 24-48 h. Para arriba-regulación de la proteína inducida por el SINEUP se detecta por análisis de Western-blot y expresión de RNA se mide mediante la transcripción reversa cuantitativa en tiempo real PCR. Hemos observado que el diseño de BD es crítica para lograr una óptima actividad SINEUP y prueba diferentes tamaños de BD y posiciones con respecto a la del codón de inicio de la meta que ARNm se recomienda. Por lo tanto, se describe aquí un semi-automatizado método de imagen de alto rendimiento basado en la detección de fluorescencia que puede ser implementada a blanco que mRNA fusionada con proteína verde fluorescente (GFP). SINEUPs específicamente mejorar la traducción dentro de la gama fisiológica normal de la célula, sin alterar el nivel de transcripción. Este método ha sido empleado con éxito contra una gama de objetivos endógenos y exógenos, en una amplia variedad de humano, ratón y líneas celulares de insectos junto con sistemas in vivo. Por otra parte, SINEUPs se han divulgado para aumentar la producción de anticuerpos y trabajar como un terapéutico contra haploinsufficient genes del RNA. La naturaleza versátil y modular de SINEUPs les hace una herramienta adecuada para gene-específico control traduccional.

Introduction

En la era post-genómica, muchos conocimientos se han obtenido en los papeles reglamentarios gene de codificación no transcritos antisentidos debido al desarrollo de tecnologías de secuenciación de próxima generación1,2,3 y herramientas de edición de gene. Esta categoría de transcripciones, que fue anteriormente considerado como "basura transcripcional", se ha establecido como un jugador clave de la regulación genética. Transcritos antisentidos se divulgan para modular la cromatina y el control de estabilidad y la expresión de su cognado proteína-codificación sentido mRNA4,5. En la mayoría de los casos, este modo de regulación es negativa y transcritos antisentidos silenciar a sus homólogos de sentido a través de ARN-ARN interacciones6,7. Este rasgo de transcritos antisentidos naturales ha sido utilizado para regular a la baja deseada genes en forma de sintético ARN interferente pequeño (siRNA), microARN (miARN) y oligos antisentido (ASO)8,9,10 ,11 dejando un vacío tecnológico para dirigidos para arriba-regulación del gene.

Un intrigante estudio cambió la perspectiva del campo de RNA antisentido demostrando que antisense largo no-codificación RNAs (como lncRNAs) de los genes Uchl1 (ubiquitina C-terminal hidrolasa L1) y Uxt (transcripción ubicuo expresada) positivamente regular la traducción de su cognado sentido mRNA nivel postranscripcional en ratones12. Al final de la 5ʹ de estos lncRNAs se solapa con varias bases en la región sin traducir del 5ʹ (5ʹ UTR) de sus correspondientes transcripciones de sentido, y no superpuestas 3ʹ final contiene una repetición invertida de un retrotransposón pertenecientes a corto entremezclado nuclear familia de elemento (seno). Curiosamente, encontramos que la principal fuerza impulsora detrás de este para arriba-regulación traduccional es repetir el seno integrado y no se limita a ratón que seno repite solamente. Humano Alu repetir que contienen como lncRNAs también mejorado la traducción de mRNAs de sentido objetivo, reforzando la idea de una nueva clase de antisentido reguladora basada en seno no-codificación RNAs, apropiadamente llamado SINEUPs13. Estudios recientes demostraron que el potencial de SINEUPs naturales se conserva en SINEUPs sintéticos diseñados para actuar específicamente varios genes endógenos y exógenos de14,15. SINEUPs tiene dos características importantes: primero el "dominio obligatorio" (BD) que generalmente es la región del extremo de 5ʹ complementaria a la secuencia que comprende la primaria comenzar codón de un ARNm codificante de la proteína y en segundo lugar el "dominio efector" (ED) ya que incorpora un Inverted repeat del seno que es un requisito previo para el SINEUP función14 (figura 1). SINEUPs se puede personalizar para el diseño de una BD dirigidos específicamente a un gen de elección. Esto entonces se puede aprovechar para analizar la función de un gen particular involucrado en una vía biológica, como una mejor alternativa a una estrategia convencional de sobreexpresión de mRNA. Además, esta versátil herramienta puede aplicarse para aumentar la producción de anticuerpos y como una droga para tratar enfermedades de haploinsufficient causadas por dosis insuficiente de proteínas funcionales16,17,18, 19,20,21.

Las ventajas de la tecnología SINEUP son múltiples. No altera la expresión de la meta a nivel transcripcional. BDs más proporcionan más especificidad a SINEUPs, mientras que no inducen una respuesta de estrés dependiente de dsRNA15. La inducción de la proteína se mantiene dentro del rango fisiológico normal de la célula, previniendo cualquier efecto adverso debido a la expresión de la proteína aberrante o excesivo. SINEUPs son compatibles con una amplia variedad de ratón, humano, y hámster cultiva líneas de células, por ejemplo, HEK293T/17 HepG2, HeLa, CHO, MN9D y muchos más12,13,14,15,18 ,19. SINEUPs pueden dirigirse eficientemente genes endógenos, transitoriamente overexpressed genes y genes tagged bandera o fusión de luciferasa, eliminando la necesidad de gene-específica de anticuerpos14,18. El análisis básico de SINEUP requiere cultivo celular rutina, transfección, electroforesis del gel de la sulfato-poliacrilamida de sodio dodecyl (SDS-PAGE), instrumentos de (qRT-PCR) reacción en cadena reversa de polimerasa de transcripción cuantitativa en tiempo real y configuración, y experiencia puede ser adquirida en poco tiempo.

Aquí, describimos un método para dirigir los genes con SINEUPs sintéticos para arriba-regular la traducción, un efecto contrario a otras tecnologías tales como RNA interferencia9 y ASO gapmers11,22,23. Un método ampliamente utilizado para la activación del gen RNA-dirigido es agrupada regularmente otro corto palindrómico basada en repeticiones de activación (CRISPRa), donde se activa la expresión génica a nivel transcripcional24. Este método, aunque sencillo y rápido, requiere múltiples única guía RNAs (sgRNAs) contra el mismo gen para mayor eficiencia, aumentando así las posibilidades de enlace objetivo25. Además, la enzima dominante del sistema CRISPRa, el catalítico muerto CRISPR proteína 9 (dCas9) tiene especificidad de unión baja y sgRNAs dirigidos a regiones promotoras bidireccional pueden no específicamente para arriba-regular cerca genes25. Por el contrario, SINEUPs se unen a mRNA en una región de enlace único con alta especificidad y no afectan la expresión de los genes cercanos. Discutimos los pasos básicos involucrados en el diseño SINEUP, transfección, proteína y análisis de expresión de RNA. Además, presentamos un semiautomático, de alto rendimiento sistema de imagen para múltiples SINEUPs de la pantalla a la vez, que es útil para la detección de SINEUPs óptima.

Protocol

1. diseño de BDs de SINEUP construye para destino mRNAs

  1. Ver transcripción partida sitio (SAT) y traducción a partir de mRNAs de blanco en las células de interés. Adquirir datos de la TSS de proyectos el ENCODE y FANTOM (cap análisis de expresión génica, la jaula) (ZENBU: http://fantom.gsc.riken.jp/zenbu/).
  2. Abrir el navegador, búsqueda de genes de interés y comprobar TSS por picos de jaula.
  3. Consultar el análisis del ejemplo de células y tejidos específicos TSS de Parkinson enfermedad proteína 7 (PARK7) mRNA se muestra en la figura 2.
  4. Diseño de secuencias de BD de varias longitudes correspondientes a 40 bases bases río arriba y 32 aguas abajo de la primera metionina (AUG), 72 nt en total.
  5. Custom ordenar el BDs diseñado en vector de expresión SINEUP (véase Tabla de materiales).
    Nota: Herramienta de búsqueda de alineamiento local básica (BLAST) para evitar efectos off-target26para comprobar la especificidad de secuencia.

2. cultura y SINEUP transfección de la célula

  1. Células de semillas de interés en una placa de 6 pozos o placa bien 24 por 24 h antes de la transfección de SINEUPs. En el caso de la línea de células de riñón embrionario humano (HEK293T/17) (véase Tabla de materiales), semillas de 0,5 x 106 células por pocillo de una placa de la pozo o 1,5 x 105 6 células por pozo de una poly-D-lisina cubierto bien 24-placa (véase Tabla de materiales). Llega a ser confluente de 70% después de 24 h.
  2. Después de 24 h, cambiar el medio a 1,5 mL de medio fresco para una placa de 6 pozos o 0,4 mL de medio fresco para una placa de 24 pozos. En el caso de SINEUP-GFP, transfectar 0,6 μg de pEGFP-C2 (véase Tabla de materiales) y 3.4 μg de SINEUP-GFP en un pozo de un ng 6 de placa de la pozo o 130 de pEGFP-C2 y 670 ng de SINEUP-GFP en un pozo de una placa bien 24 con el reactivo de transfección (10 μL en 6 μ placa de la pozo y 3 L en la placa de 24 pocillos) siguiendo las instrucciones del fabricante (véase Tabla de materiales) e incubar a 37 ° C en un incubador de 5% de CO2 durante 24 h.
  3. Lavar las células con 2 mL de solución salina buffer fosfato (PBS) (NaCl de 37 mM, 8 mM Na2HPO4, 2,6 mM KCl y 1,5 mM de KH2PO4) en cada pocillo de una placa de 6 pozos o 0.5 mL de PBS en cada pocillo de una placa de 24 pozos. Sólo para poly-D-lisina recubierto 24 bien placa 25 μl de 0.05% en peso por volumen tripsina, incubar en una incubadora 5% CO2 por 5 min y añadir 275 μl de medio de células por pocillo. En el caso de placa de pozos 6, añadir 2 mL de PBS en cada pocillo. Pipeta hacia arriba y hacia abajo para la cosecha 3/4 de las células (1,5 mL para una placa de 6 pozos) o 225 μL para una placa de 24 pozos de 1 pozo para extracción de proteínas (ir a protocolo 3 para la extracción de la proteína) y 1/4 de las células (0,5 mL en una placa de 6 pozos) o 75 μL para una placa de 24 pozos para Extracción de RNA y centrifugar a 6.000 xg durante 5 min a 4 ° C (ir al paso 5 para extracción de RNA).
    Nota: Analizar el efecto de SINEUP-GFP en un poly-D-lisina recubierto 24-placa de pozos por proyección de imagen. Vaya al paso 7 (análisis de imágenes).

3. extracción de proteínas

  1. Cuidadosamente aspirar 1,5 mL de PBS y añadir 140 μl de solución de lisis (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% (p/v) Tritón, pirofosfato de sodio de 2,5 mM, 1 mM β-glicerofosfato, 1 mM Na3VO4 1 μg/mL leupeptin y 0,005% (w/v) phenylmethylsulfonyl fluoruro (PMSF)) (véase Tabla de materiales) para un 6 μl placa de la pozo o 60 para una placa bien 24 a los gránulos de la célula.
  2. Mezclar mediante pipeteo y homogeneizar girando a baja velocidad por 1 h a 4 ° C. Recoger sobrenadante por centrifugación a 14.000 x g por 10 min a 4 ° C.
  3. Compruebe la concentración de proteína por análisis colorimétrico (véase tabla de materiales). Preparar todas las reacciones a temperatura ambiente.
    1. Preparar la dilución de 5 - 6 veces de la proteína de albúmina de suero bovino (BSA) en agua ultrapura con concentraciones que van desde 0.2-1.5 mg/proteína mL. Preparar estándares frescos cada vez.
    2. Preparación reactivo de trabajo Aʹ mezclando 1 mL de reactivo (solución de tartrato alcalino de cobre) con 20 μl del reactivo S (solución de surfactante).
    3. Carga de 5 μl de agua (control negativo), estándar de BSA (proteína estándar y positivo control) o muestra de proteína en cada pocillo de una placa de 96 pozos.
    4. Añada 25 μl del reactivo Aʹ en cada pozo. Cuidadosamente añadir 200 μL de reactivo B (reactivo de Folin) por evitando así cualquier formación de burbujas. Cubra la placa con papel de aluminio y esperar 5-10 minutos.
    5. Medir la absorbancia de proteínas a 750 nm con un espectrofotómetro. La absorbancia es estable durante al menos 1 h.
    6. Preparar la curva estándar por trazado concentraciones de proteína estándar de BSA (mg/mL) en el eje x y sus respectivas absorbancias en el eje y. Calcular la concentración de proteína de la muestra aplicando la ecuación de la curva estándar.
      Nota: Hacer una pausa en el protocolo en este paso si es necesario o vaya al paso 4. Para el almacenamiento a largo plazo, complemento congelar muestras de proteína en nitrógeno líquido y conservar a-80 ° C.

4. separación de proteínas por SDS-PAGE y detección de proteínas de la blanco con anticuerpos (Western-blot Analysis)

  1. Añadir un volumen de 2 x carga del tinte (0.1 M Tris-HCl (pH 6.8), 4%, glicerol al 20%, 1,42% 2-mercaptethanol y SDS 0,2% azul de bromofenol) para cada volumen de la muestra de proteína de paso 3.3. Calentar a 90 ° C durante 5 minutos y enfriar inmediatamente en hielo durante 1 minuto.
  2. Carga 10-20 μg de muestras de proteínas en gel de poli-acrilamida SDS 10% y se separa en 100-150 V) (véase Tabla de materiales).
  3. Transferencia de proteína del gel a la membrana de nitrocelulosa de 0,45 μm (véase Tabla de materiales) por instrumento de transferencia semi seco con tampón de transferencia (25 mM Tris, glicina 192 mM y 20% de metanol) en 25 V durante 30 minutos.
  4. Añadir solución de bloqueo (leche en polvo sin grasa 5% en buffer de x TBST 1 (137 mM NaCl, 20 mM Tris-HCl (pH 7.6), 0,1% Tween-20)) (véase Tabla de materiales) al recipiente hasta que la membrana está totalmente empapado e incubar a temperatura ambiente durante 30 minutos.
  5. En el caso de SINEUP-GFP, hibridar la proteína con anticuerpos anti-GFP (diluido 1: 2000 en solución de bloqueo) (véase Tabla de materiales) por la membrana por 30 min con agitación a temperatura de incubación. Como una proteína de control interno, detectar la proteína β-actina por cruzamiento por hibridación con el anticuerpo Anti-β-actina (diluido 1: 2000 en solución de bloqueo) (véase Tabla de materiales) por 30 min con agitación a temperatura ambiente.
  6. Añadir 1 x TBST buffer al recipiente hasta que la membrana esté completamente empapada y lavar por 5 min a temperatura ambiente. Repetir el lavado dos más veces (un total de tres lavados).
  7. Hibridar la proteína GFP a diluido (1: 1000 en solución de bloqueo) contra conejo anticuerpos conjugados con peroxidasa de rábano (HRP) e hibridar la proteína β-actina a diluido (1: 1000 en solución de bloqueo) del anticuerpo anti-ratón conjugado con HRP en la membrana por 30 min con agitación a temperatura ambiente.
  8. Lavar la membrana con 1 x TBST buffer por 5 min a temperatura ambiente. Repetir el lavado dos más veces (un total de tres lavados).
  9. Mezclar un volumen igual de reactivo de detección quimioluminescencia realzada de HRP (ECL) 1 y 2 (véase Tabla de materiales). Transferir la membrana a la combinación de reactivo 2 mL ECL, cubrir la caja con papel de aluminio y deje incubar durante 1-2 min a temperatura ambiente. Cuidadosamente retire la membrana de la combinación de reactivo de ECL y exponer con una luminiscencia de instrumento.

5. RNA extracción y tratamiento de DNasa

  1. El extracto siguiente de RNA total estándar de protocolo para extracción de RNA de las células cultivadas en un monocapa27 o como alternativa utilizar una extracción de RNA comercialmente disponible kit (véase Tabla de materiales). Para indicar en Resumen, añadir ningún reactivo de lisis monofásicos (MLR) de isotiocianato de guanidina y fenol a las células cosechadas en el paso 2.3 (1 mL MLR por 5 millones de células)27.
    Nota: Cambiar guantes con frecuencia. Utilizar reactivos libres de RNasa y diethylpyrocarbonate (DEPC)-tratado de artículos de plástico y vidrio para evitar la degradación del RNA. Hacer una pausa en el protocolo en este paso si es necesario. Tienda extrae RNA a-80 ° C.
  2. Añadir 0.1 volumen de 10 x buffer de DNasa y 2 U de la ADNsa al RNA purificado del paso 5.1 (véase Tabla de materiales).
  3. Ajuste el volumen de reacción de 50 μL con agua libre de nucleasas y mezclar suavemente. Incubar a 37 ° C durante 30 minutos.
  4. Añadir 0.1 volumen de reactivo de inactivación de DNasa resuspendió y mezclar bien (véase Tabla de materiales). Incubar por 5 min a temperatura ambiente con agitación suave.
  5. Centrifugar a 10.000 x g para la transferencia de s. 90 el sobrenadante (libre de ADN ARN) a un tubo de 1,5 mL fresco libre de Rnasa. Tenga cuidado de no tocar el sedimento porque esto puede causar arrastre de DNasa que es molesto para los pasos posteriores.
  6. Cuantificar RNA midiendo un260 y una relación de280 260/A (RNA puro, la gama es el 1.8-2.0) en un espectrofotómetro UV.

6. primera Strand cDNA síntesis y análisis de qRT-PCR

  1. Realizar primera strand cDNA síntesis siguiendo un protocolo de síntesis de cDNA estándar como a continuación (ver tabla de materiales).
    1. Mezcle 0.75 μm oligo dT la cartilla, 4,3 μm primer aleatorio, dNTPs (10 mM) con 200-500 ng RNA total (de pasos 5-8) en 10 μl de volumen de reacción total. Incubar a 65 ° C por 5 min y vuelva a colocar inmediatamente en hielo.
    2. De la mezcla buffer de transcriptasa inversa de x 1, 1 inhibidor de la U de Rnasa, 10 U de transcriptasa inversa y añadir a 10 μl mezcla RNA cartilla de 6.1.1.
    3. Establecer el volumen total de reacción de 20 μl con agua libre de nucleasa si es necesario. Mezclar suavemente e incubar la mezcla de reacción a 30 ° C por 10 min, luego a 42 ° C durante 60 min y finalmente a 95 ° C por 5 min inactivar la enzima. Enfríe los tubos en hielo.
      Nota: Descongelar las muestras de RNA y todos los reactivos en el hielo y preparar la mezcla de reacción sobre hielo. Si objetivo RNAs sólo polyA RNAs, use sólo cartilla de oligo dT (2,5 μm). Pausa del Protocolo, si es necesario. Almacenar el cDNA sintetizado a-20 ° C.
  2. Realizar qRT-PCR en triplicado técnica (n = 3, Cт desviación estándar > 0.2) y biológicos repeticiones (n ≥ 3) con 1 μl de 10 ng cDNA, 0.4 μL de primer revés (10 μm), 0.4 μL de primer avance (10 μm), 10 μl de solución de la mezcla de ADN polimerasa , 0.4 μL de DNA de doble cadena manchas tinte, 10 μl de agua libre de nucleasas (volumen de reacción fue de 20 μl) para detectar productos de la PCR utilizando las siguientes condiciones; Mantenga la etapa (1 ciclo) de 30 s a 95 ° C, ciclismo (40 ciclos) etapa 5 s a 95 ° C y durante 30 s a 60 ° C, etapa de la curva del derretimiento. Ejemplos de cartilla son para Gapdh_Fw humano: TCTCTGCTCCTCCTGTTC, Gapdh_Rv humano: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, GFP_Fw SINEUP: CTGGTGTGTATTATCTCTTATG y GFP_Rv SINEUP: CTCCCGAGTCTCTGTAGC. Ver la tabla de materiales. Analizar la expresión cuantitativa de RNA con 2- ∆∆Ct ± SD método28.

7. Análisis de SINEUPs por el método de detección semiautomática de la proyección de imagen

  1. Lavar las células con 0.5 mL de PBS para un pozo de una placa de 24 pozos.
  2. Añadir 2.0 μg de Hoechst 33342 (véase Tabla de materiales) (disolver en 500 μL de PBS) a cada pozo de la placa de 24 pozos e Incube las células a 37 ° C por 20 min teñir el núcleo.
  3. Medida Hoechst manchado a las células para contar el número total de células en un máximo de emisión azul de 461 nm y la intensidad de fluorescencia verde para contar el número de células positivas de GFP en un máximo de emisión verde de 510 nm usando un citómetro () imagen de micro pozos de alto rendimiento Véase Tabla de materiales). Analizar el efecto para arriba-regulación de proteínas de las SINEUPs mediante el cálculo de intensidad GFP integrado, que es la suma de todas intensidades de píxeles muestra señal en segmentos objetos calculados para cada canal, usando proyección de imagen de software29.
  4. Cosecha de las células para controlar la expresión de RNA (de nuevo a los pasos 5 y 6).

Representative Results

SINEUP-GFP es un SINEUP sintético que contiene tanto un óptimo BD (-28 / 4 se superponen al mRNA GFP) y un ED (seno B2 de AS -Uchl1invertida) que puede para arriba-regular traducción del mRNA GFP (Figura 3A y 3B) sin cambiar la expresión de GFP mRNA (figura 3 y 3D). Para la pantalla BDs y EDs de SINEUPs óptimo, hemos desarrollado un protocolo de análisis de imagen semiautomático que mejoraron el tiempo de detección y aumentaron el número de muestras al mismo tiempo ser evaluada comparada con una convencional de análisis de Western blot15. Como se muestra en la figura 4, este sistema de proyección de imagen de alto rendimiento tomó 3 días (Western-blot análisis tomaron dos semanas para 48 SINEUPs). Habiendo demostrado que GFP SINEUP aumenta traducción de GFP, detectamos GFP integrada intensidad de la citometría de imagen. La BD óptimo de SINEUP-GFP indujo un 1.4-fold aumento en la expresión de la proteína GFP. Aunque se observó compresión de señales de 2.6-fold (análisis de Western blot, ver Figura 3A) a 1.4-fold (imagen análisis, ver figura 5), la diferencia puede ser debido a la calibración de la imagen software de instrumento. Sin embargo, se detectaron niveles significativamente más altos de la fluorescencia de GFP con respecto al testigo (figura 5A y 5B).

Figure 1
Figura 1: diseño básico de los SINEUPs sintéticos. BD = dominio obligatorio para llegar a mRNA, ED = dominio efector que contiene una secuencia senoidal invertida. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Transcripción a partir de sitios (TSSs) de proteína humana de la enfermedad de Parkinson 7 (PARK7) mRNA en tejidos específicos y células como jaula análisis. (A) A instantánea mostrando un resultado de búsqueda de TSS para humanos mRNA PARK7 utilizando una integración de datos ómicos y visualización interactiva sistema30. La flecha verde horizontal en la pista de Entrez gene hg19 indica la posición genomic de la referencia humana PARK7 mRNA y las barras verdes verticales en el FANTOM5 jaula 1 y 2 pistas indican la suma de TSSs (medido como transcripciones por millones (tpm)) de 1.829 tipos de células y tejidos. (B) acercamiento de la región marcada de la TSS en panel A (escala 1/354: 35,4 kb a 100 bp). Gris sombra zona en la fase de FANTOM5 jaula pistas 1 y 2 indica el TSS de 6 células específicas de la total 1.829, que figuran en la parte inferior de la figura. Los números (11.369 4.998, 4.304, 3.509, 3.477 y 3.055) correspondientes a estas células mencionadas indican transcripciones por millones para cada celda específica en la gris sombra de posiciones del TSS. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Análisis de Western blot confirma para arriba-regulación de la traducción por GFP SINEUP. (A) SINEUP-GFP fue examinado por Western-blot con anticuerpos anti-GFP. (B) resultados se normalizaron a la intensidad de la banda de proteína de β-actina. MRNA GFP (C) y (D) SINEUP RNAs expresión fueron detectados por qRT-PCR. p < 0,0005, n = 3, la prueba de la t de student dos colas, barras de error son de desviación estándar. Esta figura ha sido modificada desde Takahashi et al.15. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: esquema de análisis semiautomático SINEUP. Día 1: Semilla de las células de interés en una placa de 24 pozos. Día 2: Transfectar GFP y SINEUP-GFP. Día 3: Analizar el efecto de SINEUPs por la medición de intensidad GFP integrado. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Análisis de alto rendimiento de para arriba-regulación de la traducción por GFP SINEUP. (A) comparación de la fluorescencia de GFP entre control y SINEUP-GFP transfectada las células15. Barra de escala = 2 mm. (B) GFP intensidad integrada se normalizaron al número celular total contado por tinción nuclear con Hoechst 33342. p < 0,0005, n = 3, la prueba de la t de student dos colas, barras de error son de desviación estándar. FOV: campo de visión. Esta figura ha sido modificada desde Takahashi et al.15. Haga clic aquí para ver una versión más grande de esta figura.

Discussion

Describimos aquí un protocolo para mejorar específicamente la producción de proteínas de un objetivo de ARNm por medio de un seno que contiene ARN no codificante llamada SINEUPs. Como un ejemplo representativo, sintético óptimo SINEUP-GFP se muestra para arriba-para regular la traducción del mRNA GFP 2.6-fold según lo medido por análisis de Western blot.

Diseño de una BD óptimo es crucial asegurar SINEUP especificidad y potencia (medida de proteína para arriba-regulación). Anteriormente, nos proyectó 17 BDs de SINEUP-GFP por Western-blot análisis15 y encontró que el BD óptimo superpone con la secuencia de KOZAK AUG del ARNm de la GFP, aunque puede no ser el caso con otros mRNAs y deben ser verificado para cada caso. Otro grupo independiente también proyectó la BD utilizando un método diferente de31. Como muchas BDs de detección puede ser bastante lentos y engorrosos, presentamos aquí un método de detección de alto rendimiento SINEUP. Este método mide los cambios relativos en densidad GFP integrado en SINEUP transfected las células en comparación con el control vector transfected las células. Para asegurar que las células en un determinado pozo de una placa de cultivo son transfectadas igualmente y señal GFP no se concentra en sólo una región determinada del pozo, es muy importante distribuir las células igualmente en los pozos en el paso 2.1. Para este propósito, suavemente agitar la placa 10 veces ida y vuelta (↑↓) después de la siembra de las células dentro de un banco limpio y repita en la incubadora 5% CO2 antes de comenzar la incubación.

Otro paso fundamental es el cálculo de la concentración de proteína en el paso 3.3. Errores de cálculo aquí pueden llevar a la carga de una cantidad errónea de proteínas durante el análisis de Western blot, por lo tanto prevenir la detección de pequeños cambios en la expresión de la proteína por algunos de los SINEUPs débiles o generando falsos positivos de sobrecarga. Se recomienda recién preparar la curva estándar de proteína cada vez, asegurándose de que se miden cantidades iguales de los estándares y las muestras de proteína de paso 3.3.3. El protocolo descrito aquí se centra en SINEUP-GFP, pero análisis de Western-blot se puede utilizar para cualquier objetivo de ARNm de interés. El tiempo de incubación y la concentración de anticuerpos deben ser optimizados para que cada objetivo obtener el mejor resultado.

Una de las características únicas de SINEUPs es que el nivel de expresión de mRNA de destino permanece invariable. Es importante tratar de RNA con DNasa para evitar la detección de SINEUPs transfected y ADN genómico por qRT-PCR. SINEUP ARN y la expresión del mRNA objetivo deben medirse por qRT-PCR para confirmar el éxito de transfección y actividad SINEUP. SINEUPs contienen una secuencia sinusoidal, que es abundante a lo largo de ambos el ser humano y el genoma del ratón. Para evitar la detección de la no específica de secuencias de seno, no se recomienda diseñar cartillas de qRT-PCR de la secuencia del seno.

En este protocolo hemos utilizado líneas de células humanas, pero son eficaces en un número de líneas celulares de varios diferentes especies12,13,14,18,19SINEUPs. Las condiciones de cultura y de la transfección de células pueden ser modificadas según diferentes líneas celulares como estos mantienen la eficiencia de la transfección de los vectores SINEUP. Por otra parte, métodos alternativos de extracción de RNA, síntesis de cDNA y control de concentración de proteína se pueden emplear, dado que conservan la calidad de ARN y proteína requerida para qRT-PCR y análisis de Western blot. Aunque utilizamos un citómetro de micro-bien específico de alto rendimiento, que permitió la detección de la fluorescencia de GFP en el pozo completo, otros citómetros con una gama de detección similar pueden ser utilizado31. Debe tenerse en cuenta que si la distribución de células y transfección es igual a lo largo de un pozo, entonces no es necesaria para explorar bien todo para fluorescencia de GFP: la mitad o una cuarta parte de la zona de un pozo puede ser suficiente para discernir el efecto SINEUP dependiendo del experimento habilidades de al.

Establecer un protocolo de detección de alto rendimiento SINEUP permite la detección simultánea de múltiples BDs dirigidos a un determinado mRNA en células cultivadas. Esto es importante porque las normas que rigen la orientación óptima en la BD, aún no están claros. Tan complejo sistema permite probar a gran escala de muchos SINEUPs contra diversos genes, útiles para dirigir múltiples genes involucrados en una vía de señalización particular por ejemplo. Además, pueden ser utilizado para ampliar la búsqueda para SINEUPs eficaces contra varios mRNAs, diseñando diferentes BDs SINEUP AUG-Kozak región (ver figura 1), transferencia Co longitud total destino mRNAs (UTR de UTR-CD-3ʹ 5ʹ) fusionado con el mRNA GFP en cultivos de células para encontrar el SINEUPs óptimo y posteriormente pruebas candidatos BD contra ARNm endógeno en células cultivadas y los animales del modelo in vivo, de seres humanos y ratones para otras especies animales y vegetales.

Este protocolo de investigación es muy rápido. No tenemos que arreglar y recoger las células, pero sólo tiene que colocar la vida placa de cultivo en el instrumento de proyección de imagen de la célula. Proponemos utilizar este protocolo de cribado de alto rendimiento para seleccionar BDs óptima de SINEUPs y evaluar a candidatos potenciales por análisis de Western blot. Por lo tanto, los candidatos seleccionados con BDs óptimo pueden aplicarse para aumentar la producción de anticuerpos18,19,21. Actualmente, el campo terapéutico de RNA está creciendo dramáticamente. Por ejemplo, siRNA, ASO, mRNA y terapias CRISPR ARN, se emplean extensamente para el control de la expresión del mRNA de sus respectivos objetivos9,32. En este contexto, SINEUPs están en su infancia, pero hasta ahora ninguno de los SINEUPs estudiados cambió la expresión de los mRNAs de destino. Además, SINEUPs no editar objetivo mRNA, pero solamente para arriba-regular traducción de mRNA. Además, enfermedades de pérdida de función por haploinsufficiency pueden ser objetivo de la terapia SINEUP, lograr una inducción 2 dobleces de la proteína deficiente17,33. Aunque los efectos off-target necesitan ser más estudiados, SINEUPs potencialmente y específicamente como objetivo un mRNA único, expresado con una secuencia complementaria a la BD.

Una limitación de este protocolo de alto rendimiento es que no es adecuado para la pantalla BDs de SINEUPs en modelos de ratón in vivo porque las medidas de protocolo la GFP integran intensidad sólo. Como SINEUPs natural lncRNAs antisentido que actúan post-transcriptionally, no se aplica cuando el objetivo mRNA falta en las células o las muestras de tejido.

Sin embargo, SINEUPs puede aplicarse a estudios de ganancia de función, para mejorar la producción de anticuerpos y como una terapia de RNA para arriba-para regular la expresión de proteínas deficientes dentro de la gama de 1.5-3.0-fold. Los métodos descritos aquí presentan una guía útil para apuntar y detectar realce SINEUP-inducida de la traducción del ARNm deseado y proporcionar una nueva herramienta para la regulación génica post-transcripcional.

Disclosures

El autor Piero Carninci es uno de los fundadores de TransSINE Technologies Co., Ltd. que es propiedad intelectual de patentes archivadas (EP2691522A4 y JP2017169573A) y patente concedida (US9353370B2) para la tecnología SINEUP.

Acknowledgments

Este estudio fue apoyado en parte por la ciencia básica y tecnología plataforma innovadora medicina biológica, no. 17 am 0301014, de la Agencia de Japón para investigación médica y desarrollo (AMED), beca de investigación de MEXT del centro RIKEN para la vida Tecnologías informáticas y una beca de investigación de MEXT a la IMS RIKEN. Agradecemos a los miembros del laboratorio de PC y de la red SINEUP (SISSA, Universidad del Piamonte Oriental y RIKEN) para discusiones de reflexión. Agradecemos al Dr. Matthew Valentine para corrección.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
Celular basado en análisis de SINEUP no-codificación RNAs que específicamente pueden mejorar la traducción del mRNA
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter