Name: A Unique Mouse Model for Quantitative Assessment of Biofilm Formation on Surgical Implants in Subcutaneous Abscess (Video) | JoVE Journal
Uploaded: 2025-06-06T14:30:00.000+00:00
Duration: 3 min 44 s
Description: Learn a unique mouse model for quantitative biofilm assessment on surgical implants in subcutaneous abscess. This method enables simultaneous comparison of two implants under identical infectious conditions.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This research was partially funded by an NSF Industry/University Cooperative Research Program called the Center for Disruptive Musculoskeletal Innovations (IIP-1916629), Komatsuseiki Kosakusho Co., Ltd., and Rosies Base, LLC.

All animal procedures are approved by the Institutional Animal Care and Use Committee (IACUC) at the University of California San Francisco (UCSF) and are performed in a BSL2 facility after consultation with and approval by the UCSF Biosafety Hazard Program, administrated by UCSF Environmental Health and Safety. Male and female C57BL/6 mice (12-16 weeks old, 25-50 g) were used. The details of the reagents and the equipment used are listed in the Table of Materials.
1. Bacteria preparation
<ol>
	<li>Use the bioluminescent Staphylococcus aureus Xen36 (ATCC49525) as the pathogen. 
	NOTE: This strain is obtained from the American Type Culture Collection (Manassas, VA) and uniquely utilizes a luxABCDE operon, which is optimized and integrated into the host&#39;s native plasmid. Xen36 also uses the kanamycin resistance gene linked to the lux operon.</li>
	<li>Add a small amount of frozen glycerol stock of Xen 36 and add the pieces to 5 mL of tryptic soy broth (TSB) medium containing 200 &#181;g/mL kanamycin.</li>
	<li>Incubate the culture overnight at 37 &#176;C in a shaking incubator (200 rpm).</li>
	<li>Streak Xen36 onto TSB agar plates (TSB in agar 1.5%) containing 200 &#181;g/mL kanamycin and incubate overnight at 37 &#176;C.</li>
	<li>Isolate single colonies of Xen36 and culture in 5 mL of TSB containing 200 &#181;g/mL kanamycin overnight at 37 &#176;C in a shaking incubator (200 rpm).</li>
	<li>Measure the absorbance of the resultant culture at 630 nm.</li>
	<li>Dilute the culture and make a&#160;Xen36 culture of 1.0 x 108 CFU/mL based on the absorbance at 630 nm. 
	NOTE: An absorbance measurement at 630 nm (against a TSB blank) of 0.5 is roughly equivalent to 1.0 x 108 CFU/ml of Xen36.</li>
	<li>Dilute the culture and make a&#160;Xen36 culture of 1.0 x 105 CFU/mL.</li>
</ol>
2. Preparation of connected implants
<ol>
	<li>Use two rod-shaped wires composed of commercially available surgical-grade stainless steel (SUS316L), each measuring 8 mm in length and 0.5 mm in diameter.</li>
	<li>Connect the two wires vertically by inserting them into both ends of a 20 &#181;L pipette tip cut to a length of approximately 3 mm. 
	NOTE: Insert the vertically connected wires into the tip of the 18 G needle (Figure 1). Ensure that the wires are firmly secured by the pipette tip to prevent disconnection.</li>
	<li>Autoclave the wires before surgically implanting them into the mice.</li>
</ol>
3. Creation of a mature subcutaneous pouch
NOTE: 7 days before bacterial inoculation, create the air pouch as follows:
<ol>
	<li>Anesthetize the mouse (C57BL/6) with 2% isoflurane via inhalation (following institutionally approved protocols). 
	NOTE: Assess the appropriate level of anesthesia by observing the respiratory rate, muscle tone, toe pinch, corneal reflex, and color of the mucous membranes. Use ophthalmic ointment on eyes to prevent dryness while under anesthesia.</li>
	<li>Transfer the anesthetized mouse to the surgical bed and shave the mouse&#39;s dorsal cervical/thoracic region.</li>
	<li>Swab and sterilize the entire region with 70% ethanol and povidone-iodine.</li>
	<li>Fill a 10 mL syringe with sterile air and attach a 27 G needle to the outlet.</li>
	<li>Gently pinch and elevate the base of the mouse&#39;s neck to create space between the subcutaneous tissue and the fascia.</li>
	<li>Place the needle into the midline between the mouse&#39;s scapulae and inject 3 mL of sterile air subcutaneously to create the air pouch (Figure 2). 
	NOTE: While injecting air, hold down both sides of the back with the opposite hand to ensure the air spreads to the center of the back, creating a pouch in the middle.</li>
	<li>Return the mouse to a cage warmed with a thermal pad and monitor it closely until it has recovered from the anesthesia.</li>
	<li>Inject 3 mL of sterile air every 2 days, following the same procedure as on the first day, including anesthesia and skin preparation prior to each injection, to maintain the cavity&#39;s inflation and promote mature pouch formation. 
	NOTE: Before each inflation, aspirate the air from the pouch to confirm the proper placement of the needle tip. Carefully remove the syringe from the needle, leaving the needle tip in the pouch. Reinflate the pouch with 3 mL of sterile air.</li>
</ol>
4. Implantation of connected wires and bacterial inoculation
<ol>
	<li>7 days after the first air injection, anesthetize the mouse as described in step 3.1. 
	NOTE: During the surgical procedure, constantly check that the mouse is breathing and is anesthetized. The entire surgical procedure usually takes 10-15 min when performed by a trained surgeon. Anesthesia is maintained by placing a tube delivering 2% isoflurane mixed with oxygen adjacent to the mouse snout.</li>
	<li>Swab and sterilize the entire region with 70% ethanol and povidone-iodine.</li>
	<li>Inject bupivacaine subcutaneously just before surgery.</li>
	<li>Make a 3 mm midline-longitudinal incision at the top of the pouch.</li>
	<li>Insert an 18 G needle containing the connected wires into the pouch through the hole and push out the wires using an inner syringe of a 25 G spinal needle (Figure 3A,B).</li>
	<li>Leaving the tip of the 18 G needle inside the pouch, gently remove the inner cylinder and inject 3 mL of 1.0 x 105 CFU/mL Xen36 culture using the syringe (Figure 3C,D).</li>
	<li>Carefully remove all needles, close the skin using a wound clip, and seal with topical skin adhesive (Figure 3E,F).</li>
	<li>Ensure there is no leakage, return the mouse to the individual cage warmed with a thermal pad, and monitor as before. 
	NOTE: During the 14-day abscess formation period, mice were monitored daily for signs of discomfort, including scratching at the site, redness of the skin, decreased appetite, or reduced activity. In most cases, no significant behavioral changes were observed beyond the first few days after inoculation. If a mouse exhibited persistent signs of distress, such as markedly reduced activity or shivering that did not improve, it was humanely euthanized to prevent unnecessary suffering.</li>
</ol>
5. Extraction of the implants from the subcutaneous abscess
<ol>
	<li>After euthanasia via overdose of isofluorane, shave the dorsal cervical, thoracic, and lumbar region of the mouse, and swab and sterilize the entire region with 70% ethanol and povidone-iodine (Figure 4A). 
	NOTE: The euthanasia was conducted in accordance with the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals. Death was confirmed by the absence of respiration and heartbeat, and blanching of the mucous membranes.</li>
	<li>Make a 2 cm midline incision in the lumbar region and carefully exfoliate the subcutaneous tissue using scissors.</li>
	<li>Extend the incision and subcutaneous dissection proximally and separate the adherent tissue surrounding the abscess (Figure 4B - D).</li>
	<li>Excise the entire subcutaneous abscess (Figure 4E).</li>
	<li>Cut the abscess and carefully extract the wire from the inside of the abscess (Figure 4F).</li>
</ol>
6. Quantification of the formed biofilm on the implant surfaces
<ol>
	<li>Crystal violet assay
	<ol>
		<li>Place the wires extracted from the abscess into individual wells of a 24-well plate containing 1 mL of deionized (DI) water.</li>
		<li>Transfer the wires to new wells containing 1 mL of DI water to remove any loosely adherent bacteria from the surface of the wires.</li>
		<li>Fix the biofilm on the wires with 100% ethanol for 1 min and allow them to dry.</li>
		<li>Transfer the wires to new wells containing 1 mL of 0.1% crystal violet reagent.</li>
		<li>After 15 min of staining, gently wash the wires twice with DI water to remove any excess dye.</li>
		<li>Place the implant into a 1.5 mL microcentrifuge tube containing 250 &#181;L of 33% acetic acid for 15 min; solubilize the crystal violet adherent to the biofilm on the implant, followed by vortexing for 1 min.</li>
		<li>Transfer 200 &#181;L of the suspension to a 96-well plate and measure the absorbance at OD630 nm using a microplate reader. All measurement is performed in triplicate.</li>
	</ol>
	</li>
	<li>Colony forming units (CFU) counting
	<ol>
		<li>Remove any loosely adherent bacteria from the surface of the wires as described in step 6.1.2.</li>
		<li>Place the implant into a 1.5 mL microcentrifuge tube containing 200 &#181;L of 10x trypsin and incubate at 37 &#176;C for 1 h.</li>
		<li>Vortex for 1 min and sonicate in a water bath at 100 W for 5 min, followed by additional vortexing for 30 s to detach the biofilm into the suspension.</li>
		<li>Inoculate 10 &#181;L of the serially diluted suspension onto the TSB agar plates (TSB in agar 1.5%) with 200 &#181;g/mL kanamycin. 
		NOTE: Perform this procedure in triplicate for each solution.</li>
		<li>After incubating the plates at 37 &#176;C for 24 h, count the colonies on the plates and calculate the number of bacterial cells in the original culture using the mean colony counts17. 
		NOTE: To ensure that all bacteria are removed from the wires, which is crucial for accurate measurement, stain the wires with crystal violet and observe them after applying the suspension to the plates. In the preliminary experiments, the combination of the above mechanical and chemical dissociation successfully removed all Xen36 biofilms from the surfaces of the conventional stainless steel wire (Figure 5).</li>
	</ol>
	</li>
	<li>Quantitative polymerase chain reaction (qPCR) analysis
	<ol>
		<li>Remove any loosely adherent bacteria from the surface of the wires as described in step 6.1.2.</li>
		<li>Place the implant into a 1.5 mL microtube containing 600 &#181;L of TSB.</li>
		<li>Extract DNA using the pellet-free modified alkaline lysis system16. 
		NOTE: The final volume of eluted DNA is 20 &#181;L.</li>
		<li>Dilute the DNA 1:10 and store it at -20 &#176;C.</li>
		<li>Perform qPCR for the luxA and 16S rRNA genes16. 
		NOTE: All qPCR reactions are performed in triplicate. The total reaction mix volume is 10 &#181;L, containing 3 &#181;L of DNA template, 5 &#181;l of SYBR Green, 1 &#181;L of nuclease-free water, and 0.5 &#181;L of each primer. Primers for the luxA gene are 5&#39;- GAGCATCATTTCACGGAGTTTG -3&#39; and 5&#39;- ATAGCGGCAGTTCCTACATTC -3&#39;. Primers for the 16S rRNA gene are 5&#39;- GTGGAGGGTCATTGGAAACT - 3&#39; and 5&#39;- CACTGGTGTTCCTCCATATCTC - 3&#39;. The PCR conditions are as follows: initial denaturation for 2 min at 94 &#176;C followed by 40 cycles of 15 s at 94 &#176;C, 30 s at 60 &#176;C, and 30 s at 72 &#176;C, and a final extension at 72 &#176;C for 5 min.</li>
		<li>Plot the mean of the three-cycle threshold (Ct) values is plotted against a calibration curve generated with DNA purified directly from serially diluted pure Xen36 cultures to estimate the bacterial load on the implant (Figure 6).</li>
	</ol>
	</li>
</ol>

<ol><li>Wukich, D. K., Lowery, N. J., McMillen, R. L., Frykberg, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Postoperative+infection+rates+in+foot+and+ankle+surgery%3A+a+comparison+of+patients+with+and+without+diabetes+mellitus%5BTitle%5D)+AND+%22J+Bone+Joint+Surg+Am%22%5BJournal%5D)">Postoperative infection rates in foot and ankle surgery: a comparison of patients with and without diabetes mellitus.</a> J Bone Joint Surg Am. 92 (2), 287-295 (2010).</li>
<li>Darouiche, R. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Treatment+of+infections+associated+with+surgical+implants%5BTitle%5D)+AND+%22N+Engl+J+Med%22%5BJournal%5D)">Treatment of infections associated with surgical implants.</a> N Engl J Med. 350 (14), 1422-1429 (2004).</li>
<li>Arciola, C. R., Campoccia, D., Montanaro, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Implant+infections%3A+Adhesion%2C+biofilm+formation+and+immune+evasion%5BTitle%5D)+AND+%22Nat+Rev+Microbiol%22%5BJournal%5D)">Implant infections: Adhesion, biofilm formation and immune evasion.</a> Nat Rev Microbiol. 16 (7), 397-409 (2018).</li>
<li>Li, P., Yin, R., Cheng, J., Lin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bacterial+biofilm+formation+on+biomaterials+and+approaches+to+its+treatment+and+prevention%5BTitle%5D)+AND+%22Int+J+Mol+Sci%22%5BJournal%5D)">Bacterial biofilm formation on biomaterials and approaches to its treatment and prevention.</a> Int J Mol Sci. 24 (14), ijms241411680(2023).</li>
<li>Chen, X., Zhou, J., Qian, Y., Zhao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Antibacterial+coatings+on+orthopedic+implants%5BTitle%5D)+AND+%22Mater+Today+Bio%22%5BJournal%5D)">Antibacterial coatings on orthopedic implants.</a> Mater Today Bio. 19, 100586(2023).</li>
<li>Pan, C., Zhou, Z., Yu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Coatings+as+the+useful+drug+delivery+system+for+the+prevention+of+implant-related+infections%5BTitle%5D)+AND+%22J+Orthop+Surg+Res%22%5BJournal%5D)">Coatings as the useful drug delivery system for the prevention of implant-related infections.</a> J Orthop Surg Res. 13 (1), 220(2018).</li>
<li>Savvidou, O. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficacy+of+antimicrobial+coated+orthopedic+implants+on+the+prevention+of+periprosthetic+infections%3A+A+systematic+review+and+meta-analysis%5BTitle%5D)+AND+%22J+Bone+Jt+Infect%22%5BJournal%5D)">Efficacy of antimicrobial coated orthopedic implants on the prevention of periprosthetic infections: A systematic review and meta-analysis.</a> J Bone Jt Infect. 5 (4), 212-222 (2020).</li>
<li>Sussman, E. M., Casey, B. J., Dutta, D., Dair, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Different+cytotoxicity+responses+to+antimicrobial+nanosilver+coatings+when+comparing+extract-based+and+direct-contact+assays%5BTitle%5D)+AND+%22J+Appl+Toxicol%22%5BJournal%5D)">Different cytotoxicity responses to antimicrobial nanosilver coatings when comparing extract-based and direct-contact assays.</a> J Appl Toxicol. 35 (6), 631-639 (2015).</li>
<li>Cyphert, E. L., Zhang, N., Learn, G. D., Hernandez, C. J., von Recum, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recent+advances+in+the+evaluation+of+antimicrobial+materials+for+resolution+of+orthopedic+implant-associated+infections+in+vivo%5BTitle%5D)+AND+%22ACS+Infect+Dis%22%5BJournal%5D)">Recent advances in the evaluation of antimicrobial materials for resolution of orthopedic implant-associated infections in vivo.</a> ACS Infect Dis. 7 (12), 3125-3160 (2021).</li>
<li>Stavrakis, A. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Current+animal+models+of+postoperative+spine+infection+and+potential+future+advances%5BTitle%5D)+AND+%22Front+Med+%28Lausanne%29%22%5BJournal%5D)">Current animal models of postoperative spine infection and potential future advances.</a> Front Med (Lausanne). 2, 34(2015).</li>
<li>Carli, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantification+of+Peri-implant+bacterial+load+and+in+vivo+biofilm+formation+in+an+innovative%2C+clinically+representative+mouse+model+of+periprosthetic+joint+infection%5BTitle%5D)+AND+%22J+Bone+Joint+Surg+Am%22%5BJournal%5D)">Quantification of Peri-implant bacterial load and in vivo biofilm formation in an innovative, clinically representative mouse model of periprosthetic joint infection.</a> J Bone Joint Surg Am. 99 (6), e25(2017).</li>
<li>Bernthal, N. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+mouse+model+of+post-arthroplasty+Staphylococcus+aureus+joint+infection+to+evaluate+in+vivo+the+efficacy+of+antimicrobial+implant+coatings%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">A mouse model of post-arthroplasty Staphylococcus aureus joint infection to evaluate in vivo the efficacy of antimicrobial implant coatings.</a> PLoS One. 5 (9), e12580(2010).</li>
<li>Kelley, B. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((In+vivo+mouse+model+of+spinal+implant+infection%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">In vivo mouse model of spinal implant infection.</a> J Vis Exp. (160), e60560(2020).</li>
<li>Meroni, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Journey+into+animal+models+of+human+osteomyelitis%3A+A+review%5BTitle%5D)+AND+%22Microorganisms%22%5BJournal%5D)">A Journey into animal models of human osteomyelitis: A review.</a> Microorganisms. 10 (6), 10061135(2022).</li>
<li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mouse+model+of+hematogenous+implant-related+Staphylococcus+aureus+biofilm+infection+reveals+therapeutic+targets%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Mouse model of hematogenous implant-related Staphylococcus aureus biofilm infection reveals therapeutic targets.</a> Proc Natl Acad Sci U S A. 114 (26), E5094-E5102 (2017).</li>
<li>Mitsuhiro Nishizawa, D. H., et al. A novel approach to reducing spinal implant-associated infections. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aMitsuhiro+Nishizawa%2C+DH+%22bioRxiv%22">bioRxiv</a>. , (2024).</li>
<li>Fehlings, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+clinical+practice+guideline+for+the+management+of+patients+with+acute+spinal+cord+injury%3A+Recommendations+on+the+use+of+methylprednisolone+sodium+succinate%5BTitle%5D)+AND+%22Global+Spine+J%22%5BJournal%5D)">A clinical practice guideline for the management of patients with acute spinal cord injury: Recommendations on the use of methylprednisolone sodium succinate.</a> Global Spine J. 7 (3 Suppl), 203S-211S (2017).</li>
<li>Dworsky, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Novel+in+vivo+mouse+model+of+implant-related+spine+infection%5BTitle%5D)+AND+%22J+Orthop+Res%22%5BJournal%5D)">Novel in vivo mouse model of implant-related spine infection.</a> J Orthop Res. 35 (1), 193-199 (2017).</li>
<li>Masters, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Distinct+vasculotropic+versus+osteotropic+features+of+S.+agalactiae+versus+S.+aureus+implant-associated+bone+infection+in+mice%5BTitle%5D)+AND+%22J+Orthop+Res%22%5BJournal%5D)">Distinct vasculotropic versus osteotropic features of S. agalactiae versus S. aureus implant-associated bone infection in mice.</a> J Orthop Res. 39 (2), 389-401 (2021).</li>
<li>Sheppard, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Novel+in+vivo+mouse+model+of+shoulder+implant+infection%5BTitle%5D)+AND+%22J+Shoulder+Elbow+Surg%22%5BJournal%5D)">Novel in vivo mouse model of shoulder implant infection.</a> J Shoulder Elbow Surg. 29 (7), 1412-1424 (2020).</li>
<li>Mansouri, M. D., Ramanathan, V., Al-Sharif, A. H., Darouiche, R. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficacy+of+trypsin+in+enhancing+assessment+of+bacterial+colonization+of+vascular+catheters%5BTitle%5D)+AND+%22J+Hosp+Infect%22%5BJournal%5D)">Efficacy of trypsin in enhancing assessment of bacterial colonization of vascular catheters.</a> J Hosp Infect. 76 (4), 328-331 (2010).</li>
<li>Wang, X., Howe, S., Deng, F., Zhao, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Current+applications+of+absolute+bacterial+quantification+in+microbiome+studies+and+decision-making+regarding+different+biological+questions%5BTitle%5D)+AND+%22Microorganisms%22%5BJournal%5D)">Current applications of absolute bacterial quantification in microbiome studies and decision-making regarding different biological questions.</a> Microorganisms. 9 (9), 9091797(2021).</li>
<li>Lima, A., Franca, A., Muzny, C. A., Taylor, C. M., Cerca, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+extraction+leads+to+bias+in+bacterial+quantification+by+qPCR%5BTitle%5D)+AND+%22Appl+Microbiol+Biotechnol%22%5BJournal%5D)">DNA extraction leads to bias in bacterial quantification by qPCR.</a> Appl Microbiol Biotechnol. 106 (24), 7993-8006 (2022).</li>
<li>Eleaume, H., Jabbouri, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparison+of+two+standardization+methods+in+real-time+quantitative+RT-PCR+to+follow+Staphylococcus+aureus+genes+expression+during+in+vitro+growth%5BTitle%5D)+AND+%22J+Microbiol+Methods%22%5BJournal%5D)">Comparison of two standardization methods in real-time quantitative RT-PCR to follow Staphylococcus aureus genes expression during in vitro growth.</a> J Microbiol Methods. 59 (3), 363-370 (2004).</li>
<li>Vidlak, D., Kielian, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Infectious+dose+dictates+the+host+response+during+Staphylococcus+aureus+orthopedic-implant+biofilm+infection%5BTitle%5D)+AND+%22Infect+Immun%22%5BJournal%5D)">Infectious dose dictates the host response during Staphylococcus aureus orthopedic-implant biofilm infection.</a> Infect Immun. 84 (7), 1957-1965 (2016).</li>
</ol>

The authors declare no competing interests.

This study demonstrated a comprehensive approach for precise quantitative assessments of biofilm formation on multiple implants by leveraging a novel mouse model and optimized analysis techniques for implant-related infection. To ensure that two implants were incubated under identical infection conditions in the same subject, a mature subcutaneous pouch was created within a single mouse through repeated air injections. This model provided a closed and stable environment where two connected implants could be incubated und...

Implant-related infections remain a significant challenge in clinical settings because they may cause high rates of morbidity and mortality in orthopedic surgery despite advances in surgical technique and implant design1. Although the incidence of infections associated with surgical implants has significantly decreased due to modern standards of aseptic control in the operating room environment and appropriate protocols for peri-operative antibiotic prophylaxis, the incidence of implant-related infections in primary surgery remains 2%-5%2.
The primary underlying mechanism of implant-related infections is the formation of a biofilm on the implant surfaces, which protects microorganisms from antibiotics and the immune system, making the infection difficult to eradicate3,4. As bacterial adhesion onto the implant surface is crucial during the first stage of biofilm formation, minimizing bacterial adhesion and subsequent biofilm formation is an essential strategy to reduce the risk of implant-related infections. Despite the antibacterial properties of various implant technologies, these have not been widely used clinically due to adverse events, such as cell toxicity and allergies5,6,7,8. Therefore, there is still an unmet clinical need for antibacterial implants that harmonize safety, efficacy, stability, and durability to reduce the risk of implant-related infections. The research and development of implants with antibacterial properties could advance surgical technology to overcome these problems.
Assessing the antibacterial properties of various biomaterials using small animal models is essential prior to proceeding to larger animal models and clinical trials9. Numerous studies have shown applicable mouse models of implant-related infections using a bioluminescent bacterium, which contains the luxABCDE operon10,11,12,13,14,15. While these models accelerate research into developing antibacterial implants or technologies, they have certain limitations. First, advanced expertise and specialized equipment, such as X-rays or dedicated imaging systems, are often required to assess the bacterial load on the implants placed in mouse models directly and accurately. Second, while collected implants typically evaluate a solitary implant at a single infection site per animal, the infection conditions and immunological responses may vary among individuals, potentially leading to variability in the outcomes of comparative assessments. Therefore, when comparing the antibacterial effects of various biomaterials in vivo, implanting and inoculating them with bacteria in uniform settings is more beneficial to address these issues. Additionally, it is essential to optimize the current methodology and conduct quantitative assessments with reproducibility and accuracy by exploiting the characteristics of the animal model and the bacteria used.
This study presents a novel experimental approach for in vivo implant-related infections that enables precise measurements to assess the biofilm formation on the surfaces of two implants within a single mouse model through comparative inter- and intra-individual analytical methods. The biofilm on each implant can be quantified using optimized methods for visualizing the biofilm on the implant, determining the colony forming units (CFU) and quantitative polymerase chain reaction (qPCR) analysis of a bioluminescent strain of Staphylococcus aureus, Xen 36. The previous study showed that a novel metal implant possesses promising in vivo antibacterial efficacy against Staphylococcus aureus using this comprehensive approach16. This methodology can be easily implemented in a standard laboratory setting and may accelerate research into developing antibacterial biomaterials.

<table><tbody><tr><td>Acetic Acid</td><td>THOMAS SCIENTIFIC</td><td>12-16-15-00</td><td></td></tr><tr><td>Agilent BioTek 800 TS Absorbance Reader</td><td>Agilent</td><td>BT800TS</td><td></td></tr><tr><td>Air-Tite Sterile Hypodermic Needles, Needle Gauge: 18 G</td><td>FISHER SCIENTIFIC</td><td>14817151 (CS)</td><td></td></tr><tr><td>BD Spinal Needles: 25 G</td><td>FISHER SCIENTIFIC</td><td>22043805</td><td></td></tr><tr><td>Benchtop Incubator Shaker</td><td>FISHER SCIENTIFIC</td><td></td><td></td></tr><tr><td>Branson Ultrasonic Bath, 115 Vac, 60 Hz</td><td>FISHER SCIENTIFIC</td><td>2489500</td><td></td></tr><tr><td>Branson Ultrasonics 2510R-MTH (Sonicator)</td><td></td><td>RPI-T48500-500.0</td><td></td></tr><tr><td>Centrifuge sorvall pico</td><td>FISHER SCIENTIFIC</td><td></td><td></td></tr><tr><td>CFX96 Real Time Optics Module qPCR System</td><td>BIO-RAD</td><td></td><td></td></tr><tr><td>Compact Sterilizer, 30L</td><td>THOMAS SCIENTIFIC LLC</td><td>22A00N096 (EA/1)</td><td></td></tr><tr><td>Crystal Violet, 1%, Solution SCI_ED</td><td>FISHER SCIENTIFIC</td><td>10114-58-6</td><td></td></tr><tr><td>Falcon 24-well cell culture plate</td><td>FISHER SCIENTIFIC</td><td>877125</td><td></td></tr><tr><td>Falcon 96-well cell culture plate</td><td>FISHER SCIENTIFIC</td><td>8771001</td><td></td></tr><tr><td>Fisherbrand Digital Vortex Mixer</td><td>FISHER SCIENTIFICS</td><td></td><td></td></tr><tr><td>Kanamycin</td><td>THOMAS SCIENTIFIC LLC&amp;nbsp;</td><td>15160054</td><td></td></tr><tr><td>Mannitol Salt Agar</td><td>&amp;nbsp;&lt;br/&gt; FISHER SCIENTIFIC&amp;nbsp;</td><td></td><td></td></tr><tr><td>Micirobiological Incubator</td><td>Thermo Scientific</td><td>51028063H</td><td></td></tr><tr><td>PBS, Phosphate Buffered Saline</td><td></td><td></td><td></td></tr><tr><td>Staphylococcus aureus ATCC 49525 (Xen36)</td><td>Perkin Elmer</td><td>119243</td><td></td></tr><tr><td>SYBR Green I Nucleic Acid Gel Stain</td><td>FISHER SCIENTIFIC</td><td></td><td></td></tr><tr><td>Trypsin 10x (2.5%)</td><td>FISHER SCIENTIFIC</td><td>15090046</td><td></td></tr><tr><td>Tryptic Soy Broth&amp;nbsp;</td><td>NETA SCIENTIFIC INC&amp;nbsp;</td><td></td><td></td></tr><tr><td>Zyppy Plasmid Miniprep Ki</td><td>FISHER SCIENTIFIC</td><td>501977785</td><td>pellet-free modified alkaline lysis system</td></tr></tbody></table>

a unique mouse model for quantitative assessment of biofilm formation on surgical implants in subcutaneous abscess

A Unique Mouse Model for Quantitative Assessment of Biofilm Formation on Surgical Implants in Subcutaneous Abscess

To develop a novel biomaterial with antibacterial properties for orthopedic surgical procedures, establishing an experimental animal model of implant-related infections that closely mimics the pathological state is crucial. Additionally, a quantitative comparison with control samples is required to assess biofilm formation on materials. However, current animal models, which involve implanting each individual with a single material, may yield inconsistent outcomes due to the heterogeneity of infection status among subjects. Furthermore, accurately quantifying biofilm formation on materials in vivo remains challenging, and the findings may lack reliability. To address these issues, this study demonstrated a unique mouse model of implant-related infection that enables the simultaneous incubation of two implants with bacteria in an enclosed environment within a single mouse, forming an encapsulated subcutaneous abscess. A mature air pouch was initially created beneath the skin of the back. Two stainless steel wires were connected and placed into the pouch, followed by the inoculation of Xen 36, a bioluminescent strain of Staphylococcus aureus. By 14 days after inoculation, a subcutaneous abscess had formed around the wires. The biofilm was completely removed from the surface of each wire, and the dissolved bacterial suspensions were accurately measured using optimized methods to assess biofilm formation on the implant, determine colony-forming units, and perform quantitative polymerase chain reaction analysis. By leveraging the lux operon of the bioluminescent bacteria, the relative expression levels of luxA and 16S rRNA were used to determine the bacterial load within the biofilm on each wire. This optimized comparative analytical approach enables precise assessments of biofilm formation on two wires under uniform infection conditions within a single mouse model and may facilitate the advancement of biomaterials with antibacterial properties.

This study evaluated the reliability of a comprehensive approach using a novel mouse model of implant-related infection with optimized quantitative assessments of biofilm formation on implant surfaces, which has been used in the previous study16. The two identical implants were used to examine the biofilm formed on their surfaces, aiming to verify that both implants could be incubated simultaneously in uniform infection conditions within a solitary subcutaneous spa...

This protocol describes a unique experimental model of implant-related infections that enables the simultaneous incubation of two implants with bacteria under identical conditions within a single mouse. It also allows precise assessment of biofilm formation on implant surfaces using optimized comparative analytical methods, demonstrating advanced techniques for evaluating biomaterials' antimicrobial properties.

To develop a novel biomaterial with antibacterial properties for orthopedic surgical procedures, establishing an experimental animal model of ...

Our research aims to develop innovative treatment for implant-related infections. To evaluate novel biomaterials with potential antimicrobial properties, we develop more precious in vivo testing approach. Prior animal models are typically limited to producing a single implant-related infection per animal, which can lead to significant variability in the average outcomes obtained from multiple animals.Our mouse model allows a direct comparison of the two imprints, subjected to identical infectious conditions within a single animal, hence providing a precious assessment of the antibacterial activity. Our in vivo experimental methodology will accelerate research on potentially antimicrobial biomaterials, contributing to the development of new treatment for implant-related infections in the future. Our experimental approach is replicable with standard equipment and simple procedures in a conventional research setting, hence enhancing comprehension of the mechanisms behind antibacterial activity.To begin, position the anesthetized mouse on the surgical bed. Fill a 10 milliliter syringe with sterile air and attach a 27 gauge needle to the outlet. Now, gently pinch and elevate the base of the mouse's neck to create space between the subcutaneous tissue and the fascia.Place the needle into the midline between the mouse's scapulae and inject three milliliters of sterile air subcutaneously to create the air pouch. Then return the mouse to a cage warmed with a thermal pad. Inject three milliliters of sterile air every two days to maintain the cavity's inflation and create a mature pouch.After anesthetizing the animal, inject it with bupivacaine subcutaneously. Make a three millimeter midline longitudinal incision at the top of the pouch and insert an 18 gauge needle containing the connected wires into the pouch through the hole. Push out the wires using an inner syringe of a 25 gauge spinal needle.Leaving the tip of the 18 gauge needle inside the pouch, gently remove the inner cylinder and inject Xen36 culture using the syringe carefully. Remove all needles, close the skin using a wound clip and seal with topical skin adhesive. Finally, return the mouse to a cage warmed with a thermal pad for monitoring.Crystal violet staining showed consistent biofilm formation on both wires without observable differences. Absorbance measurements from the dissolved crystal violet assay showed no statistically significant differences in bacterial load between the two wires. Colony-forming unit counting and quantitative PCR analysis of 16s ribosomal RNA and LuxA genes showed no statistically significant differences in bacterial load between the two wires.

a-unique-mouse-model-for-quantitative-assessment-biofilm-formation-on

Research

JoVE Journal

Immunology and Infection

Source: de Vries, C. R., et.al. A Delayed Inoculation Model of Chronic Pseudomonas aeruginosa Wound Infection. J. Vis. Exp. (2020)This video demonstrates the delayed inoculation of luminescent Pseudomonas aeruginosa into a mouse bearing two full-thickness dorsal skin wounds covered by a transparent film dressing. This facilitates biofilm formation and the establishment of chronic infection. Regular bioluminescence monitoring enables quantification of bacterial burden and tracking of infection...

Developing a Mouse Model of Chronic Pseudomonas aeruginosa Skin Wound Infection 

Source: Zhang, C., et al., Development and Assessment of Intracellular Infection Models for Staphylococcus aureus. J. Vis. Exp. (2025)The video demonstrates the isolation of kidneys containing Staphylococcus aureus-infected macrophages, followed by tissue homogenization to release intracellular bacteria. It quantifies bacterial persistence within macrophages in control and antibiotic-treated groups by counting colony-forming units.

Assessing Intracellular Bacterial Persistence and Antibiotic Resistance in a Mouse Model

This video demonstrates the development of an in vivo mouse model to study the biofilm formation of Candida albicans in subcutaneous tissue. The experiment involves implanting Candida-infected devices in the animal's back region for biofilm development.

Candida albicans Biofilm Formation in an In Vivo Mouse Model

Combined optical and μCT imaging in a mouse model of orthopaedic implant infection, utilizing a bioluminescent engineered strain of Staphylococcus aureus, provided the capability to noninvasively and longitudinally monitor the dynamics of the bacterial infection, as well as the corresponding inflammatory response and anatomical changes in the bone.

Combined In vivo Optical and &#181;CT Imaging to Monitor Infection, Inflammation, and Bone Anatomy in an Orthopaedic Implant Infection in Mice

We present an experimental procedure of Candida albicans biofilm development in a mouse subcutaneous model. Fungal biofilms were quantified by determining the number of colony forming units and by a non-invasive bioluminescence imaging, where the amount of light that is produced corresponds with the number of viable cells.

Candida albicans Biofilm Development on Medically-relevant Foreign Bodies in a Mouse Subcutaneous Model Followed by Bioluminescence Imaging

Here we describe a novel diabetic murine model utilizing hairless mice for real-time, non-invasive, monitoring of biofilm wound infections of bioluminescent Pseudomonas aeruginosa. This method can be adapted to evaluate infection of other bacterial species and genetically modified microorganisms, including multi-species biofilms, and test the efficacy of antibiofilm strategies.

Come to the Light Side: In Vivo Monitoring of Pseudomonas aeruginosa Biofilm Infections in Chronic Wounds in a Diabetic Hairless Murine Model

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

The protocol describes a novel in vivo mouse model of spinal implant infection where a stainless-steel k-wire implant is infected with bioluminescent Staphylococcus aureus Xen36. Bacterial burden is monitored longitudinally with bioluminescent imaging and confirmed with colony forming unit counts after euthanasia.

In Vivo Mouse Model of Spinal Implant Infection

We describe a delayed inoculation protocol for generating chronic wound infections in immunocompetent mice.

A Delayed Inoculation Model of Chronic Pseudomonas aeruginosa Wound Infection

Periprosthetic joint infection (PJI) caused by dangerous pathogens is common in clinical orthopedics. Existing animal models cannot accurately simulate the actual situation of PJI. Here, we established a Candida albicans biofilm-associated PJI mouse model to research and develop new therapeutics for PJI.

A Periprosthetic Joint Candida albicans Infection Model in Mouse

The present protocol describes a mouse model employing subcutaneous dorsal implantation to investigate implant-associated infections, enabling comprehensive investigation of pathophysiological mechanisms and supporting the development of diagnostic criteria with targeted therapeutic strategies.

Animal Model of Implant-Associated Infections in Mice

Learn a unique mouse model for quantitative biofilm assessment on surgical implants in subcutaneous abscess. This method enables simultaneous comparison of two implants under identical infectious conditions.

A Unique Mouse Model for Quantitative Assessment of Biofilm Formation on Surgical Implants in Subcutaneous Abscess

Explore More Videos