Name: A Neonatal Mouse Model of Necrotizing Enterocolitis and Lamina Propria Isolation for Immune Cell Profiling (Video) | JoVE Journal
Uploaded: 2025-09-19T14:40:00.000+00:00
Duration: 9 min 13 s
Description: Learn a neonatal mouse model of necrotizing enterocolitis using formula feeding, hypoxia, LPS, and patient-derived bacteria. Isolate lamina propria immune cells for flow cytometry profiling to study NEC pathogenesis.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This manuscript was supported by R01DK124614, R01HD105301, DP1DK140012, the Chan Zuckerberg Initiative Grant number 2022-316749, the Yang Biomedical Scholar Award, and the University of North Carolina at Chapel Hill Department of Pediatrics.

All methods were performed in accordance with the ethical guidelines provided by the Institutional Animal Care and Use Committee (IACUC) at the University of North Carolina at Chapel Hill School of Medicine. Mice were bred, maintained, and housed according to procedures described in the Guide for the Care and Use of Laboratory Animals under a study proposal approved by the IACUC (protocol no. 24-114) of the University of North Carolina at Chapel Hill School of Medicine. C57BL/6J mice were used for all experiments described in this study. Pups were started in the model at postnatal day 4, weighing between 1.8-2.3 g; animals outside this weight range were excluded. The experimental cohorts had a balanced sex distribution, with males and females each comprising approximately 50% of the treated animals. The reagents and the equipment used are listed in the Table of Materials.
1. Murine NEC model
NOTE: Enteric bacterial stock is produced by obtaining the enteric contents from an infant who had the most severe form of NEC, NEC totalis13,16. The enteric contents are cultured overnight at 1 x g for 16 h at 37 &#176;C, centrifuged at 3000 x g for 10 min at 4 &#176;C, and resuspended in 50% glycerol. 20 &#181;L aliquots are pipetted into cryovials and stored at -80 &#176;C for long-term storage. The selected culture times in this protocol were chosen for workflow efficiency. These time points can be adjusted as needed to accommodate individual laboratory schedules without impacting the overall model. Additionally, this protocol was optimized for a maximum capacity of 40 mice, but can be scaled up as needed.
<ol>
	<li>Preparing bacterial culture
	<ol>
		<li>On experimental day 0 at 15:00, add a 20 &#181;L aliquot of enteric bacteria cultured from an infant with NEC totalis to a 15 mL culture tube containing 2 mL of Luria-Bertani (LB) broth. Incubate the bacterial culture with the tube lid in the vented position in an orbital shaker at 37&#176;C, 1 x g, overnight for 16 h, and incubate a culture tube containing only 2 mL of LB broth concurrently as a control to assess for any LB contamination.
		<ol>
			<li>Visually confirm the overnight culture by comparing the turbidity between the bacterial culture and the clear, LB-only control; proceed only if the bacterial culture appears turbid and the control remains clear.</li>
		</ol>
		</li>
		<li>On experimental day 1, at 07:00, aliquot 125 &#181;L of the inoculated overnight culture into a T75 cell culture flask with a vented lid containing 25 mL of LB broth. Prepare four T75 flasks in total and incubate them in an upright position in an orbital shaker at 37&#176;C, 1 x g, for 2 h to expand the bacterial culture. 
		NOTE: Overnight cultures are prepared on experimental days 0, 1, and 2 of the NEC model.</li>
	</ol>
	</li>
	<li>Allocating pups into experimental groups
	<ol>
		<li>On experimental day 1 at 07:00, weigh postnatal day 4 pups. 
		&#8203;NOTE: The optimal weight range is between 1.8-2.3 g, and outliers should be removed from the experiment.</li>
		<li>Group the experimental mice into formula-fed and dam-fed cohorts and calculate the average weight of the formula-fed mice. Separate the designated formula-fed mice from the dam and place them in a new cage housed in an infant incubator pre-heated to 37 &#176;C. Keep the dam-fed pups in the original cage with the dam. 
		NOTE: Neonatal mice are particularly sensitive to changes in ambient temperature. To maintain consistent temperature regulation after separation from the dam, formula-fed pups are kept in a temperature-controlled infant incubator set at 37 &#176;C. This approach is consistent with established NEC protocols that preserve physiologic temperature without the use of additional thermal interventions11,17,18,19.</li>
		<li>Repeat on experimental days 2 and 3, weighing the formula-fed mice and calculating the average weight prior to the 07:00 feeding time point daily.</li>
	</ol>
	</li>
	<li>Measuring Optical Density (OD) of bacterial culture
	<ol>
		<li>After 2 h of incubation at 37 &#176;C and 1 x g, remove the four T75 flasks with expanded culture from the orbital shaker on experimental days 1, 2, and 3. Combine the contents of the four T75 flasks, mix well, and pipette 1 mL of the bacterial culture into a cuvette.
		<ol>
			<li>Prepare a blank solution by adding 1 mL of sterile LB broth to a cuvette. Measure the optical density of the bacterial culture at 600 nm (OD600nm) with a spectrophotometer. 
			NOTE: The target OD600nm is 0.6&#160;&#177; 0.02. If the OD600nm of the bacterial culture is below the target value, continue incubation as described in step 1.3.1. until the target OD600nm of 0.6&#160;&#177; 0.02 is reached. If the OD600nm is over 0.6, dilute the bacterial culture with sterile LB broth.</li>
		</ol>
		</li>
		<li>Transfer 80 mL of the bacterial culture into two 50 mL centrifuge tubes and centrifuge at 3000 x g for 10 min at 4 &#176;C. Confirm successful culture by checking for a visible pellet at the bottom of each tube.</li>
	</ol>
	</li>
	<li>Formula preparation
	<ol>
		<li>Begin formula preparation at 09:00 on experimental days 1, 2, and 3. Combine 16 mL of infant formula and 8 mL of puppy milk in a 2:1 ratio in a sterile 50 mL centrifuge tube.</li>
		<li>Remove the supernatant from the two 50 mL centrifuge tubes containing pelleted bacterial culture (step 1.3.2).</li>
		<li>Thoroughly resuspend each of the two pellets in 2 mL of the formula mix and transfer the resuspension to the formula mix to make 24 mL of the NEC formula. 
		NOTE: The final bacterial concentration in the NEC formula should be between 4 and 5 x 109 CFU/mL.</li>
		<li>Label six 50 mL centrifuge tubes for each of the six feeding time points (10:00, 13:00, 16:00, 19:00, 22:00, 07:00).</li>
		<li>Pipette 4 mL of the NEC formula into each labeled tube.</li>
		<li>Prepare six single-use aliquots of LPS (5 mg/mL) stock and store in low-binding microtubes at -20&#176;C. Add LPS (see NOTE for concentration) to the NEC formula immediately before feeding at each time point. 
		NOTE: The amount of LPS added to the NEC formula is based on the average body weight of the formula-fed pups calculated at 07:00 each day, using a dosage of 5 &#181;g of LPS per gram of the body weight of the pups. The final LPS concentration varies with body weight. For example, with a feeding volume of 80 &#181;L and an average pup cohort weight of 2 grams, the LPS concentration in the formula would be 0.125 mg/mL.</li>
	</ol>
	</li>
	<li>Feeding 
	NOTE: On experimental day 1, mice to be placed in the NEC model are fasted for 3 h after separation from their dam. The first NEC formula feed is at 10:00 and continues every 3 h until 22:00. On experimental days 2 and 3, mice are fed at 07:00, 10:00, 13:00, 16:00, 19:00, and 22:00. Mice are not fed on experimental day 4.
	<ol>
		<li>Immediately prior to feeding mice, thaw and vortex one aliquot of LPS for 15 s. Add the appropriate amount of LPS based on the average weight of the mice to the 4 mL prepared tube of NEC formula (see step 1.4.6 for calculation) and thoroughly mix by pipetting.</li>
		<li>Fill a 1 mL syringe with NEC formula and attach a neonatal peripherally inserted central catheter (PICC) line. Ensure there are no bubbles or air in the syringe or the PICC line.</li>
		<li>Administer the NEC formula to the pups via oral gavage with the PICC line.
		<ol>
			<li>Gently restrain each pup by the loose skin at the base of its neck and hold the mouse in an upright position. Using forceps, guide the distal end of the PICC line into the oropharynx and esophagus, positioning the tip of the PICC line within the stomach. 
			NOTE: The insertion distance of the PICC line is equal to the distance from the corner of the mouth to the top of the milk spot in the stomach. The optimal insertion point should then be clearly marked on the PICC line using a permanent marker.</li>
			<li>If significant resistance is felt during the PICC line insertion, remove the PICC line, reposition, and carefully reattempt the insertion.</li>
			<li>Dispense 8&#8239;&#181;L of NEC formula slowly into the stomach, monitoring the pup closely throughout the feeding for signs of aspiration. Observe for the appearance of a white milk spot to confirm successful gastric delivery.</li>
			<li>Remove the PICC line. Observe the pup for any labored breathing or emesis. If the pup regurgitates formula, blot the mouth and nose with a low-lint laboratory wipe.</li>
		</ol>
		</li>
		<li>Repeat this process at every feeding time point.</li>
		<li>Twice daily, subject the pups to hypoxia for 10 min immediately following the 13:00 and 19:00 feeding times.
		<ol>
			<li>After two feeds per day, place the pups in a hypoxia chamber connected to a gas tank containing 95% nitrogen and 5% oxygen. Open the tank valve and monitor the oxygen levels within the sealed hypoxia chamber using a handheld monitor. Once the hypoxia chamber reaches 5%&#177; 0.5% oxygen, maintain the pups at this oxygen level for 10 min. 
			NOTE: The flow rate should be optimized to decrease from 20% to 5% oxygen at a steady, controlled rate over a 2 min period.</li>
		</ol>
		</li>
		<li>Watch the mouse pups between feedings for any signs of respiratory distress, pale discoloration, or apnea. If these signs are present, remove the affected pup from the hypoxia chamber, watch carefully for recovery, and if needed, euthanize the pups in accordance with IACUC policy.</li>
		<li>Continue oral gavage feeding and hypoxia exposure at scheduled time points for the full 72 h duration of the NEC model. 
		NOTE: If experimental day 1 starts Monday at 10:00, the 72 h endpoint will occur at 10:00 on Thursday. This is designated as day 4 of the model. Mice are not fed at 07:00 on day 4 of the model, and are euthanized at this final 10:00 time point for tissue collection.</li>
	</ol>
	</li>
	<li>Euthanizing animals and collecting tissue
	<ol>
		<li>On the morning of Day 4 of the model, weigh and record the sex of each pup, then euthanize in accordance with IACUC guidelines.</li>
		<li>Following euthanasia, collect blood from each pup into a serum separator tube containing a clot activator and gel.</li>
		<li>Centrifuge at 16,000 x g for 20 min at 4 &#176;C to separate the serum. Pipette the serum into labeled 1.7 mL tubes and store at -80 &#176;C.</li>
		<li>Make a 1-2 cm midline incision through the abdominal wall and the peritoneum to expose the gastrointestinal tract. Inspect the exposed intestine for hallmark features of NEC, including distension, erythema, gas accumulation within the intestinal wall (pneumatosis intestinalis), and visible air bubbles.</li>
		<li>Identify and resect the duodenum through the distal rectum. Place the tissue in a Petri dish on ice. Use ice-cold Phosphate-Buffered Saline (PBS) to rinse the intestine.</li>
		<li>Identify the cecum and cut proximally to separate the cecum and colon from the small intestine. Section off pieces starting at the distal ileum and working towards the jejunum. Place a 1 cm piece in a tube containing RNA lysis buffer and 1.5 mm zirconium oxide beads on ice for transcriptional analysis.
		<ol>
			<li>Flush a 1.5 cm piece with a syringe containing PBS attached to a 24 G blunt-end needle, and then place it in a microcentrifuge tube containing 1 mL of 4% paraformaldehyde (PFA). Snap freeze a 1 cm piece of intestine and store at -80 &#176;C for protein analysis. Snap freeze a 1 cm piece of intestine and store at -80 &#176;C for any additional assays.</li>
		</ol>
		</li>
		<li>Process tissue collected into RNA lysis buffer in a bead beater (5.50 m/s, 1.0 min., cycle = 1.0, pause dwell: 10 s, 4 &#176;C) to homogenize the tissue, then store at -80 &#176;C.</li>
	</ol>
	</li>
	<li>Tissue fixation
	<ol>
		<li>Place tissue pieces collected in 4% PFA on a rocker at 4 &#176;C to fix for 24 h. After 24 h, remove 4% PFA from each tube and replace with 1 mL PBS to wash the tissue. Return the tubes to the rocker at 4 &#176;C for 15 min. Repeat the PBS wash once.
		<ol>
			<li>Remove the PBS and add 1 mL of 50% ethanol to each tube and return the tubes to the rocker at 4 &#176;C for 15 min. Remove the 50% ethanol and add 1 mL of 70% ethanol, and store at 4 &#176;C until tissue can be processed into paraffin histology blocks. 
			NOTE: Additional intestinal segments or stool samples may be collected as needed for further analysis.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Lamina propria immune cell isolation
NOTE: This protocol is optimized for the isolation of lamina propria cells from neonatal mice at approximately one week of age. If reference samples are needed for spectral flow cytometry, weanlings (postnatal weeks 3-4) may be used. For weanling samples, double all reagent volumes specified in the protocol.
<ol>
	<li>Preparing reagents
	<ol>
		<li>Prepare 1x Hank&#39;s balanced salt solution without Ca2+ and Mg2+ (HBSS W/O) containing 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) and store at room temperature.</li>
		<li>Prepare fluorescent-activated cell sorting (FACS) buffer by dissolving 5% bovine serum albumin (BSA) in PBS + 5 mM ethylenediaminetetraacetic acid (EDTA) and store at 4 &#176;C.</li>
		<li>The day before performing lamina propria cell isolation, prepare pre-digestion solution by adding 5mM EDTA, 5% fetal bovine serum (FBS), and 1 mM dithiothreitol (DTT) to HBSS W/O.</li>
		<li>Prepare digestion solution immediately before performing lamina propria cell isolation by supplementing Roswell Park Memorial Institute 1640 medium (RPMI) with 10% FBS and &#8239;mg/mL collagenase IV. 
		NOTE: HBSS W/O can be prepared in advance and stored at room temperature. FACS buffer should be prepared in advance and stored at 4 &#176;C. Pre-digestion and digestion solutions must be prepared fresh immediately before performing lamina propria isolation and kept on ice.</li>
	</ol>
	</li>
	<li>Collecting and preparing intestinal tissue for digestion
	<ol>
		<li>Locate the cecum and transect proximally to remove the cecum and colon. Excise 2-3 cm of distal small intestine (ileum) and place it on ice-cold HBSS W/O in a petri dish (resuming from step 1.6.5).</li>
		<li>Using a 24 G blunt-end needle attached to a syringe, flush the intestinal lumen completely with ice-cold HBSS W/O while stabilizing the tissue with forceps. Visually confirm that the intestinal lumen is free of stool after flushing.</li>
		<li>Carefully remove any remaining connective tissue from the intestinal segment using fine forceps or scissors.</li>
		<li>Cut the intestine longitudinally to open, then section transversely into 1-1.&#8239;cm segments.</li>
	</ol>
	</li>
	<li>Lamina propria dissociation
	<ol>
		<li>Transfer intestinal segments into a 1&#8239;mL centrifuge tube containing 1&#8239;mL of pre-digestion solution that has been cooled on ice.</li>
		<li>Incubate the sample at 37 &#176;C for 20 min with continuous rotation to facilitate tissue dissociation.</li>
		<li>Gently swirl the tube, then pour the contents through a 10&#8239;&#181;m cell strainer placed over a 5&#8239;mL centrifuge tube. 
		NOTE: The filtrate collected through the 10&#8239;&#181;m strainer contains intraepithelial lymphocytes (IELs) and can be used for downstream analysis if desired.</li>
		<li>Transfer tissue fragments into a new 15 mL centrifuge tube containing 10 mL of pre-heated to 37 &#176;C digestion solution. Subsequently, incubate the sample for 40 min at 37 &#176;C with continuous rotation.</li>
		<li>Transfer the entire sample into an automated tissue dissociation tube and run the dissociation program consisting of four rotation cycles of 15 s each, alternating between clockwise and counterclockwise directions. 
		NOTE: An alternative to an automated tissue dissociator is manually grinding the intestinal tissue using the frosted tips of two microscope slides. If using this method, apply gentle, even pressure to avoid excessive mechanical stress, as this can significantly reduce cell viability.</li>
		<li>Gently vortex the cell suspension, then centrifuge the samples in the tissue dissociation tube at 300 &#215; g for 5 min at 4 &#176;C.</li>
		<li>Carefully aspirate the supernatant without disturbing the pellet, then resuspend the cells in &#8239;mL of ice-cold FACS buffer.</li>
		<li>Place a 10&#8239;&#181;m cell strainer on a 5&#8239;mL centrifuge tube. Transfer the resuspended cell suspension through the filter, then wash the filter with an additional &#8239;mL of ice-cold FACS buffer.</li>
		<li>Count cells and assess viability using trypan blue or a viability dye. Centrifuge the volume required for flow cytometry at 30&#8239;&#215;&#8239;g for 5 min at 4 &#176;C. Use cells immediately for downstream applications to preserve viability and marker expression.</li>
	</ol>
	</li>
</ol>

<ol><li>Alsaied, A., Islam, N., Thalib, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Global+incidence+of+necrotizing+enterocolitis%3A+A+systematic+review+and+meta-analysis%5BTitle%5D)+AND+%22BMC+Pediatr%22%5BJournal%5D)">Global incidence of necrotizing enterocolitis: A systematic review and meta-analysis.</a> BMC Pediatr. 20 (1), 344(2020).</li>
<li>Warner, B. B., Tarr, P. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Necrotizing+enterocolitis+and+preterm+infant+gut+bacteria%5BTitle%5D)+AND+%22Semin+Fetal+Neonatal+Med%22%5BJournal%5D)">Necrotizing enterocolitis and preterm infant gut bacteria.</a> Semin Fetal Neonatal Med. 21 (6), 394-399 (2016).</li>
<li>Rose, A. T., Patel, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+critical+analysis+of+risk+factors+for+necrotizing+enterocolitis%5BTitle%5D)+AND+%22Semin+Fetal+Neonatal+Med%22%5BJournal%5D)">A critical analysis of risk factors for necrotizing enterocolitis.</a> Semin Fetal Neonatal Med. 23 (6), 374-379 (2018).</li>
<li>Tanner, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pathogenesis+of+necrotizing+enterocolitis%3A+Modeling+the+innate+immune+response%5BTitle%5D)+AND+%22Am+J+Pathol%22%5BJournal%5D)">Pathogenesis of necrotizing enterocolitis: Modeling the innate immune response.</a> Am J Pathol. 185 (1), 4-16 (2015).</li>
<li>Leaphart, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+critical+role+for+TLR4+in+the+pathogenesis+of+necrotizing+enterocolitis+by+modulating+intestinal+injury+and+repair1%5BTitle%5D)+AND+%22J+Immunol%22%5BJournal%5D)">A critical role for TLR4 in the pathogenesis of necrotizing enterocolitis by modulating intestinal injury and repair1.</a> J Immunol. 179 (7), 4808-4820 (2007).</li>
<li>Hackam, D. J., Sodhi, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Toll-like+receptor-mediated+intestinal+inflammatory+imbalance+in+the+pathogenesis+of+necrotizing+enterocolitis%5BTitle%5D)+AND+%22Cell+Mol+Gastroenterol+Hepatol%22%5BJournal%5D)">Toll-like receptor-mediated intestinal inflammatory imbalance in the pathogenesis of necrotizing enterocolitis.</a> Cell Mol Gastroenterol Hepatol. 6 (2), 229-238.e1 (2018).</li>
<li>Sulistyo, A., Rahman, A., Biouss, G., Antounians, L., Zani, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Animal+models+of+necrotizing+enterocolitis%3A+Review+of+the+literature+and+state+of+the+art%5BTitle%5D)+AND+%22Innov+Surg+Sci%22%5BJournal%5D)">Animal models of necrotizing enterocolitis: Review of the literature and state of the art.</a> Innov Surg Sci. 3 (2), 87-92 (2018).</li>
<li>Lopez, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Models+of+necrotizing+enterocolitis%5BTitle%5D)+AND+%22Semin+Perinatol%22%5BJournal%5D)">Models of necrotizing enterocolitis.</a> Semin Perinatol. 47 (1), 151695(2023).</li>
<li>Jilling, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+roles+of+bacteria+and+TLR4+in+rat+and+murine+models+of+necrotizing+enterocolitis%5BTitle%5D)+AND+%22J+Immunol%22%5BJournal%5D)">The roles of bacteria and TLR4 in rat and murine models of necrotizing enterocolitis.</a> J Immunol. 177 (5), 3273-3282 (2006).</li>
<li>Mihi, B., Lanik, W. E., Gong, Q., Good, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+mouse+model+of+necrotizing+enterocolitis%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">A mouse model of necrotizing enterocolitis.</a> Methods Mol Biol. 2321, 101-110 (2021).</li>
<li>Nolan, L. S., Gong, Q., Hofmeister, H. N., Good, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+protocol+for+the+induction+of+experimental+necrotizing+enterocolitis+in+neonatal+mice%5BTitle%5D)+AND+%22STAR+Protoc%22%5BJournal%5D)">A protocol for the induction of experimental necrotizing enterocolitis in neonatal mice.</a> STAR Protoc. 2 (4), 100951(2021).</li>
<li>Kaplina, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Necrotizing+enterocolitis%3A+The+role+of+hypoxia%2C+gut+microbiome%2C+and+microbial+metabolites%5BTitle%5D)+AND+%22Int+J+Mol+Sci%22%5BJournal%5D)">Necrotizing enterocolitis: The role of hypoxia, gut microbiome, and microbial metabolites.</a> Int J Mol Sci. 24 (3), 2471(2023).</li>
<li>Good, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Lactobacillus+rhamnosus+hn001+decreases+the+severity+of+necrotizing+enterocolitis+in+neonatal+mice+and+preterm+piglets%3A+Evidence+in+mice+for+a+role+of+TLR9%5BTitle%5D)+AND+%22Am+J+Physiol+Gastrointest+Liver+Physiol%22%5BJournal%5D)">Lactobacillus rhamnosus hn001 decreases the severity of necrotizing enterocolitis in neonatal mice and preterm piglets: Evidence in mice for a role of TLR9.</a> Am J Physiol Gastrointest Liver Physiol. 306 (11), G1021-G1032 (2014).</li>
<li>Denning, T. L., Bhatia, A. M., Kane, A. F., Patel, R. M., Denning, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pathogenesis+of+nec%3A+Role+of+the+innate+and+adaptive+immune+response%5BTitle%5D)+AND+%22Semin+Perinatol%22%5BJournal%5D)">Pathogenesis of nec: Role of the innate and adaptive immune response.</a> Semin Perinatol. 41 (1), 15-28 (2017).</li>
<li>Yu, Y. -R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+protocol+for+the+comprehensive+flow+cytometric+analysis+of+immune+cells+in+normal+and+inflamed+murine+non-lymphoid+tissues%5BTitle%5D)+AND+%22PLOS+ONE%22%5BJournal%5D)">A protocol for the comprehensive flow cytometric analysis of immune cells in normal and inflamed murine non-lymphoid tissues.</a> PLOS ONE. 11 (3), e0150606(2016).</li>
<li>Mihi, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Interleukin-22+signaling+attenuates+necrotizing+enterocolitis+by+promoting+epithelial+cell+regeneration%5BTitle%5D)+AND+%22Cell+Rep+Med%22%5BJournal%5D)">Interleukin-22 signaling attenuates necrotizing enterocolitis by promoting epithelial cell regeneration.</a> Cell Rep Med. 2 (6), 100320(2021).</li>
<li>Bautista, G. M., Cera, A. J., Chaaban, H., Mcelroy, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((State-of-the-art+review+and+update+of+in+vivo+models+of+necrotizing+enterocolitis%5BTitle%5D)+AND+%22Front+Pediatr%22%5BJournal%5D)">State-of-the-art review and update of in vivo models of necrotizing enterocolitis.</a> Front Pediatr. 11, 1161342(2023).</li>
<li>Sodhi, C. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+human+milk+oligosaccharides+2%27-fucosyllactose+and+6%27-sialyllactose+protect+against+the+development+of+necrotizing+enterocolitis+by+inhibiting+toll-like+receptor+4+signaling%5BTitle%5D)+AND+%22Pediatr+Res%22%5BJournal%5D)">The human milk oligosaccharides 2'-fucosyllactose and 6'-sialyllactose protect against the development of necrotizing enterocolitis by inhibiting toll-like receptor 4 signaling.</a> Pediatr Res. 89 (1), 91-101 (2021).</li>
<li>Blum, L., Vincent, D., Boettcher, M., Knopf, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Immunological+aspects+of+necrotizing+enterocolitis+models%3A+A+review%5BTitle%5D)+AND+%22Front+Immunol%22%5BJournal%5D)">Immunological aspects of necrotizing enterocolitis models: A review.</a> Front Immunol. 15, 1434281(2024).</li>
<li>Nolan, L. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Indole-3-carbinol-dependent+aryl+hydrocarbon+receptor+signaling+attenuates+the+inflammatory+response+in+experimental+necrotizing+enterocolitis%5BTitle%5D)+AND+%22Immunohorizons%22%5BJournal%5D)">Indole-3-carbinol-dependent aryl hydrocarbon receptor signaling attenuates the inflammatory response in experimental necrotizing enterocolitis.</a> Immunohorizons. 5 (4), 193-209 (2021).</li>
<li>Valle-Noguera, A., Gómez-Sánchez, M. J., Girard-Madoux, M. J. H., Cruz-Adalia, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimized+protocol+for+characterization+of+mouse+gut+innate+lymphoid+cells%5BTitle%5D)+AND+%22Front+Immunol%22%5BJournal%5D)">Optimized protocol for characterization of mouse gut innate lymphoid cells.</a> Front Immunol. 11, 563414(2020).</li>
<li>Booth, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+and+functional+properties+of+gastric+tissue-resident+memory+T+cells+from+children%2C+adults%2C+and+the+elderly%5BTitle%5D)+AND+%22Front+Immunol%22%5BJournal%5D)">Characterization and functional properties of gastric tissue-resident memory T cells from children, adults, and the elderly.</a> Front Immunol. 5, 294(2014).</li>
</ol>

The authors declare no conflict of interest related to this manuscript.

This protocol integrates a physiologically relevant neonatal murine model of NEC with lamina propria immune cell isolation, providing a comprehensive platform to investigate mucosal immune responses during intestinal inflammation. By combining clinically relevant exposures, such as enteric microbiome from human NEC cases, hypoxic stress, and formula feeding, this model recapitulates the complex and multifactorial pathogenesis observed in human disease10,13. The a...

Necrotizing enterocolitis (NEC) is a severe inflammatory disease of the intestine that almost exclusively affects premature neonates. Approximately 7%-8% of very low birth weight infants (&#60;1500 g) will be affected by NEC, and mortality rates associated with the disease can approach 50% in neonates that require surgical intervention1. The pathogenesis of NEC remains incompletely understood; however, current evidence suggests that NEC arises from the confluence of multiple factors, including an immature intestinal barrier, dysregulated immune signaling, and a dysbiotic microbiome2,3,4. The convergence of these factors can initiate and exacerbate inflammatory responses in the intestine, most notably through the activation of toll-like receptor 4 (TLR4), resulting in epithelial damage and various types of cell death, including apoptosis and necrosis5,6. The aim of this protocol is to present a reproducible and physiologically relevant mouse model of NEC that recapitulates the intestinal inflammation and pneumatosis intestinalis (gas within the bowel wall) observed in human neonates, enabling mechanistic investigation into disease pathogenesis. Additionally, this protocol describes the isolation of immune cells from the small intestinal lamina propria of neonatal mice, allowing researchers to perform immune cell profiling via flow cytometry.
Compared to larger animal models, such as neonatal rats or piglets7,8,&#160;neonatal mouse models offer several distinct advantages, including lower cost, greater access to transgenic animals, and the ability to perform experiments on larger cohorts. Murine NEC models primarily utilize a combination of formula feeding, cold stress, and hypoxia to simulate the complex pathophysiology of NEC observed in human patients7,8,9. However, many murine models of NEC are limited by their dependence on broad microbial stressors or artificial alterations of the microbiota, which may compromise their clinical relevance. In contrast, the model described in this protocol overcomes these limitations by integrating several key factors implicated in NEC pathogenesis in human infants10,11. Specifically, this model combines hypoxic stress, which has been implicated in disrupting intestinal barrier integrity3,12, with oral administration of infant formula supplemented with lipopolysaccharide (LPS), a well-characterized TLR4 ligand that induces intestinal inflammation, as well as clinically relevant dysbiotic microbiome with enteric bacteria cultured from a patient with NEC totalis, the most severe form of the disease, characterized by pan-necrosis of the bowel10,13. By integrating these clinically relevant and disease-specific stressors, our model accurately reflects the clinical and molecular features of NEC. Furthermore, to provide investigators with a framework to interrogate the immune-mediated mechanisms underlying NEC pathogenesis, this protocol outlines the isolation of lamina propria cells from the neonatal murine small intestine for flow cytometry analysis. As the principal site of intestinal mucosal immune activity, the lamina propria contains a dynamic repertoire of resident and infiltrating immune cells that play a central role in NEC-associated inflammation14. Flow cytometry provides a robust and scalable platform for characterizing these immune cell populations with high resolution, enabling detailed analysis of cellular phenotypes, quantification of immune responses, and identification of immunologic signatures implicated in NEC pathogenesis15.
The murine NEC model outlined in this protocol complements in vitro models by enabling the study of host-microbiome interactions, immune responses, and inflammatory signaling within the complex environment of the neonatal intestine. It reproduces key aspects of NEC pathogenesis that cannot be modeled in vitro, making it a valuable tool for elucidating disease mechanisms and assessing therapeutic strategies. Although species-specific differences remain a limitation, this model offers a robust and accessible platform to advance our understanding of NEC and accelerate the development of targeted interventions.

<table><tbody><tr><td>1 mL Syringe-Tuberculin Slip Tip</td><td>Becton Dickinson</td><td>309659</td><td>Syringe for formula feeding</td></tr><tr><td>1.5 mL semi-micro Disposable Cuvettes</td><td>BRAND GMBH + CO KG</td><td>759085D</td><td></td></tr><tr><td>1.7 ml Microtubes Clear</td><td>Axygen - Corning Inc.</td><td>MCT-175-C</td><td>Nonpryogenic &amp;amp; Rnase-/Dnase-free</td></tr><tr><td>5% Oxygen, Balance Nitrogen Certified Reference Material, Size 200 High Pressure Steel Cylinger, CGA 580</td><td>Airgas</td><td>X02NI95C2003186</td><td></td></tr><tr><td>Anti-Mo CD16/CD32 Purified Clone: 93</td><td>eBioscience Inc.&amp;nbsp;</td><td>14-0161-85</td><td></td></tr><tr><td>Anti-Mouse CD16/CD32 Purified Clone: 93</td><td>eBioscience Inc.&amp;nbsp;</td><td>14-0161-86</td><td></td></tr><tr><td>APC anti-mouse Ly-6C Clone: HK1.4 Isotype: Rat IgGc</td><td>BioLegend</td><td>128015</td><td></td></tr><tr><td>autoMACS Rinsing Solution</td><td>Miltenyi Biotec</td><td>130-091-222</td><td></td></tr><tr><td>BB515 Rat Anti-CD11b Clone: M1/70</td><td>BD Biosciences</td><td>564455</td><td></td></tr><tr><td>BB700 Rat Anti-Mouse CD4 Clone: RM4-5</td><td>BD Biosciences</td><td>566408</td><td></td></tr><tr><td>BD Microtainer SST</td><td>Becton Dickinson</td><td>365867</td><td>Serum Tube</td></tr><tr><td>BIOTIX&amp;nbsp;Rainin LTS Compatible Racked Filter Tips, p1200</td><td>Fisher Scientific</td><td>12-111-365</td><td></td></tr><tr><td>BIOTIX&amp;nbsp;Rainin LTS Compatible Racked Filter Tips, p20</td><td>Fisher Scientific</td><td>12-111-366</td><td></td></tr><tr><td>BIOTIX&amp;nbsp;Rainin LTS Compatible Racked Filter Tips, p200</td><td>Fisher Scientific</td><td>12-111-362</td><td></td></tr><tr><td>Brilliant Stain Buffer</td><td>BD Biosciences</td><td>563795</td><td></td></tr><tr><td>BUV615 Rat Anti-Mouse Ly-6G Clone: 1A8</td><td>BD Biosciences</td><td>751263</td><td></td></tr><tr><td>BV650 Rat Anti-Mouse I-A/I-E Clone: M5/114.15.2</td><td>BD Biosciences</td><td>563415</td><td></td></tr><tr><td>C57BL/6J Neonatal Mice</td><td>The Jackson Laboratory</td><td>000664</td><td></td></tr><tr><td>CD45-VioGreen mouse</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130-102-412</td><td></td></tr><tr><td>CD64 Antibody, anti-mouse, PE-Vio 770, REAfinity Clone REA286</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130-119-659</td><td></td></tr><tr><td>CFX Opus Real-Time PC Systems&amp;nbsp;</td><td>Bio-Rad</td><td>12011319</td><td></td></tr><tr><td>Collagenase Type 4</td><td>Worthington Biochemical Corporation&amp;nbsp;</td><td>LS004188</td><td></td></tr><tr><td>DL-dithiothreitol&amp;nbsp;</td><td>Sigma</td><td>D9779-5g</td><td></td></tr><tr><td>eBioscience FOXP3/Transcription Factor Staining Buffer Set</td><td>Life Technologies Corp.&amp;nbsp;</td><td>00-5523-00</td><td></td></tr><tr><td>EDTA (0.5M), pH 8.0</td><td>Quality Biological Inc</td><td>351-027-721</td><td></td></tr><tr><td>Esbilac Puppy Milk Replacer</td><td>Pet-Ag, Inc.</td><td>99502-1</td><td>Puppy Milk</td></tr><tr><td>Fisherbrand Disposable Cuvettes</td><td>Fisher Scientific</td><td>14-955-127</td><td></td></tr><tr><td>Fisherbrand Sterile Polystyrene Disposable Serological Pipets with Magnifier Stripe (paper/plastic wrap), 10mL</td><td>Fisher Scientific</td><td>13-678-11E</td><td></td></tr><tr><td>Fisherbrand Sterile Polystyrene Disposable Serological Pipets with Magnifier Stripe (paper/plastic wrap), 25mL</td><td>Fisher Scientific</td><td>13-678-11</td><td></td></tr><tr><td>Fisherbrand Sterile Polystyrene Disposable Serological Pipets with Magnifier Stripe (paper/plastic wrap), 50mL</td><td>Fisher Scientific</td><td>13-678-11F</td><td></td></tr><tr><td>Fisherbrand Sterile Polystyrene Disposable Serological Pipets with Magnifier Stripe (paper/plastic wrap), 5mL</td><td>Fisher Scientific</td><td>13-678-11D</td><td></td></tr><tr><td>Genie Temp-Shaker 300</td><td>USA Scientific, Inc.</td><td>SI-G1600</td><td></td></tr><tr><td>gentleMACS Dissociator (protocol; m_intestine-01)</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130-093-235</td><td></td></tr><tr><td>gentleMACS&amp;nbsp; C Tubes</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130096334</td><td></td></tr><tr><td>Ghost Dye Red 780 Viability Dye</td><td>Tonbo Biosciences</td><td>13-0865-T100</td><td></td></tr><tr><td>Glycerol ReagentPlus</td><td>Sigma-Aldrich</td><td>G7757-500ML</td><td></td></tr><tr><td>GraphPad Prims Software, Version 10.0</td><td>GraphPad</td><td>N/A</td><td></td></tr><tr><td>Greiner Bio-One Round Bottom Polypropylene Culture Tube with Two-Position Vent Stopper</td><td>Fisher Scientific</td><td>07-000-212</td><td></td></tr><tr><td>Handi+ Oxygen analyzer</td><td>Maxtec</td><td>N/A</td><td></td></tr><tr><td>Hanks&#039; Balanced Salt Solution</td><td>Gibco</td><td>141650-095</td><td></td></tr><tr><td>HEPES Buffer</td><td>Mediatech, Inc.&amp;nbsp;</td><td>25-060-CI</td><td></td></tr><tr><td>Hypoxia Chamber</td><td>Billups-Rothenburg, Inc.</td><td>N/A</td><td></td></tr><tr><td>ImageJ</td><td>Schneider et al., 2012</td><td>N/A</td><td></td></tr><tr><td>Integra Miltex MeisterHand Iris Scissors, 10.2cm</td><td>Fisher Scientific</td><td>12-460-655</td><td></td></tr><tr><td>Integra Miltex MeisterHand Iris Scissors, 9cm</td><td>Fisher Scientific</td><td>12-460-598</td><td></td></tr><tr><td>Integra Miltex&amp;trade; Swiss Jeweler-Style Forceps</td><td>Fisher Scientific</td><td>12-460-110</td><td></td></tr><tr><td>Isolette Infant Incubator</td><td>Air-Shields Vickers</td><td>C100-200-2 Series 02</td><td>Incubator for mice</td></tr><tr><td>Kimtech Science Kimwipes Delicate Task Wipes</td><td>Kimberly-Clark</td><td>34120</td><td></td></tr><tr><td>LPS</td><td>Sigma-Aldrich</td><td>L3129-10mg</td><td></td></tr><tr><td>Luria Broth Broth, Miller Molecular Genetics Powder</td><td>Fisher Scientific</td><td>BP1426-500</td><td></td></tr><tr><td>MACS BSA Stock Solution</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130-091-376</td><td></td></tr><tr><td>MACSmix Tube Rotator</td><td>Miltenyi Biotec&amp;nbsp;</td><td>130-090-753</td><td></td></tr><tr><td>Microcentrifuge Tubes</td><td>Thermo Scientific</td><td>3451</td><td>1.5 ml, clear, graduated, sterile</td></tr><tr><td>NanoDrop OneC Microvolume UV-Vis Spectrophotometer</td><td>ThermoFisher Scientific</td><td>ND-ONEC-W</td><td></td></tr><tr><td>Ohaus scout portable balance</td><td>Fisher Scientific</td><td>30253024</td><td></td></tr><tr><td>Paraformaldehyde</td><td>Thermo Scientific</td><td>J61899.AK</td><td></td></tr><tr><td>PE Rat Anti-Mouse TIM-4 Clone: RMT4-54</td><td>BD Biosciences</td><td>564147</td><td></td></tr><tr><td>PE-CF594Rat Anti-Mouse CD24 Clone:M1/69</td><td>BD Biosciences</td><td>562477</td><td></td></tr><tr><td>Peripherally Inserted Central Catheter, 1.9 French, Single-Lumen</td><td>Utah Medical Products, Inc.</td><td>P-2S</td><td>A single-lumen silicone peripherallly inserted central catheter.</td></tr><tr><td>Phosphate buffered saline (PBS)</td><td>Gibco&amp;nbsp;</td><td>10010023</td><td></td></tr><tr><td>&lt;em&gt;Quick&lt;/em&gt;-RNA MicroPrep kit</td><td>Zymo Research</td><td>R1051</td><td></td></tr><tr><td>Rainin pipette - 1000 uL</td><td>Rainin</td><td>17014382</td><td></td></tr><tr><td>Rainin pipette - 200 uL</td><td>Rainin</td><td>17014390</td><td></td></tr><tr><td>Rainin pippette - 20 uL</td><td>Rainin</td><td>17014392</td><td></td></tr><tr><td>RB780 Hamster Anti-Mouse CD11c Clone: HL3</td><td>BD Biosciences</td><td>755338</td><td></td></tr><tr><td>RPMI Medium 1640 (1x)</td><td>Gibco</td><td>11875-093</td><td></td></tr><tr><td>Similac Advance&amp;nbsp;</td><td>Abbott Nutrition</td><td>53363</td><td>Baby Formula</td></tr><tr><td>Sorvall ST8R Centrifuge</td><td>Fisher Scientific</td><td>75007200</td><td></td></tr><tr><td>SsoAdvanced Universal SYBR Green Supermix</td><td>Bio-Rad</td><td>1725271</td><td></td></tr><tr><td>Straight, fine, sharp point sciessors</td><td>Miltex Instruments</td><td>MH5-300</td><td></td></tr><tr><td>T100 Thermocycler</td><td>Bio-Rad</td><td>621BR71229</td><td></td></tr><tr><td>Thermo Scientific&amp;nbsp;Nunc 50mL Conical Sterile Polypropylene Centrifuge Tubes, blue racks</td><td>Fisher Scientific</td><td>12-565-271</td><td></td></tr><tr><td>Thermo Scientific&amp;nbsp;S1 Pipet Fillers</td><td>Fisher Scientific</td><td>14387166</td><td></td></tr><tr><td>Tissue Culture Flask</td><td>Fischer Scientific</td><td>FB012937</td><td>75 cm&lt;sup&gt;2&lt;/sup&gt; , Vented cap, TC treated, Sterile</td></tr><tr><td>True-Stain Monocyte Blocker</td><td>BioLegend</td><td>426102</td><td></td></tr><tr><td>Two Stage Brass 0-50 psi General Purpose Cylinder Regulator</td><td>Airgas</td><td>Y12215B580-AG</td><td></td></tr><tr><td>Vortex-Genie 2</td><td>USA Scientific, Inc.</td><td>NC9864336</td><td></td></tr><tr><td>World Precision Instrument&amp;nbsp;Iris Forceps, 10cm, Curved, Serrated, German</td><td>Fisher Scientific</td><td>50-822-332</td><td></td></tr><tr><td>World Precision Instrument&amp;nbsp;Iris Forceps, 10cm, Straight, Serrated</td><td>Fisher Scientific</td><td>50-822-329</td><td></td></tr><tr><td>ZymoScript RT PreMix Kit</td><td>Zymo Research</td><td>R3012</td><td></td></tr><tr><td>&lt;strong&gt;Primers&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td></td><td></td><td>&lt;em&gt;Sequence&lt;/em&gt;</td><td></td></tr><tr><td>&lt;em&gt;Cxcl2&amp;nbsp;&lt;/em&gt;(Mouse) forward primer for quantitative PCR</td><td>Integrated DNA Technologies</td><td>CCAGACAGAAGTCATAGCCACT</td><td></td></tr><tr><td>&lt;em&gt;Cxcl2&amp;nbsp;&lt;/em&gt;(Mouse) reverse primer for quantitative PCR</td><td>Integrated DNA Technologies</td><td>GGCACATCAGGTACGATCCA</td><td></td></tr><tr><td>&lt;em&gt;Il1b&amp;nbsp;&lt;/em&gt;(Mouse) forward primer for quantitative PCR</td><td>Integrated DNA Technologies</td><td>AGTGTGGATCCCAAGCAATACCCA</td><td></td></tr><tr><td>&lt;em&gt;Il1b&amp;nbsp;&lt;/em&gt;(Mouse) reverse primer for quantitative PCR</td><td>Integrated DNA Technologies</td><td>TGTCCTGACCACTGTTGTTTCCCA</td><td></td></tr><tr><td>&lt;em&gt;LCN2 &lt;/em&gt;(Mouse) forward primer for quantitative PCR</td><td>Integrated DNA Technologies</td><td>GACTTCCGGAGCGATCAGTT</td><td></td></tr><tr><td>&lt;em&gt;LCN2&lt;/em&gt; (Mouse) reverse primer for quantitative PCR</td><td>Integrated DNA Technologies</td><td>CTGTACCTGAGGATACCTGTGC</td><td></td></tr></tbody></table>

a neonatal mouse model of necrotizing enterocolitis and lamina propria isolation for immune cell profiling

A Neonatal Mouse Model of Necrotizing Enterocolitis and Lamina Propria Isolation for Immune Cell Profiling

Necrotizing enterocolitis (NEC) is a severe inflammatory disease of the neonatal intestine, primarily affecting preterm infants. NEC is characterized by epithelial injury, microbial dysbiosis, and a dysregulated immune response, often resulting in intestinal necrosis and systemic inflammation. Experimental murine models that recapitulate the key aspects of human disease have been essential in advancing our understanding of the mechanisms that drive disease and inform therapeutic development. This protocol describes a well-established neonatal mouse model of necrotizing enterocolitis (NEC) utilizing formula feeding, intermittent hypoxia, oral administration of lipopolysaccharide (LPS), and enteric bacteria cultured from an infant with NEC. This combination reliably induces histological, transcriptional, and immunological features consistent with NEC in human infants and has been foundational in multiple key discoveries in the field. Additionally, this protocol describes the isolation of immune cells from the small intestinal lamina propria of neonatal mice. Lamina propria cell isolation enables detailed immune cell profiling via flow cytometry, facilitating analysis of both innate and adaptive cell populations within the intestine.

The neonatal murine model of NEC described in this protocol replicates key features of the disease. Kaplan-Meier survival analysis (Figure 1A) revealed a significant reduction in survival in the NEC treatment group compared to the dam-fed controls (9/21 vs. 8/8; p = 0.0063). Gross inspection of the intestines from the mice subjected to the model (Figure 1B) demonstrated hallmark features of NEC, including intestinal distension, air bubbles, and visible ...

This protocol outlines a neonatal mouse model of necrotizing enterocolitis (NEC) and subsequent isolation of lamina propria immune cells from the neonatal murine small intestine.

Necrotizing enterocolitis (NEC) is a severe inflammatory disease of the neonatal intestine, primarily affecting preterm infants. NEC is characterized by ...

Our research focuses on the disease affecting medically fragile infants called necrotizing enterocolitis. We aim to uncover the mechanisms involved in the immune response in NEC and develop strategies for early diagnosis and prevention of the disease. It is very challenging to study intestinal immune cell responses in neonatal NEC Our protocol fills this gap by demonstrating how to isolate lamina propria immune cells for analysis via flow cytometry.To begin, acquire a culture of enteric bacteria cultured from an infant with necrotizing enterocolitis totalis, or NEC. On experimental day 0 at 3:00 pm, pipette a 20-microliter aliquot of the culture into a 15-milliliter culture tube containing 2 milliliters of Luria-Bertani broth. Incubate the bacterial culture at 37 degrees Celsius for 16 hours in an orbital shaker set to 1G, ensuring the tube lid is kept in a vented position.Concurrently, incubate a second culture tube containing only 2 milliliters of Luria-Bertani broth as a control to check for any contamination. The next day at 7:00 am, pipette 125 microliters of the overnight bacterial culture into a T75 cell culture flask with a vented lid containing 25 milliliters of Luria-Bertani broth. Prepare a total of four T75 flasks and incubate in an upright position at 37 degrees Celsius for two hours in an orbital shaker set at 1G.At 9:00 am on experimental days 1, 2 and 3, combine 16 milliliters of infant formula with 8 milliliters of puppy milk in a sterile 50-milliliter centrifuge tube to prepare the formula mixture. Remove the supernatant from two 50-milliliter centrifuge tubes containing the pelleted bacterial culture. Thoroughly resuspend each of the two pellets in 2 milliliters of the prepared formula mix.Then transfer both resuspended mixtures into the remaining formula mix to create a total of 24 milliliters of NEC formula. Label six 50-milliliter centrifuge tubes with the six feeding time points. Pipette 4 milliliters of the NEC formula into each of the six labeled tubes.Next, prepare six single use aliquots of lipopolysaccharide stock at 5 milligrams per milliliter and store in low binding micro tubes at 20 degrees Celsius. Just before feeding, thaw one lipopolysaccharide aliquot and vortex for 15 seconds. Add a calculated volume of the lipopolysaccharide to a 4-milliliter NEC formula tube and mix well by pipetting.Fill a 1-milliliter syringe with the prepared NEC formula and attach it to a neonatal PICC line. To administer the NEC formula to each pup via oral gavage, gently restrain the pup by the loose skin at the base of the neck and hold it upright. The insertion distance of the PICC line is equal to the distance from the corner of the mouth to the top of the milk spot in the stomach.The optimal insertion point on the PICC line should be marked using a permanent marker. Using forceps, guide the PICC line into the oropharynx and down into the stomach. If resistance is encountered, remove the PICC line, reposition it and attempt reinsertion.Dispense 80 microliters of NEC formula slowly into the stomach. Monitor the pup for signs of aspiration during feeding. After feeding, remove the PICC line and observe the pup for any labored breathing or vomiting.If regurgitation occurs, blot the pup's mouth and nose using a low lint laboratory wipe. Repeat the feeding process at all feeding time points. On experimental day 4, obtain the intestinal tissue from the euthanized neonatal mice.With a pair of scissors, cut the intestine longitudinally to open it, then section it transversely into 1-1.5 centimeter segments. Transfer the intestinal segments into a 15-milliliter centrifuge tube containing 10 milliliters of predigestion solution that has been cooled on ice. Then incubate the tube at 37 degrees Celsius with continuous rotation for 20 minutes to begin tissue dissociation.Gently swirl the tube to dislodge loosened tissue, then pour the contents through a 100-micrometer cell strainer placed on top of a 50-milliliter centrifuge tube. Transfer the remaining tissue fragments into a new 15-milliliter centrifuge tube containing 10 milliliters of digestion solution preheated to 37 degrees Celsius. Incubate the sample with continuous rotation for 40 minutes at 37 degrees Celsius.Then transfer the contents into an automated tissue dissociation tube. Run the program with four 15-second alternating clockwise and counterclockwise rotation cycles. When the dissociation is complete, gently vortex the cell suspension in the dissociation tube and then centrifuge it at 300G for 5 minutes at 4 degrees Celsius.Carefully aspirate the supernatant without disturbing the pellet. Resuspend the cells in 1 milliliter of ice cold fluorescence-activated cell sorting buffer. Place a 100-micrometer cell strainer over a 50-milliliter centrifuge tube.Transfer the resuspended cells through the strainer and wash it with 2 milliliters of cold fluorescence-activated cell sorting buffer. Count the isolated cells and assess viability using trypan blue or a viability dye. Centrifuge the desired volume for flow cytometry at 300G for 5 minutes at 4 degrees Celsius.A significant reduction in survival in the NEC treatment group was observed compared to the dam-fed controls. Gross intestinal examination of NEC mice demonstrated hallmark features of NEC, including visible signs of distension, air accumulation and pneumatosis intestinalis compared to healthy controls. Hematoxylin and Eosin staining revealed patchy villous destruction and disrupted intestinal architecture in NEC mice compared to intact villi in controls.Expression of IL1B, CXCL2 and LCN2 messenger RNA was significantly higher in the NEC group than in controls. Total CD45+immune cells in the intestinal lamina propria were not significantly different between NEC and control groups. Macrophage levels were significantly elevated in NEC intestines compared to controls.NEC mice showed an increased proportion of myeloid cells, particularly monocytes and macrophages, relative to other immune subtypes. Single-cell multiomics approaches are uncovering immune cell signatures in NEC, offering new insights into mechanisms and potential biomarkers. Modeling NEC is challenging because the disease is multifactorial.Replicating the human intestinal environment, immune responses and microbial influences in neonatal mice requires careful optimization. Our model integrates human-derived microbiome, hypoxia and formula feeding, making it physiologically relevant aligned for detailed immune cell profiling in neonatal mice.

a-neonatal-mouse-model-necrotizing-enterocolitis-lamina-propria

Research

JoVE Journal

Immunology and Infection

Source: Seman, B. G., et al. A Neonatal Imaging Model of Gram-Negative Bacterial Sepsis. J. Vis. Exp. (2020)The video demonstrates a neonatal mouse model for studying systemic infection using encapsulated bioluminescent bacteria. Neonatal pups are injected with high- or low-dose bacterial suspensions and returned to their mother for postnatal care. The encapsulated bacteria evade early immune detection, spread systemically, and are visualized over time using luminescence imaging. This model...

Modeling Infection in Neonatal Mice Using Encapsulated Bioluminescent Bacteria

Here, a procedure is described for the establishment of systemic infection in the neonatal rat with cultures of Escherichia coli K1. This non-invasive procedure permits colonization of the gastrointestinal tract, translocation of the pathogen to the systemic circulation, and invasion of the central nervous system at the choroid plexus.

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

This protocol provides the necessary steps to establish and evaluate neonatal sepsis in 7-day-old mice.

A Controlled Mouse Model for Neonatal Polymicrobial Sepsis

This study details the process of gavaging precise amounts of probiotics to neonatal mice. The experimental set-up was optimized to include but is not limited to probiotic dosing, methods of administration, and quantification of bacteria in the intestines.

Probiotic Studies in Neonatal Mice Using Gavage

Enteroids are emerging as a novel model in the study of human disease. The protocol describes how to simulate an enteroid model of human necrotizing enterocolitis using lipopolysaccharide (LPS) treatment of enteroids generated from neonatal tissue. Collected enteroids demonstrate inflammatory changes akin to those seen in human necrotizing enterocolitis.

A Novel Human Epithelial Enteroid Model of Necrotizing Enterocolitis

We developed a model of chorioamnionitis to simulate fetal exposure to maternal inflammation (FEMI) without complications of live organisms to examine the effects of FEMI on development of the offspring’s intestinal tract. This allows for study of mechanistic causes for development of intestinal injury following chorioamnionitis.

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Infection of neonatal mice with bioluminescent E. coli O1:K1:H7 results in a septic infection with significant pulmonary inflammation and lung pathology. Here, we describe procedures to model and further study neonatal sepsis using longitudinal intravital imaging in parallel with enumeration of systemic bacterial burdens, inflammatory profiling, and lung histopathology.

A Neonatal Imaging Model of Gram-Negative Bacterial Sepsis

Dysregulated intestinal epithelial barrier function and immune responses are hallmarks of inflammatory bowel disease that remain poorly investigated due to a lack of physiological models. Here, we describe a mouse intestinal loop model that employs a well-vascularized and exteriorized bowel segment to study mucosal permeability and leukocyte recruitment in vivo.

Functional Assessment of Intestinal Permeability and Neutrophil Transepithelial Migration in Mice using a Standardized Intestinal Loop Model

Necrotizing enterocolitis (NEC) is the most severe gastrointestinal (GI) disease that often occurs in premature infants, especially very low birth weight infants, with high mortality and unclear pathogenesis. The cause of NEC may be related to inflammatory immune regulatory system abnormalities. An NEC animal model is an indispensable tool for NEC disease immune research. NEC animal models usually use C57BL/6J neonatal mice; BALB/c neonatal mice are rarely used. Related studies have shown that...

A Neonatal BALB/c Mouse Model of Necrotizing Enterocolitis

This protocol describes an in vitro model of necrotizing enterocolitis (NEC), which can be used for mechanistic studies into disease pathogenesis. It features a microfluidic chip seeded with intestinal enteroids derived from the human neonatal intestine, endothelial cells, and the intestinal microbiome of a neonate with severe NEC.

Microfluidic Model of Necrotizing Enterocolitis Incorporating Human Neonatal Intestinal Enteroids and a Dysbiotic Microbiome

Preterm birth (delivery &lt; 37 weeks) is an urgent global health issue with suboptimal prevention and treatment options. We present a mouse model of ascending vaginal bacterial infection-induced preterm birth and outline how to analyze the resulting neonatal morbidity and mortality.

Modeling Ascending Vaginal Infection, Preterm Birth, and Neonatal Morbidity in Mice

Learn a neonatal mouse model of necrotizing enterocolitis using formula feeding, hypoxia, LPS, and patient-derived bacteria. Isolate lamina propria immune cells for flow cytometry profiling to study NEC pathogenesis.

A Neonatal Mouse Model of Necrotizing Enterocolitis and Lamina Propria Isolation for Immune Cell Profiling

Explore More Videos