Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Cell baserat analyser av SINEUP icke-kodande RNAs som specifikt kan förbättra mRNA Översättning

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs är syntetiska antisense icke-kodande RNAs, som innehåller en bindande domän (BD) och en effektor domän (ED) och uppreglera översättning av rikta mRNA. Här beskriver vi detektionsmetoder för SINEUPs i odlade cellinjer, analys av deras översättning-främja aktivitet av Western-blot och en halvautomatisk hög genomströmning imaging system.

Abstract

Riktad-protein förbättring är av betydelse inte bara för att studera biologiska processer, utan även för terapeutiska och biotekniska tillämpningar. Här presenterar vi en metod för att selektivt uppreglera proteinuttryck av önskad gener i odlade celler med hjälp av syntetiska antisense icke-kodande RNAs kallas SINEUPs. Denna positiva kontrollen av genuttryck är på post-transcriptional nivå och utövas av en inverterad kort interspersed nukleära element (sinus) Upprepa i 3ʹ slutet av SINEUPs som består av dess effektor domän (ED). SINEUPs kan specifikt binder till någon protein-kodning mRNA i val genom dess bindande domän (BD), en region som kompletterar sekvensen inom regionen 5ʹ oöversatta (5ʹ UTR) och runt den start Codonen på mRNA. Mål-specifika SINEUPs utformade på detta sätt är transfekterade att odlade celler och proteiner och RNA extraheras för nedströms analyser, normalt 24-48 h efter transfection. SINEUP-inducerad protein Uppregleringen detekteras av Western-blot analys och RNA uttryck är mätt med realtid kvantitativa omvänd Transkription PCR. Vi har observerat att BD design är avgörande för att uppnå optimal SINEUP aktivitet och att testa olika BD storlekar och ståndpunkter med avseende på den start-kodon målet mRNA rekommenderas. Därför beskriver vi här en halvautomatisk hög genomströmning bildgivande metod baserad på fluorescens upptäckt som kan genomföras till target mRNA smält med grönt fluorescerande protein (GFP). SINEUPs förbättra specifikt Översättning inom normala fysiologiska intervallet av cellen, utan att ändra avskrift målnivån. Denna metod har använts framgångsrikt mot ett spektrum av endogena och exogena mål, i en mängd olika mänskliga, mus och insekt cellinjer tillsammans med invivo system. SINEUPs har dessutom rapporterats öka antikroppsproduktion och arbeta som en terapeutisk mot haploinsufficient gener RNA. Den flexibla och modulära karaktären SINEUPs gör dem ett lämpligt verktyg för gen-specifika translationell kontroll.

Introduction

I Postgenomisk eran, många insikter har fått in i gen reglerande roller av icke-kodande antisense avskrifter på grund av utvecklingen av nästa generations sekvensering teknik1,2,3 och gen-redigeringsverktyg. Denna kategori av avskrifter, som ansågs tidigare vara ”transkriptionell trash”, är nu etablerad som en nyckelaktör för genetiska regleringen. Antisense avskrifter rapporteras att modulera kromatin och kontrollen stabilitet och uttryck av deras cognate protein-kodning känsla mRNA4,5. I de flesta fall, denna förordning är negativa och antisense avskrifter tystnad motsvarigheterna känsla genom RNA-RNA interaktioner6,7. Detta drag av naturliga antisense avskrifter har använts till downregulate önskas gener i form av syntetiska små störande RNA (siRNA), mikroRNA (miRNA) och antisense oligos (ASO)8,9,10 ,11 lämnar ett tekniska tomrum för riktade upp-genreglering.

En spännande studie ändras fältet antisense-RNA perspektiv genom att påvisa att antisense länge icke-kodande RNAs (som lncRNAs) av generna Uchl1 (ubiquitin C-terminal hydrolas L1) och Uxt (ubiquitously uttryckta avskrift) positivt reglera översättning av deras besläktat känsla mRNA på post-transcriptional nivå i möss12. 5ʹ slutet av dessa interspersed som lncRNAs överlappar flera baser i 5ʹ oöversatta regionen (5ʹ UTR) bildregistreringar motsvarande känsla, och icke-överlappande 3ʹ slutet innehåller en inverterad upprepning av en retrotransposon tillhör kort kärn element (sinus) familj. Intressant nog fann vi att den främsta drivkraften bakom detta translationell Uppregleringen är inbäddade sinus upprepar och det är inte begränsat till mus sinus upprepar bara. Mänskliga Alu repeat-innehållande heter som lncRNAs också förbättrad översättning av målet känsla mRNA, förstärker idén om en ny klass av sinus-driven reglerande antisense icke-kodande RNAs, passande nog SINEUPs13. Senare studier visade att potentialen i naturliga SINEUPs bevaras i syntetiska SINEUPs som utformats för att specifikt mål olika endogena och exogena gener14,15. SINEUPs har två viktiga funktioner: första ”bindande domänen” (BD) som är allmänt 5ʹ slutet regionen komplement till sekvensen som omfattar primärt starta kodon en protein-kodning mRNA och andra ”effektor domänen” (ED) eftersom det inbegriper en inverterad upprepning av sinus vilket är en förutsättning för SINEUP funktion14 (figur 1). SINEUPs kan anpassas för att designa en BD särskilt inriktad på en gen av val. Detta kan sedan utnyttjas för att dissekera funktionen av en särskild gen som är involverade i en biologisk väg, som ett bättre alternativ till en konventionell mRNA överuttryck strategi. Dessutom Detta mångsidiga verktyg kan användas för att öka produktion av antikroppar, och som en drog att behandla haploinsufficient sjukdomar som orsakas av otillräckliga doser av funktionella proteiner16,17,18, 19,20,21.

Fördelar med SINEUP-teknik är många. Det förändrar inte uttrycket för målet på transkriptionell nivå. Längre BDs ge mer specificitet till SINEUPs, medan inte förmå en dsRNA-beroende stress svar15. Protein med induktion upprätthålls inom det normala fysiologiska intervallet av cellen, förebygga eventuella skadliga inverkan på grund av avvikande eller överdriven proteinuttryck. SINEUPs är kompatibel med en mängd olika mus, mänskliga, och hamster odlade cellinjer, exempelvis HEK293T/17, HepG2, HeLa, CHO, MN9D och många fler12,13,14,15,18 ,19. SINEUPs kan effektivt rikta endogena gener, övergående överuttryckt gener och flaggan-märkta eller luciferas-fusion gener, eliminerande nöden av gen-specifika antikroppar14,18. Grundläggande SINEUP analysen kräver rutinmässig cellkultur, transfection, sodium dodecyl sulfate-polyakrylamid gelelektrofores (SDS-PAGE), realtid kvantitativa omvänd Transkription-polymerasen kedjar reaktion (qRT-PCR) instrument och inställningar, och kunskap kan vinnas på kort tid.

Här, beskriver vi en metod för att rikta gener med syntetiska SINEUPs att uppreglera översättning, en effekt tvärtemot andra tekniker såsom RNA interferens9 och ASO gapmers11,22,23. En allmänt använd metod för RNA-guidad gen aktivering är klustrade regelbundet mellanliggande kort palindromic repetitioner-baserad aktivering (CRISPRa), där genuttrycket utlöses den transkriptionell nivå24. Denna metod, men enkel och snabb, kräver flera enda guide RNAs (sgRNAs) inriktning samma gen för högre effektivitet, vilket ökar chanserna för off-target bindande25. Det nyckel-enzymet av CRISPRa systemet, det katalytiskt döda CRISPR-associerade proteinet 9 (dCas9) har dessutom låg bindande specificitet och sgRNAs inriktning dubbelriktad arrangören regioner kan icke-specifikt uppreglera i närheten gener25. Omvänt SINEUPs binda för att rikta mRNA på en enda bindande region med hög specificitet och påverkar inte närliggande genuttryck. Vi diskutera de grundläggande stegen i SINEUP design, transfection, proteiner och RNA uttryck analyser. Dessutom presenterar vi en halvautomatisk, hög genomströmning imaging system skärm flera SINEUPs samtidigt, vilket är användbart för detektion av optimala SINEUPs.

Protocol

1. utformningen av BDs av SINEUP konstruktioner för Target mRNA

  1. Kontrollera transkription start plats (TSS) och översättning start plats av målet mRNA i cellerna i intresse. Förvärva TSS data från både koda och FANTOM projekt (cap analys av genuttryck, Bur) (ZENBU: http://fantom.gsc.riken.jp/zenbu/).
  2. Öppna webbläsaren, Sök gener av intresse och kontrollera TSS av bur toppar.
  3. Konsultera exempel analys av celler och vävnad specifikt TSS av Parkinsons sjukdom protein 7 (PARK7) mRNA som visas i figur 2.
  4. Design BD sekvenser av flera olika längder som motsvarar 40 baser uppströms och 32 baser nedströms av första metionin (AUG), 72 nt totalt.
  5. Custom beställa designade BDs i SINEUP uttryck vektor (se Tabell för material).
    Obs: Kontrollera sekvens specificiteten av grundläggande lokal justering sökverktyg (BLAST) att undvika off-target effekter26.

2. cell kultur och SINEUP Transfection

  1. Utsäde celler av intresse i en 6 väl-platta eller 24 brunn-platta för 24 h innan transfection av SINEUPs. När det gäller mänskliga embryonala njurar cellinje (HEK293T/17) (se Tabell för material), frö 0,5 x 106 celler per väl en 6 väl-plattan eller 1,5 x 105 celler per väl av en poly-D-lysin belagda 24 brunn-tallrik (se Tabell för material). Det blir 70% konfluenta efter 24 h.
  2. Efter 24 h, ändra mediet till 1,5 mL färsk medium för en 6 väl-platta eller 0,4 mL färsk medium för en 24 brunn-platta. Vid SINEUP-GFP, transfect 0,6 µg för pEGFP-C2 (se Tabell av material) och 3,4 µg SINEUP-GFP i en väl en 6 väl-plattan eller 130 ng för pEGFP-C2 och 670 ng av SINEUP-GFP i en väl 24 brunn-platta med transfection reagens (10 µL i 6 väl-plattan och 3 µ L i 24 brunn-plattan) enligt tillverkarens anvisningar (se Tabell för material), och inkubera vid 37 ° C i en 5% CO2-inkubator för 24 h.
  3. Tvätta cellerna med 2 mL av fosfat buffert saltlösning (PBS) (37 mM NaCl, 8 mM Na2HPO4, 2.6 mM KCl och 1,5 mM KH2PO4) i varje brunn 6 väl-platta eller 0,5 mL PBS i varje brunn 24 brunn-platta. Endast för poly-D-lysin belagda 24 brunn-skylt, Lägg 25 µL 0,05% vikt per volym Trypsin och inkubera i en 5% CO2 inkubator för 5 min, 275 µL av cell medium per brunn. Vid 6 väl-plattan, tillsätt 2 mL PBS i varje brunn. Pipettera upp och ner för att skörda 3/4 av celler (1,5 mL för en 6 väl-tallrik) eller 225 µL för en 24 brunn-platta från 1 väl för protein utvinning (gå till protokoll nr 3 för protein utvinning) och 1/4 av celler (0,5 mL till en 6 väl-platta) eller 75 µL för en 24 brunn-platta för RNA-extraktion och centrifugera vid 6000 x g i 5 minuter vid 4 ° C (gå till steg 5 för RNA-extraktion).
    Obs: Analysera effekten av SINEUP-GFP i en poly-D-lysin belagda 24 brunn-tallrik med imaging. Gå till steg 7 (bildanalys).

3. protein utvinning

  1. Noggrant aspirera 1,5 mL PBS och lägga till 140 µL lysis lösning (20 mM Tris-HCl (pH 7,5), 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% (w/v) Triton, 2,5 mM natrium pyrofosfat, 1 mM β-glycerofosfat, 1 mM Na3VO4 1 μg/mL leupeptin och 0,005% (w/v) phenylmethylsulfonyl fluor (PMSF)) (se Tabell för material) för en 6 väl-plattan eller 60 µL för en 24 brunn-platta för att cell pellets.
  2. Blanda genom pipettering och sedan blanda genom att vrida på långsam hastighet för 1 h vid 4 ° C. Samla in supernatanten genom centrifugering vid 14 000 x g under 10 minuter vid 4 ° C.
  3. Kontrollera proteinkoncentration av kolorimetriska analys (se tabell för material). Förbereda alla reaktioner vid rumstemperatur.
    1. Förbereda 5 - 6 gånger utspädning av bovint serumalbumin (BSA) protein standard i ultrarent vatten med koncentrationer från 0,2-1,5 mg/mL protein. Förbereda färska standarder varje gång.
    2. Förbereda arbetande reagens Aʹ genom att blanda 1 mL reagens en (alkaliska koppar tartratlösning) med 20 µL av reagens S (tensiden lösning).
    3. Ladda 5 µL av vatten (negativ kontroll), BSA standard (protein standard och positiv kontroll) eller protein prov i varje brunn 96-brunn-platta.
    4. Tillsätt 25 µL av reagens Aʹ i varje brunn. Tillsätt försiktigt 200 µL av reagens B (Folin reagent) per väl undvika någon bubbla bildandet. Täck tallriken med aluminiumfolie och vänta 5-10 min.
    5. Mät absorbansen protein vid 750 nm med en spektrofotometer. Absorbansen är stabil i minst 1 h.
    6. Förbereda standardkurvan genom plotting BSA standard protein koncentrationer (mg/mL) på x-axeln och deras respektive diagram med absorbansen längs y-axeln. Beräkna provets proteinkoncentration av standardkurvan formel.
      Obs: Pausa protokollet på detta steg om det behövs eller gå till steg 4. För långsiktig lagring frysa snapin protein prover i flytande kväve och förvaras vid-80 ° C.

4. protein Separation av SDS-PAGE och upptäckt av målproteiner med antikroppar (Western-blot analys)

  1. Lägga till en volym av 2 x laddar färgämne (0,1 M Tris-HCl (pH 6,8), 4% SDS, 20% glycerol, 1,42% 2-mercaptethanol och 0,2% bromofenolblått) varje volym av protein prov från steg 3.3. Värme vid 90 ° C i 5 min och omedelbart cool på is för 1 min.
  2. Ladda 10-20 µg protein prov 10% SDS poly-akrylamid gel och separata på 100-150 V) (se Tabell för material).
  3. Överföra protein från gel till 0,45 µm nitrocellulosa membran (se Tabell för material) av halvtorr överföring instrument med överföring buffert (25 mM Tris, 192 mM glycin och 20% metanol) 25 V för 30 min.
  4. Lägg till blockerande lösning (5% fett torr mjölk i 1 x TBST buffert (137 mM NaCl, 20 mM Tris-HCl (pH 7,6), 0,1% Tween-20)) (se Tabell för material) till behållaren tills membranet är helt blöt och odla den i rumstemperatur i 30 min.
  5. När det gäller SINEUP-GFP, hybridisera proteinet med anti-GFP antikropp (utspädd 1: 2000 i blockerar lösningen) (se Tabell för material) av ruvning membranet under 30 minuter med skakningar vid rumstemperatur. Som en intern kontroll protein, upptäcka β-aktin protein genom att korsa med Anti-β-aktin antikropp (utspädd 1: 2000 i blockerar lösningen) (se Tabell för material) under 30 minuter med skakningar vid rumstemperatur.
  6. Tillsätt 1 x TBST buffert till behållaren tills membranet är helt blöt och tvätta för 5 min i rumstemperatur. Upprepa tvättningen två fler gånger (totalt tre tvättar).
  7. Hybridisera GFP protein till utspädning (1: 1000 blockera lösning) anti-kanin antikropp konjugerat med pepparrotsperoxidas (HRP) och hybridisera β-aktin protein till utspädning (1: 1000 blockera lösning) antimus-antikropp konjugerat med HRP på membranet 30 minuter med skakningar vid rumstemperatur.
  8. Tvätta membran med 1 x TBST buffert för 5 min i rumstemperatur. Upprepa tvättningen två fler gånger (totalt tre tvättar).
  9. Blanda lika stor volym av HRP-förbättrade chemiluminescence (ECL) upptäckt reagens 1 och 2 (se Tabell för material). Överföra membranet till 2 mL ECL reagens mix, täcka rutan med aluminiumfolie och låt det Inkubera i 1-2 min i rumstemperatur. Försiktigt bort membranet från ECL reagens mix och exponera använder en luminiscens imaging instrument.

5. RNA-extraktion och DNAS behandling

  1. Extrakt totala RNA följande standard protokoll för RNA-extraktion från celler odlade i en enskiktslager27 eller alternativt använda en kommersiellt tillgänglig RNA-extraktion kit (se Tabell för material). För att konstatera i korthet, lägga till någon monofasiska lysis reagens (MLR) av guanidin isotiocyanat och fenol till skördade celler i steg 2,3 (1 mL MLR per ~ 5 miljoner celler)27.
    Obs: Byt handskar ofta. Använda RNase-fri reagenser och diethylpyrocarbonate (DEPC)-behandlade plastartiklar och glas till förhindra RNA nedbrytning. Pausa protokollet på detta steg om det behövs. Store extraherade RNA vid-80 ° C.
  2. Tillsätt 0,1 mängd 10 x DNAS buffert och 2 U av DNAS till renat RNA från steg 5.1 (se Tabell för material).
  3. Ställa in volymen för reaktion till 50 µL med nuclease-gratis vatten och blanda försiktigt. Inkubera vid 37 ° C i 30 min.
  4. Tillsätt 0,1 volym åter svävande DNAS inaktivering reagens och blanda väl (se Tabell för material). Inkubera i 5 minuter vid rumstemperatur med milda skakningar.
  5. Centrifugera vid 10 000 x g 90 s. överför supernatanten (DNA-fria RNA) till en färsk RNase-fri 1,5 mL tub. Var noga med att inte röra pelleten eftersom detta kan orsaka överföring av DNAS som är besvärande för efterföljande steg.
  6. Kvantifiera RNA genom att mäta en260 och260/a280 förhållandet (för ren RNA, spänna är 1.8-2.0) i en UV-spektrofotometer.

6. första Strand cDNA syntes och qRT-PCR analys

  1. Utföra första strand cDNA syntes efter ett standard cDNA syntes protokoll som nedan (se tabell för material).
    1. Blanda 0,75 µM oligo dT primer, 4.3 µM slumpmässiga primer, dNTP (10 mM) med 200-500 ng total-RNA (från steg 5-8) i 10 µL av totala reaktionsvolym. Inkubera vid 65 ° C i 5 min och sedan omedelbart sätta på is.
    2. Blanda 1 x omvänt transkriptas buffert, 1 U av RNase inhibitor, 10 U av omvänt transkriptas, och Lägg till 10 µL RNA-primer mix från 6.1.1.
    3. Ange den totala reaktionsvolym till 20 µL med nuclease-fritt vatten om det behövs. Blanda försiktigt och inkubera reaktionsblandning vid 30 ° C i 10 min, sedan vid 42 ° C i 60 min, och slutligen vid 95 ° C i 5 min till inaktivera enzymet. Cool rören på is.
      Obs: Tina RNA prover och alla reagenser på is och förbereda reaktionsblandning på is. Om målet RNAs endast polyA RNAs, använda oligo dT primer endast (2,5 µM). Pausa protokollet om det behövs. Store syntetiseras cDNA vid-20 ° C.
  2. Utföra qRT-PCR i tekniska exemplar (n = 3, Cт standardavvikelse > 0,2) och inom biologiska replikat (n ≥ 3) använder 1 µL 10 ng cDNA, 0.4 µL av reverse primer (10 µM), 0,4 µL av forward primer (10 µM), 10 µL av blandningen lösning av DNA-polymeras , 0.4 µL av dubbel-strand DNA färgning dye, 10 µL nuclease-fritt vatten (reaktionsvolym var 20 µL) att upptäcka PCR-produkter användande följande villkor; Håll scenen (1 cykel) för 30 s vid 95 ° C, Cykling scenen (40 cykler) för 5 s vid 95 ° C och 30 s vid 60 ° C, smälta kurva scenen. Primer exempel är för mänskliga Gapdh_Fw: TCTCTGCTCCTCCTGTTC, mänskliga Gapdh_Rv: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, SINEUP-GFP_Fw: CTGGTGTGTATTATCTCTTATG och SINEUP-GFP_Rv: CTCCCGAGTCTCTGTAGC. Se tabell över material. Analysera kvantitativa RNA uttryck med 2- ∆∆Ct ± SD metod28.

7. imaging analys av SINEUPs av halvautomatisk detektionsmetod

  1. Tvätta cellerna med 0,5 mL PBS för ett väl 24 brunn-platta.
  2. Lägg till 2,0 μg av Hoechst 33342 (se Tabell för material) (upplösning i 500 μL av PBS) till varje brunn av 24-brunn-plattan och inkubera cellerna vid 37 ° C i 20 min att färga kärnan.
  3. Åtgärd Hoechst färgade celler för att räkna antalet celler på maximalt blå utsläpp 461 nm och gröna fluorescensintensitet att räkna antalet GFP positiva celler på en grön utsläpp högst 510 nm med hjälp av en hög genomströmning mikro-bra bild cytometer ( Se Tabell för material). Analysera proteinet upp-reglerande effekt av SINEUPs genom att beräkna GFP integrerade intensitet, vilket är summan av alla pixel stödnivåer visar signal i segmenterade objekt beräknas för varje kanal, använda Imaging programvara29.
  4. Skörda celler att kontrollera RNA uttryck (tillbaka till steg 5 och 6).

Representative Results

SINEUP-GFP är en syntetisk SINEUP som innehåller både en optimal BD (-28 / + 4 överlappar till GFP mRNA) och en ED (Inverterat sinus B2 från AS -Uchl1) som kan uppreglera GFP mRNA översättning (figur 3A och 3B) utan att ändra uttrycket av GFP mRNA (figur 3 c och 3D). Skärm för optimal BDs och EDs för SINEUPs, utvecklade vi ett protokoll av halvautomatisk bildanalys som förbättrat upptäckten tid och ökade antalet prover samtidigt som screening jämfört med en konventionell Western-blot analys15. I figur 4visas detta hög genomströmning imaging system tog 3 dagar (Western-blot analys tog 2 veckor för 48 SINEUPs). Har visat att SINEUP-GFP ökar GFP översättning, upptäckt vi GFP integrerade intensiteten av den bild cytometer. Den optimala BD SINEUP-GFP inducerade en 1,4-faldig ökning av GFP proteinuttryck. Även om vi observerat komprimering av signaler från 2.6-fold (Western-blot analys, se figur 3A) till 1,4-faldig (Imaging analys, se figur 5), skillnaden kan bero på kalibrering av instrument avbildningsprogrammet. Dock upptäckte vi betydligt högre nivåer av GFP fluorescens jämfört med kontroll (figur 5A och 5B).

Figure 1
Figur 1: grundläggande design av de syntetiska SINEUPs. BD = bindande domän för att rikta mRNA, ED = effektor domän som innehåller ett inverterat sinus-sekvens. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: Transkription starta platser (TSSs) humant Parkinsons sjukdom protein 7 (PARK7) mRNA i specifika vävnader och celler som upptäcks av bur analys. (A) A ögonblicksbild visar ett TSS sökresultat för mänskliga PARK7 mRNA använder ett omics dataintegrering och interaktiv visualisering system30. Den vågräta gröna pilen i Entrez gen hg19 spåret anger genomisk positionen hänvisningen mänskliga PARK7 mRNA och de vertikala gröna staplarna i FANTOM5 bur 1- och 2 spår visar summan av TSSs (mätt som avskrifter per miljon (tpm)) från 1 829 typer av vävnader och celler. (B) Zoom i TSS i panel A markerad region (1/354 skala: 35,4 kb till 100 bp). Grå skuggade området i FANTOM5 bur fas 1 och 2 spår anger TSS 6 specifika celler ur de totala 1 829, som listas längst ned på bilden. Siffrorna (11.369, 4.998, 4.304, 3.509, 3.477 och 3.055) motsvarar dessa uppräknade celler indikerar avskrifter per miljon för varje specifik cell på grey skuggade positioner av TSS. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: Western-blot analys bekräftar Uppregleringen av översättning av SINEUP-GFP. (A) SINEUP-GFP undersöktes av Western-blot med anti-GFP antikropp. (B) resultat var normaliserade till intensiteten av β-aktin protein bandet. (C) GFP mRNA och (D) SINEUP RNAs uttryck upptäcktes av qRT-PCR. p < 0,0005, n = 3, tvåsidiga Students t-test, felstaplar är standardavvikelsen. Denna siffra har ändrats från Takahashi et al.15. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: Schematisk av SINEUP delvis automatiserad bildanalys. Dag 1: Utsäde celler av intresse i en 24 brunn-plattan. Dag 2: Transfect god Jordbrukarsed och SINEUP-GFP. Dag 3: Analysera effekten av SINEUPs genom att mäta GFP integrerade intensitet. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: High-throughput analys av översättning Uppregleringen av SINEUP-GFP. (A) jämförelse av GFP fluorescens mellan kontroll- och SINEUP-GFP transfekterade celler15. Skalstapeln = 2 mm. (B), GFP integrerad intensitet var normaliserade till totala cell nummer räknas av nukleär färgning med Hoechst 33342. p < 0,0005, n = 3, tvåsidiga Students t-test, felstaplar är standardavvikelsen. FOV: synfält. Denna siffra har ändrats från Takahashi et al.15. Klicka här för att se en större version av denna siffra.

Discussion

Vi beskrivs här ett protokoll för att särskilt förbättra proteinproduktion av ett mål som mRNA med hjälp av en sinus-innehållande icke-kodande RNA, kallas SINEUPs. Som ett typexempel visas optimal syntetiska SINEUP-GFP att uppreglera översättningen av GFP mRNA 2.6-fold mätt med Western-blot analys.

Designa en optimal BD är avgörande för att säkerställa SINEUP specificitet och styrka (omfattningen av protein upp-förordning). Tidigare vi säkerhetskontrolleras 17 BDs av SINEUP-GFP med Western-blot analys15 och hittade att den optimala BD överlappar den AUG-KOZAK sekvensen av GFP mRNA, men det inte kanske är fallet med andra mRNA och bör kontrolleras för varje enskilt fall. En annan oberoende grupp screenas även BD använder en annan metod31. Som screening många BDs kan vara ganska tidskrävande och besvärligt, introducerade vi en hög genomströmning SINEUP detektionsmetod här. Denna metod mäter relativa förändringar i GFP integrerad täthet i SINEUP transfekterade-celler jämfört med kontroll vektor transfekterade-cellerna. För att säkerställa att celler i en särskild brunn kultur platta är transfekterade lika och god Jordbrukarsed signal inte är koncentrerad till endast en viss region i brunnen, är det mycket viktigt att distribuera cellerna lika i brunnarna i steg 2.1. För detta ändamål, försiktigt skaka plattan 10 gånger fram och tillbaka (↑↓) efter sådd cellerna inuti en ren bänk och upprepa i 5% CO2 inkubatorn innan inkubering.

Ett annat viktigt steg är beräkningen av proteinkoncentration i steg 3.3. Felbedömningar här kan leda till lastningen av en felaktig mängd protein under Western-blot analys, följaktligen att förhindra upptäckt av små förändringar i proteinuttryck av några av de svaga SINEUPs eller generera falsklarm från överbelastning. Det rekommenderas att färska förbereda protein standardkurvan varje gång, att se till att lika mängder standarder och protein prov mäts i steg 3.3.3. Protokollet beskrivs här fokuserar på SINEUP-GFP, men Western-blot analys kan användas för något rikta mRNA av intresse. De inkubationstid och koncentrationen av antikroppar bör optimeras för varje mål för att få bästa resultat.

En av de unika funktionerna i SINEUPs är att mål-mRNA uttryck nivå förblir opåverkad. Det är viktigt att behandla RNA med DNAS att undvika upptäckt av transfekterade SINEUPs och genomisk DNA av qRT-PCR. SINEUP RNAs och målet mRNA uttryck bör mätas med qRT-PCR bekräfta framgång både transfection och SINEUP aktivitet. SINEUPs innehåller en SINE sekvens, som är rikligt förekommande i hela både människan och mus genomen. För att undvika icke-specifik detektion av SINE sekvenser, rekommenderas det inte att utforma qRT-PCR primers till SINE sekvensen.

I detta protokoll vi används mänskliga cellinjer, men SINEUPs är effektiv i ett antal cellinjer från flera olika arter12,13,14,18,19. Cell kultur och transfection villkoren kan ändras enligt olika cellinjer så länge dessa behåller transfection effektivitet SINEUP vektorer. Dessutom kan alternativa metoder av RNA extraktion, cDNA syntes, och protein koncentration kontroll vara anställd, med tanke på att de bevara krävs RNA och protein för qRT-PCR och Western-blot analys. Medan vi använde en särskild hög genomströmning mikro-väl cytometer, som aktiverats detektion av GFP fluorescens över hela brunnen, kan andra cytometers med en liknande avkänningsområde vara begagnade31. Det bör noteras att om fördelningen av celler och transfection är lika i hela en väl, då det inte är nödvändigt att skanna hela brunnen för god Jordbrukarsed fluorescens: hälften eller en fjärdedel av området av en brunn kan vara nog att urskilja SINEUP effekt beroende på experiment Al färdigheter.

Att upprätta en hög genomströmning SINEUP detection protocol möjliggör samtidiga screening av flera BDs inriktning en given mRNA i odlade celler. Detta är viktigt eftersom reglerna för optimal inriktning av BD är fortfarande oklart. Sådan multiplex screening system möjliggör storskalig testning av många SINEUPs mot olika gener, användbar för inriktning flera gener inblandade i en viss signalväg för anföra som exempel. Dessutom det kan utnyttjas för att utöka sökandet efter effektiva SINEUPs inriktning flera mRNA, utforma olika SINEUP BDs runt AUG-Kozak region (se figur 1), Co transfecting fulla längd mål mRNA (5ʹ UTR-CD-skivor-3ʹ UTR) smält med GFP mRNA i odlade celler för att hitta optimal SINEUPs och därefter testa BD kandidater mot endogena mRNA i odlade celler och invivo modell djur, från människor och möss till andra Fridlysningsbestämmelserna.

Detta screening protokoll är mycket snabb. Vi behöver inte fixa och samla celler, men behöver bara placera levande cell kultur plattan i imaging instrumentet. Vi föreslår att använda detta high-throughput screening protokoll att välja optimal BDs av SINEUPs och utvärdera potentiella kandidater genom Western-blot analys. Valda kandidater med optimal BDs kan således tillämpas för att öka antikropp produktion18,19,21. För närvarande växer dramatiskt RNA terapeutiska området. Exempelvis är siRNA, ASO, mRNA och CRISPR RNA terapier, allmänt används för att kontrollera mRNA uttryck för deras respektive mål9,32. I detta sammanhang SINEUPs är i sin linda, men hittills ingen av de studerade SINEUPs förändrat uttryck av målet mRNA. Dessutom redigera SINEUPs inte rikta mRNA, men endast uppreglera översättning av mRNA. Dessutom kan förlust-av-funktion sjukdomar till följd av haploinsufficiency riktas av SINEUP behandling, att uppnå en 2-faldig induktion av de bristfälliga protein17,33. Även om off-target effekter behöver studeras ytterligare, rikta SINEUPs potentiellt och specifikt en enda, uttryckt mRNA med en kompletterande sekvens till BD.

En begränsning av hög genomströmning protokollet är att det inte är passande att skärmen BDs av SINEUPs i invivo musmodeller eftersom protokollet åtgärderna i GFP integrerat intensiteten bara. Som SINEUPs är naturliga antisense lncRNAs att agera post-transcriptionally, kan inte de tillämpas när målet mRNA saknas i celler eller vävnadsprover.

SINEUPs kan dock tillämpas till gain-of-function studier, att öka produktion av antikroppar, och som en RNA-terapi för att uppreglera uttrycket av bristfällig proteiner inom spänna av 1,5-3,0-fold. Metoderna som beskrivs här presenterar en användbar guide för att rikta och upptäcka SINEUP-inducerad översättning förbättring av önskad mRNA och ger ett nytt verktyg för post-transcriptional genreglering.

Disclosures

Motsvarande författaren Piero Carninci är en av grundarna av TransSINE Technologies Co. Ltd. som innehar immateriella på arkiverade patentet (EP2691522A4 och JP2017169573A) och beviljat patent (US9353370B2) för SINEUP teknik.

Acknowledgments

Denna studie var delvis stöds av grundläggande vetenskap och plattform Technology Program för innovativa biologisk medicin, nr 17 am 0301014, från Japan byrån för medicinsk forskning och utveckling (AMED), forskningsanslag från MEXT till RIKEN Center for Life Science-teknologier och forskningsbidrag från MEXT till RIKEN IMS. Vi tackar medlemmar av de PC-labbet och SINEUP nätverket (SISSA, universitet i östra Piemonte och RIKEN) för tankeväckande diskussioner. Vi tackar Dr Matthew Valentine för korrekturläsning.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
Cell baserat analyser av SINEUP icke-kodande RNAs som specifikt kan förbättra mRNA Översättning
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter