Mikroinjektion af rekombinant RCAS(A)-retrovirus i embryonal kyllingelinse
Summary
Dette protokolpapir beskriver metoden til embryonal mikroinjektion af kyllingelinse af et RCAS(A) retrovirus som et værktøj til at studere in situ-funktion og ekspression af proteiner under linseudvikling.
Abstract
Embryonal kylling (Gallus domesticus) er en veletableret dyremodel til undersøgelse af linseudvikling og fysiologi på grund af dens høje grad af lighed med den menneskelige linse. RCAS (A) er et replikationskompetent kyllingeretrovirus, der inficerer delende celler, der fungerer som et kraftfuldt værktøj til at studere in situ-ekspression og funktion af vildtype- og mutantproteiner under linseudvikling ved mikroinjektion i det tomme lumen i linsevesikel i tidlige udviklingsstadier, hvilket begrænser dets virkning til omgivende prolifererende linseceller. Sammenlignet med andre tilgange, såsom transgene modeller og ex vivo-kulturer , giver brugen af et RCAS (A) replikationskompetent aviær retrovirus et yderst effektivt, hurtigt og tilpasseligt system til at udtrykke eksogene proteiner i kyllingembryoner. Specifikt kan målrettet genoverførsel begrænses til proliferative linsefiberceller uden behov for vævsspecifikke promotorer. I denne artikel vil vi kort gennemgå de trin, der er nødvendige for rekombinant retrovirus RCAS (A) forberedelse, give et detaljeret, omfattende overblik over mikroinjektionsproceduren og give prøveresultater af teknikken.
Introduction
Målet med denne protokol er at beskrive metoden til embryonal mikroinjektion af kyllingelinse af en RCAS (A) (replikationskompetent fuglesarkom / leukose retrovirus A). Effektiv retroviral levering i en embryonal kyllingelinse har vist sig at være et lovende værktøj til in vivo-undersøgelse af linseproteiners molekylære mekanisme og strukturfunktion i normal linsefysiologi, patologiske tilstande og udvikling. Desuden kan denne eksperimentelle model anvendes til identifikation af terapeutiske mål og lægemiddelscreening for tilstande som human medfødt grå stær. Alt i alt har denne protokol til formål at fastlægge de nødvendige trin til udvikling af en tilpasselig platform til undersøgelse af linseproteiner.
Embryonale kyllinger (Gallus domesticus) er på grund af deres lighed i linsestruktur og funktion med den menneskelige linse en veletableret dyremodel til undersøgelse af linseudvikling og fysiologi 1,2,3,4. Anvendelsen af et RCAS(A)-replikationskompetent fugleretrovirus er blevet betragtet som et yderst effektivt, hurtigt og tilpasseligt system til at udtrykke eksogene proteiner i kyllingembryoner. Det har navnlig en unik evne til at begrænse målgenoverførslen til proliferative linsefiberceller uden behov for vævsspecifikke promotorer ved hjælp af den unikke tidsramme for embryonal udvikling, inden for hvilken tilstedeværelsen af tomt linselumen tillader in situ RCAS(A)-mikroinjektion i det begrænsede sted til ekspression af eksogene proteiner i proliferative linsefiberceller5 6,7,8.
Chick embryo mikroinjektionsproceduren, beskrevet dybtgående her, er oprindeligt delvist baseret på Fekete et’s arbejde. al.6 og videreudviklet af Jiang et. al.8 og er blevet anvendt som et middel til at indføre både virale og ikke-virale plasmider i linsen hos embryonale kyllinger 1,9,10,11,12,13. Samlet set demonstrerer det tidligere arbejde potentialet ved at udnytte denne metode til at studere linseudvikling, differentiering, cellulær kommunikation og sygdomsprogression og til opdagelse og test af terapeutiske mål for linsepatologiske tilstande såsom grå stær.
Protocol
Representative Results
Discussion
Denne eksperimentelle model giver mulighed for at udtrykke proteinet (e) af interesse i den intakte linse, hvilket fører til undersøgelsen af disse proteiners funktionelle relevans i linsestruktur og funktion. Den embryonale chick mikroinjektionsmodel er delvist baseret på Fekete et’s arbejde. al.6 og blev videreudviklet af Jiang et. al.8 og er blevet anvendt som et middel til at indsætte både virale plasmider og midler såsom agonister, lille interfererende RNA (siRNA…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Dette arbejde blev støttet af National Institutes of Health (NIH) Grants: RO1 EY012085 (til J.X.J) og F32DK134051 (til FMA) og Welch Foundation tilskud: AQ-1507 (til J.X.J.). Indholdet er udelukkende forfatternes ansvar og repræsenterer ikke nødvendigvis de officielle synspunkter fra National Institutes of Health. Figurerne blev delvist skabt med Biorender.com.
Materials
| 0.22 µm Filter | Corning | 431118 | For removing cellular debris from media |
| 35 mm x 10 mm Culture Dish | FisherScientific | 50-202-030 | For using during microinjection |
| Centrifuge | Fisherbrand | 13-100-676 | Spinning down solution |
| Constructs | GENEWIZ | – | For generation of constructs |
| Dissecting microscope | AmScope | SM-4TZ-144A | Visualization of lens for microinjection |
| DNA PCR primers | Integrated DNA Technologies | – | Generation of primers: Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively |
| Drummond Nanoject II Automatic Nanoliter Injector | Drummond Scientific | 3-000-204 | Microinjection Pipet |
| Dual Gooseneck Lights Microscope Illuminator | AmScope | LED-50WY | Lighting for visualization |
| Dulbecco’s Modified Eagle Medium (DMEM) | Invitrogen | For cell culture | |
| Egg Holder | – | – | Homemade styrofoam rings with 2-inch diameter and one-half inch height |
| Egg Incubator | GQF Manufacturing Company Inc. | 1502 | For incubation of fertilized eggs |
| Fast Green | Fisher scientific | F99-10 | For visualization of viral stock injection |
| Fertilized white leghorn chicken eggs | Texas A&M University | N/A | Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/) |
| Fetal Bovine Serum (FBS) | Hyclone Laboratories | For cell culture | |
| Fluorescein-conjugated anti-mouse IgG | Jackson ImmunoResearch | 115-095-003 | For anti-FLAG 1:500 |
| Forceps | FisherScientific | 22-327379 | For moving things around and isolation |
| Glass capillaries | Sutter Instruments | B100-75-10 | Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length) |
| Lipofectamine | Invitrogen | L3000001 | For transfection |
| Manual vertical micropipette puller | Sutter Instruments | P-30 | To obtain glass micropipette of the correct size |
| Microcentrifuge Tubes | FisherScientific | 02-682-004 | Dissolving solution |
| Microscope | Keyence | BZ-X710 | For imaging staining |
| Parafilm | FisherScientific | 03-448-254 | Placing solution |
| Penicillin/Streptomycin | Invitrogen | For cell culture | |
| Pico-Injector | Harvard Apparatus | PLI-100 | For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time |
| rabbit anti-chick AQP0 | Self generated | – | Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363. |
| rabbit anti-FLAG antibody | Rockland Immunichemicals | 600-401-383 | For staining FLAG |
| Rhodamine-conjugated anti-rabbit IgG | Jackson ImmunoResearch | 111-295-003 | For anti-AQP0 1:500 |
| Sponge clamping pad | Sutter Instruments | BX10 | For storage of glass micropipette |
References
- Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. Development of a potent embryonic chick lens model for studying congenital cataracts in vivo. Communications Biology. 4 (1), 325 (2021).
- Chen, Y., et al. γ-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds. The FEBS Journal. 283 (8), 1516-1530 (2016).
- Coulombre, A. J., Coulombre, J. L. Lens development. I. Role of the lens in eye growth. Journal of Experimental Zoology. 156 (1), 39-47 (1964).
- McKeehan, M. S. Induction of portions of the chick lens without contact with the optic cup. The Anatomical Record. 132 (3), 297-305 (1958).
- Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo. Molecular immunology. 47 (7-8), 1619-1628 (2010).
- Fekete, D. M., Cepko, C. L. Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo. Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).
- Jiang, J. X. Use of retroviruses to express connexins. Methods in Molecular Biology. , 159-174 (2001).
- Jiang, J. X., Goodenough, D. A. Retroviral expression of connexins in embryonic chick lens. Investigative Ophthalmology & Visual Science. 39 (3), 537-543 (1998).
- Shestopalov, V. I., Bassnett, S. Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core. Journal of Cell Science. 113 (11), 1913-1921 (2000).
- Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50. Journal of Cell Science. 124 (2), 198-206 (2011).
- Li, Z., et al. The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression. Journal of Biological Chemistry. 299 (3), 102965 (2023).
- Shestopalov, V. I., Bassnett, S. Exogenous gene expression and protein targeting in lens fiber cells. Investigative Ophthalmology & Visual Science. 40 (7), 1435-1443 (1999).
- Shestopalov, V. I., Bassnett, S. Three-dimensional organization of primary lens fiber cells. Investigative Ophthalmology & Visual Science. 41 (3), 859-863 (2000).
- Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors. Journal of Virology. 61 (10), 3004-3012 (1987).
- Yan, R. T., Wang, S. Z. Production of high-titer RCAS retrovirus. Methods in Molecular Biology. 884, 193-199 (2012).
- Kingston, R. E. Introduction of DNA into mammalian cells. Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).
- Li, Y., et al. Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model. STAR Protocols. 3 (1), 101060 (2022).
- Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Developmental Dynamics. 195 (4), 231-272 (1992).
- Hallagan, J. B., Allen, D. C., Borzelleca, J. F. The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification. Food and Chemical Toxicology. 33 (6), 515-528 (1995).
- Okada, T. S., Eguchi, G., Takeichi, M. The expression of differentiation by chicken lens epithelium in in vitro cell culture. Development, Growth & Differentiation. 13 (4), 323-336 (1971).
- Menko, A. S., Klukas, K. A., Johnson, R. G. Chicken embryo lens cultures mimic differentiation in the lens. Developmental Biology. 103 (1), 129-141 (1984).
- Parreno, J., et al. Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells. Frontiers in Cell and Developmental Biology. 10, 983178 (2022).
- Edwards, A., Gupta, J. D., Harley, J. D. Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens. Experimental Eye Research. 15 (4), 495-498 (1973).
- Musil, L. S. Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation. Journal of Membrane Biology. 245 (7), 357-368 (2012).
- West-Mays, J. A., Pino, G., Lovicu, F. J. Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis. Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).
- Upreti, A., et al. Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response. Cells. 12 (3), 501 (2023).
- Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. Activation of SRC kinases signals induction of posterior capsule opacification. Investigative Ophthalmology & Visual Science. 48 (5), 2214-2223 (2007).
- Briskin, M. J., et al. Heritable retroviral transgenes are highly expressed in chickens. Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).
- Hughes, S. H. The RCAS vector system. Folia Biologica. 50 (3-4), 107-119 (2004).
