कौन क्या है? गैर इनवेसिव तरीकों व्यक्तिगत रूप से सेक्स और मार्क Altricial लड़कियों को


Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:



इस प्रोटोकॉल अत्यंत तेजी से, आसान, गैर इनवेसिव, विश्वसनीय और कम लागत में सक्षम बनाता है जो तरीकों का एक सुविधाजनक सेट, पक्षियों की आणविक लिंग निर्धारण और उनकी गैर इनवेसिव, त्वरित, सुरक्षित और आसानी से पहचानने के लिए शीघ्र ही अंडे सेने के बाद अंकन प्रदान करता है. लड़कियों की केवल सीमित निपटने की आवश्यकता है. तरीकों की यह सुविधाजनक उपकरण बॉक्स आरआरआर-दिशा निर्देशों के साथ पूरी तरह अनुरूप है.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.


कई प्रयोगों जल्दी वंश के लिंग निर्धारण के साथ ही जल्दी व्यक्तिगत पहचान के लिए नवजात शिशुओं के अंकन की आवश्यकता होती है. लागू जब भी पशु कल्याण के दिशा निर्देशों के अनुसार, गैर इनवेसिव तकनीक प्राथमिकता दी जानी चाहिए. हमारे समूह में, हम प्रयोगशाला में और क्षेत्र में गाना पक्षियों की विभिन्न प्रजातियों पर काम करते हैं, और हम सफलतापूर्वक सेक्स के लिए गैर इनवेसिव तरीकों को लागू करने और अलग - अलग लड़कियों के निशान. यह पत्र एक व्यापक गैर इनवेसिव उपकरण बॉक्स प्रस्तुत करता है. पक्षियों sexing पूर्व माध्यमिक यौन लक्षण की अभिव्यक्ति के लिए पीसीआर के लिए डीएनए असर सामग्री के संग्रह की आवश्यकता है. हम मुख swabs से डीएनए निकालने के द्वारा किसी भी उम्र (पोस्ट हैचिंग) का सेक्स पक्षियों के लिए एक त्वरित और आसान विधि की स्थापना की. परिणाम 3 घंटे के भीतर प्राप्त किया जा सकता है. व्यक्तिगत अंकन लड़की के नीचे पंख अंडे सेने आदेश के भीतर तेजी से पहचान की अनुमति विशिष्ट पैटर्न में छंटनी कर रहे हैं. विधियों का यह सेट एक मानक सुसज्जित प्रयोगशाला में आसानी से लागू है और काम के लिए विशेष रूप से उपयुक्तकोई विशेष उपकरण के रूप में मैदान में जी नमूना और भंडारण के लिए आवश्यक है. लड़कियों की हैंडलिंग और कम से कम अंकन और sexing तकनीक जिससे पशु कल्याण के दिशा निर्देशों के आरआरआर सैद्धांतिक समर्थन गैर आक्रामक रहे है.


व्यक्तिगत पहचान, sexing और जीनोटाइपिंग प्रयोगात्मक अध्ययन की एक किस्म में मूलभूत आवश्यक शर्तें हैं. डीएनए असर सामग्री प्राप्त करने और (यहां तक ​​कि एक कम उम्र में) स्पष्ट विषयों अंकन शरीर विज्ञान, व्यवहार, और अस्तित्व पर न्यूनतम प्रभाव होना चाहिए. जब भी संभव हो, आक्रामक प्रक्रियाओं आरआरआर सिद्धांत 1 के अनुसार बचा जाना चाहिए.

गैर इनवेसिव तरीकों से न केवल पशु के लिए फायदेमंद होते हैं, लेकिन यह भी जानवरों कम उपचार से प्रभावित कर रहे हैं के रूप में प्राप्त आंकड़ों में सुधार हो सकता है.

पक्षियों में, डीएनए sexing गोबर 2, पंख 3,4 या मुख swabs 3,5,9 के रूप में गैर invasively प्राप्य सामग्री का एक नंबर पर प्रदर्शन किया जा सकता है. वे प्रदर्शन करने के लिए आसान कर रहे हैं क्योंकि भले ही इस विषय की हालत और उम्र मुख swabs के एवियन sexing के लिए पसंद की विधि को शायद ही कभी असफल और हैंडलिंग कम है, कर रहे हैं.

मुख swabs से अब तक डीएनएया तो व्यावसायिक रूप से उपलब्ध किट 3,6 या समय मानक डीएनए निष्कर्षण प्रोटोकॉल 3,6-8 लेने के साथ निकाला गया था. किट न केवल बल्कि महंगे हैं, लेकिन उनके प्रोटोकॉल फील्ड कार्य के लिए चुनौतियों लागू कर सकते हैं. कुछ प्रक्रियात्मक जानकारी, जैसे सुखाने और नमूनों की ऊष्मायन, क्षेत्र में व्यावहारिक नहीं हैं. विशेष रूप से प्रयोगात्मक प्रोटोकॉल के रूप में जल्दी कुछ मिनट के बाद अंडे सेने रूप से सेक्स निर्भर उपचार की आवश्यकता होती है, जहां एक की स्थापना में, परिणाम प्राप्त करने के लिए एक त्वरित, गैर इनवेसिव, विश्वसनीय और आसान विधि के लिए आग्रह करता हूं कि वहाँ है.

एवियन taxa भर में अंकन व्यक्तियों के लिए एक काफी Toolbox 10 विकसित किया गया है. उपलब्ध तकनीकों की विस्तृत सरणी अनुसंधान उद्देश्यों, प्रजातियों और बजट की विविधता के लिए खातों. हालांकि, छोटे nestlings अंकन अतिरिक्त चुनौतियों के साथ शोधकर्ताओं का सामना किया है. कुछ प्रजातियों में (जैसे passerines) लड़कियों पैर बैंड लागू करने के लिए बहुत छोटे हैं और वैकल्पिक तरीकों की आवश्यकता होती है जोअभिभावक संतानों के व्यवहार में परिवर्तन नहीं करते हैं. जागरूकता और पशुओं के कल्याण और क्षेत्र और प्रयोगशाला अध्ययन में तकनीक में सुधार लाने में रुचि बढ़ रही है, गैर इनवेसिव तकनीक का उपयोग दृढ़ता से प्रोत्साहित किया और पसंद किया जाता है.

इस प्रोटोकॉल व्यक्तिगत पैर बैंड लागू करने से पहले बहुत युवा nestlings चिह्नित करने के लिए एक गैर इनवेसिव, जल्दी, आसानी से पहचानने और लगातार तरीका प्रदान करता है संभव है. इस अंकन पद्धति सबसे महत्वपूर्ण एवियन प्रयोगशाला मॉडल प्रजातियों में से एक, ज़ेबरा चिड़िया (Taeniopygia guttata) 11-13 पर शुरू की है. प्रोटोकॉल व्यक्ति अंकन तकनीक 10 के लिए पहले प्रकाशित उद्देश्यों के सभी के अनुरूप है और पहले से ही सफलतापूर्वक 14,15 लागू किया गया है.

Subscription Required. Please recommend JoVE to your librarian.


सभी प्रक्रियाओं पशु संरक्षण (TierSchG) के लिए जर्मन कानून के अनुपालन में प्रदर्शन किया गया.

अभिकर्मकों और उपभोग्य सामग्रियों की 1. तैयारी

  1. आणविक ग्रेड पानी में 5% (डब्ल्यू / डब्ल्यू) Chelex -100 समाधान तैयार करें. मानक 1.5 मिलीलीटर प्रतिक्रिया ट्यूबों में 200 μl की aliquots तैयार करें. Chelex राल निलंबन से तेज precipitates के रूप में यह aliquots की तैयारी के दौरान लगातार फिर से homogenize निलंबन करने के लिए आवश्यक है. यह एक बैच में 50 मिलीलीटर या अधिक तैयार है और एक चुंबकीय उत्तेजक का उपयोग homogenized निलंबन रखने की सलाह दी जाती है. Chelex समाधान परिवेश की स्थिति पर साल के लिए भंडारित किया जा सकता है.
  2. परीक्षण किया जाना पक्षी की चोंच चौड़ाई से छोटी एक चौड़ाई के साथ वाटमान कागज के टुकड़े काटें. कागज की लंबाई का नमूना लेने के लिए विधि पर निर्भर करता है:
    1. संदंश का प्रयोग, टुकड़ा पक्षी की चोंच में डाला जा रहा है संदंश के बिना नमूना संग्रह सक्षम करने के लिए काफी लंबे समय के लिए किया जाना चाहिए. एक के रूप मेंमोटा अनुमान, 0.5 सेमी की चोंच की लंबाई के लिए 1 सेमी की लंबाई के साथ एक कागज का टुकड़ा ठीक किया जाना चाहिए.
    2. संदंश का उपयोग नहीं करते हैं, तो टुकड़ा रह गया होना चाहिए, लेकिन टुकड़ा की कठोरता अभी उपकला कोशिकाओं के नमूने की अनुमति चाहिए.
  3. विश्लेषण किया जा करने के लिए प्रत्येक नमूना के लिए पीसीआर premix की एक विभाज्य तैयार करें. Μl 25 की कुल मात्रा में एक पीसीआर के लिए मिश्रण 0.18 मिमी dNTPs, 2 मिमी 2 MgCl, 70 मिमी Tris-एचसीएल, 17.25 मिमी अमोनियम सल्फेट, 0.1% बीच 20, 0.32 माइक्रोन के p2 प्राइमर (TCTGCATCGCTAAATCCTTT), 0.32 माइक्रोन P8 शामिल प्राइमर (CTCCCAAGGATGAGRAAYTG) 16 और 2 इकाइयों Taq पोलीमरेज़. घर का बना Taq पोलीमरेज़ 17 इस्तेमाल किया जा सकता है. डीएनए समाधान की अधिकतम राशि के अलावा अनुमति देने के लिए, एक 6 μl premix कई हफ्तों के लिए तैयार है और -20 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है.

2. नमूना संग्रह

दस्ताने पहने हुए पीसीआर प्राइमरों मानव डीएनए के लिए पानी रखना नहीं कर सकते हैं के रूप में एवियन लिंग निर्धारण के लिए आवश्यक नहीं है. के लिएअन्य जीनोटाइपिंग प्रयोजनों यह सलाह दी जा सकती है.

  1. ब्याज की पक्षी पर कब्जा है और धीरे 'घंटी पकड़' 18 के साथ एक ओर उदाहरण में पकड़. पक्षी निचोड़ नहीं सुनिश्चित करें.
  2. एक संदंश के साथ वाटमान कागज के एक टुकड़े को पकड़ो और गाल, जीभ और पश्चनासारंध्र के अंदर भर में यह कई बार स्वाइप. आमतौर पर नमूनों कम से कम 30 सेकंड के भीतर प्राप्त कर रहे हैं.
    1. वयस्क जानवर: प्रजातियों पर निर्भर करता है कि वह अपने चोंच खोलने के लिए पक्षी पाने के लिए मुश्किल हो सकता है. आमतौर पर चोंच की ओर छू और कोमल दबाव लागू करने के लिए काम करेंगे.
    2. Nestlings: hatchlings या nestlings से नमूने उनके भीख माँग व्यवहार चोंच के अंदर करने के लिए आसान पहुँच प्रदान करता है, के रूप में इस तकनीक का उपयोग विशेष रूप से आसान है. उनके nestbox खोले जाने पर वे आसानी से जैसे भीख माँगने के रूप में यह भी, उन सब पर से निपटने के बिना नमूना प्राप्त करने के लिए संभव हो सकता है.
  3. इसके तत्काल बाद एक तैयार प्रतिक्रिया ट्यूब contai में कागज की दुकान5% की निंग 200 μl (डब्ल्यू / डब्ल्यू) Chelex -100 समाधान.

आप भी / इरादा धारा 6 में वर्णित के रूप में अब ऐसा करते हैं, लड़कियों को चिह्नित करने की जरूरत है.

डीएनए निष्कर्षण पहले नमूने के 3. संग्रहण

  1. -20 डिग्री सेल्सियस पर प्रयोगशाला में काम कर रहे हैं, तो दुकान के नमूने इस परिवेश तापमान पर स्टोर के नमूने संभव या (क्षेत्र में जैसे) मुश्किल नहीं है.
  2. नमूने कमरे के तापमान से -20 डिग्री सेल्सियस से लेकर तापमान में 3 से अधिक वर्षों के लिए भंडारित किया जा सकता है

4. डीएनए निष्कर्षण

  1. नमूना जमे हुए है, तो कमरे के तापमान पर यह पिघलना.
  2. कागज का टुकड़ा Chelex -100 समाधान में डूबे हुए ट्यूब के तल पर है कि यह सुनिश्चित करें.
  3. 56 डिग्री सेल्सियस पर 15 मिनट के लिए नमूने सेते
  4. भंवर संक्षिप्त और ट्यूब की सामग्री नीचे स्पिन.
  5. 100 डिग्री सेल्सियस पर 8 मिनट के लिए नमूने सेते
  6. 3 मिनट के लिए 15,000 XG पर नमूने स्पिन.
  7. S उपयोगबाद में जीनोटाइपिंग के लिए upernatant.

5. आण्विक लिंग निर्धारण

  1. नमूना प्रति 6 μl premix प्लस नकारात्मक (अनिवार्य) और सकारात्मक नियंत्रण (वैकल्पिक) के लिए दो अतिरिक्त ट्यूबों के साथ एक पीसीआर ट्यूब तैयार करें. दिनचर्या लिंग निर्धारण के लिए एक सकारात्मक नियंत्रण के रूप में पिछले सफल sexing से एक नमूना शामिल हैं.
  2. पीसीआर Premix डीएनए निष्कर्षण से सतह पर तैरनेवाला के 19 μl जोड़ें. Chelex मोतियों का भार से बचने के लिए समाधान की सतह से विंदुक के लिए सुनिश्चित करें. Chelex एक कटियन एक्सचेंजर है और इस प्रकार गंभीर रूप से सभी एंजाइमी प्रतिक्रियाओं को रोकता है, क्योंकि यह महत्वपूर्ण है.
  3. 3 मिनट, 72 डिग्री पर एक 45 सेकंड बढ़ाव कदम से पीछा 55 डिग्री सेल्सियस पर एक 30 सेकंड annealing कदम है, जिसके बाद 30 सेकंड के पिघलने कदम 94 डिग्री सेल्सियस, के साथ 45 चक्र प्रत्येक के लिए 94 डिग्री सेल्सियस पर ऊष्मायन: निम्नलिखित पीसीआर कार्यक्रम चलाने के लिए सी. एक अंतिम चेस बंद चरण में, प्रतिक्रियाओं 72 डिग्री सेल्सियस पर 5 मिनट के लिए incubated हैं
  4. एक 2% मानक TBE या TAE agaro तैयार करें पीसीआर उत्पादों को अलग करने के एसई जेल.
  5. उचित वोल्टेज सेटिंग्स के साथ agarose जेल चलाएँ.
  6. पराबैंगनी प्रकाश के तहत बैंड कल्पना और एक तस्वीर ले लो. महिलाओं से होने वाले नमूनों में दो बैंड अच्छी तरह से अलग हो रहे हैं सुनिश्चित करें.
  7. एक (पुरुष) या दो (महिला) बैंड की मौजूदगी से महिला के नमूनों से पुरुष भेद.

6. Nestlings चिह्नित

  1. प्रजातियों / अध्ययन के लिए एक कार्यक्रम उपयुक्त पर नव रची लड़कियों के लिए घोंसले की जाँच (ज्यादातर लड़कियों तो पक्षियों के बच्चे के रूप में सुबह में जैसे दैनिक चेक सलाह दी जाती है).
  2. एक अलग विशेषता स्थान पर एक घोंसला के भीतर प्रत्येक लड़की के नीचे पंख कट. ज़ेबरा फिन्चेस में चढ़ाव के टफ्ट्स पोटा के शरीर (चित्रा -4 ए) में चार विशेषता और अलग क्षेत्रों में बढ़ता है. प्रत्येक लड़की के लिए एक क्षेत्र (चित्रा 4 बी) में कटौती. एक घोंसला के भीतर चार से अधिक लड़कियों कर रहे हैं, अद्वितीय चार 'बाल कटाने' जोड़ा जा सकता है.
ज़ेबरा फिन्चेस के लिए> "ove_content: नीचे पंख का पता लगाने और पोटा आकार बज अनुमति देता है के लिए मुश्किल हो जब अंडे सेने डाक दस दिनों में पैर बैंड लागू करें.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

मुख swabs छोटे पक्षियों की एक किस्म में लिंग निर्धारण के लिए डीएनए को प्राप्त करने के लिए इस्तेमाल किया जा सकता है

, कैनरी (Serinus Canaria), Bengalese फिन्चेस (लॉनचुरा स्ट्रिएटा), Nightingales (Luscinia megarhynchos), महान स्तन (Parus प्रमुख) और Blackbirds (टर्डाइन वंशीय पक्षी कुल - नमूने ज़ेबरा फिन्चेस (5 वर्ष Taeniopygia guttata, 99 व्यक्तियों, उम्र 0 दिन) से एकत्र किए गए merula) (सभी अन्य प्रजातियों के लिए: नमूना आकार 1-3, उम्र अज्ञात) (चित्रा 1).

ज़ेबरा फिन्चेस से लिए गए नमूनों के लिए, PCRs के लिए सफलता की दर 100% थी. पीसीआर परिणाम हमेशा (nestlings में) प्ररूपी निरीक्षण (वयस्कों में) से पहले या बाद में द्वारा निर्धारित सेक्स का मिलान नहीं हुआ. बैंड की तीव्रता डीएनए असर सामग्री की समान मात्रा में सभी उम्र से कमाए जा सकते हैं यह दर्शाता है कि nestlings या वयस्कों के बीच व्यवस्थित ढंग से अलग नहीं किया था.

चित्रा 1 "के लिए: सामग्री चौड़ाई =" / files/ftp_upload/51429/51429fig1highres.jpg "src =" / files/ftp_upload/51429/51429fig1.jpg "/>" src = के लिए "6in
चित्रा 1. आण्विक sexing. विभिन्न एवियन प्रजातियों से प्राप्त मुख swabs से sexing परिणामों के उदाहरण हैं. 2% agarose जेल ethidium ब्रोमाइड के साथ दाग. बाएं से दाएं: आकार मार्कर, ज़ेबरा चिड़िया पुरुष, Bengalese चिड़िया महिला, ब्लैकबर्ड पुरुष, ग्रेट तैसा पुरुष, कोकिला पुरुष, कैनरी पुरुष, पानी नियंत्रण, आकार मार्कर.

यह PCRs में Chelex carryover प्रदूषण को रोकने के लिए महत्वपूर्ण है

एक पीसीआर प्रतिक्रिया में Chelex राल संदूषण के प्रभाव को प्रदर्शित करने के लिए, हम एक पीसीआर प्रतिक्रिया में Chelex मोतियों की एक छोटी राशि (चित्रा 2) शामिल थे. चित्रा 2A में देखा जा सकता है, Chelex मोती के carryover संदूषण आगे दूषित नमूने में प्राइमर डिमर गठन (की कमी से यह साफ है जो डीएनए के प्रवर्धन <रोकतामजबूत> चित्रा 2 बी). 2A चित्रा 2 लेन में हम Chelex से अधिक ले जाने के बिना पीसीआर के लिए एक ही नमूना इस्तेमाल किया. आमतौर पर दूषित नमूनों agarose जेल (चित्रा 2 बी) की जेब में काले धब्बे द्वारा आसानी से पहचानने योग्य होते हैं.

चित्रा 2
चित्रा 2. Chelex संदूषण. ए) पीसीआर प्रतिक्रिया में Chelex carryover डीएनए के प्रवर्धन रोकता. बाएं से दाएं करने के लिए:. आकार मार्कर, ज़ेबरा चिड़िया पुरुष, ज़ेबरा चिड़िया महिला, Chelex की जानबूझकर carryover के साथ ही नमूने, पानी नियंत्रण, आकार मार्कर बी) Chelex मोती Chelex बिना छोड़ दिया जेल की जेब में अंधेरा धुंधला (के रूप में आसानी से दिखाई दे रहे हैं , सही Chelex साथ. Chelex की उपस्थिति में पीसीआर प्रतिक्रिया की गंभीर निषेध भी लापता प्राइमर डी से यह साफ हैदूषित नमूने में Imer गठन.

नमूने तीन साल से अधिक के लिए डीएनए निष्कर्षण से पहले कमरे के तापमान पर संग्रहित किया जा सकता है

सफल निकासी अभी भी लंबे भंडारण के बाद किया जा सकता है कि क्या जांच करने के लिए, नमूने एक ही पक्षी से बार बार ले जाया गया और ज़्यादा से ज़्यादा तीन साल के लिए परिवेश तापमान पर प्रयोगशाला में भंडारित किया. नमूने सूर्य से प्रकाश और गर्मी के लिए प्राकृतिक जोखिम के साथ करीब एक खिड़की करने के लिए जमा थे. तीन साल के बाद डीएनए निकाला और sexing पीसीआर प्रदर्शन किया गया था. परिणाम एक से तीन साल पहले (सही नमूने के बाद) का प्रदर्शन और भंडारण के किसी भी प्रभाव (चित्रा 3) का संकेत नहीं था मिलान किया.

चित्रा 3
चित्रा 3. Chelex befo नमूनों की लंबी अवधि के भंडारण की अनुमति देता हैतालिका में संकेत के रूप में दो जानवरों (पुरुष बाईं, महिला अधिकार) की फिर से और डीएनए निष्कर्षण के बाद. नमूने विभिन्न परिस्थितियों में संग्रहीत किए गए थे. सिग्नल सभी नमूनों से सफलतापूर्वक प्राप्त किया गया.

चित्रा 4
चित्रा 4. लड़कियों का अंकन. ए) योजनाबद्ध प्रतिनिधित्व और ज़ेबरा चिड़िया nestlings में नीचे पंख विकास के चार अलग क्षेत्रों का नामकरण:. Nestlings के एक = सिर, बी = वापस, सी = विंग्स (दोनों), डी = flanks (दोनों) बी) उदाहरण तस्वीर जो या तो संबंधित 'बाल कटाने' (ई.) या नहीं 'बाल कटवाने' (ई) में से एक प्राप्त किया.

निकाले डीएनए 4 डिग्री सेल्सियस पर तीन साल से अधिक के लिए भंडारित किया जा सकता है

पहला प्रयोग से ज़ेबरा चिड़िया नमूने एक मानक प्रयोगशाला शुक्र में तीन साल के लिए जमा थे4 डिग्री सेल्सियस और सफलतापूर्वक डीजीई पुनर्परीक्षण. सभी नमूने के रूप में सीधे डीएनए निष्कर्षण (चित्रा 3) के बाद एक ही पीसीआर परिणाम सामने आए.

Hatchlings पर अंडे सेने से व्यक्तिगत मान्यता सक्षम करने के लिए उनके नीचे पंख trimming द्वारा चिह्नित किया जा सकता है

सही उनके नीचे पंख काटने से अंडे सेने के बाद व्यक्ति nestlings चिह्नित (आंकड़े 4, 5, 6) उन्हें आसानी से पहचानने योग्य बनाया. नीचे पंख उनकी अकड़ के रूप में एक शराबी भूमिका है एक चिकनी फलक फार्म एक साथ शामिल नहीं हुए हैं. वे अभी भी तब तक शरीर (चित्रा 5) कवर जो विकासशील पंख, के सुझावों पर posthatch 10 दिन में पहचाना जा सकता है. अलग स्थानों पर उनकी अनुपस्थिति कभी कभी भी nestlings (चित्रा 6) से निपटने के बिना, मान्यता के लिए आसान बनाता है. इन तथाकथित `बाल कटाने 'लगाने सफलतापूर्वक ज़ेबरा FINC शावक के शरीर का आकार जब तक अंडे सेने से समय के लिए अंतराल भरता है, जो एक सुरुचिपूर्ण तकनीक है,वह पैर बैंड के आवेदन संभव बनाता है.

चित्रा 5
पोस्ट हैच सुबह 10 बजे चित्रा 5. चिह्नित ज़ेबरा चिड़िया nestlings. चित्र (कैंची) के साथ या (तीर) चिह्नों के बिना या तो nestlings दिखा. एक = सिर, बी = वापस, सी = पंख, डी = flanks: एक तीर नीचे पंख 'बाल कटाने' के संबंधित नामकरण के अनुसार ब्याज के स्थान को इंगित करता है.

चित्रा 6
नामकरण के अनुसार प्रसव घोंसला भीतर चिह्नित nestlings की चित्रा 6. पहचान (उम्र = 10 दिनों मतलब है).दोनों पंख याद कर रहे हैं के रूप में ही सिर पर याद कर रहे हैं जो कारण उसके प्रमुख नीचे पंख को हाजिर करने के लिए आसान एक = सिर,. बी = वापस, नीचे पंख दृश्यमान सभी स्थानों पर लेकिन वापस. सी = पंखों पर, एक चौकस पर्यवेक्षक की जरूरत पंख के नीचे, लेकिन पोटा आसन सिर से नीचे पंख दक्षिणपंथी कवर करता है. अपने flanks नहीं देखा जा सकता है के रूप में डी = flanks, केवल समाप्त करने की प्रक्रिया के द्वारा मान्यता प्राप्त किया जा सकता है. यह सिर पर नीचे स्पष्ट पंख वृद्धि से पता चलता है के रूप में यह मज़बूती से विकास के रूप में पहचाना जा सकता है, पीठ और अपने पंख. वापस (ख) 'बाल कटाने' सिर (ए) और का एक संयोजन =, पर के रूप में नीचे पंख भेद करना आसान है सिर और पीठ याद कर रहे हैं. एफ केवल अंकन अपने सिर के रूप में अन्य विकल्पों को नष्ट करने के माध्यम से भेदभाव किया जा सकता है, जो 'बाल कटाने' ए (सिर) और विकास (flanks), का एक संयोजन = स्पष्ट है और कोई अन्य अज्ञात पोटा अंकन एक सिर दर्शाती है. जी = नहीं कियाकिसी भी चिह्नों प्राप्त करते हैं और यह पक्षियों के बच्चे के लिए पिछले था के रूप में अपने भाई बहन की तुलना में बहुत छोटा होता है. इसके अलावा जी सभी स्थानों पर पंख नीचे व्यक्त नहीं करता जो एक पोटा के लिए एक अच्छा उदाहरण है.

Subscription Required. Please recommend JoVE to your librarian.


Chelex का उपयोग मुख swabs से sexing एक अत्यंत उच्च सफलता दर दिखाया. पैर बैंडिंग संभव था जब तक काटना hatchling के नीचे पंख nestlings के बीच भेदभाव सक्षम होना चाहिए.

मुख swabs से Chelex डीएनए निष्कर्षण सफलतापूर्वक आणविक sexing प्रदर्शन करने के लिए पर्याप्त डीएनए झुकेंगे. लिंग निर्धारण यौन द्विरूपी पक्षति द्वारा मान्य के रूप में 100% सही था. यहां बताया सफलता दर पिछले दो अध्ययनों 7,9 द्वारा रिपोर्ट की दर से स्पष्ट रूप से अधिक है. Chelex साथ डीएनए निष्कर्षण सामग्री खो दिया जा सकता है जिसमें pipetting और तेज़ी चरणों को कम करता है. हालांकि, एक अलग प्रजातियों में हमारे प्रोटोकॉल मान्य के अध्ययनों में से एक (APUs APUs) अभी भी यह पहले से ही Arima एट अल की रिपोर्ट में 82% से अधिक स्पष्ट रूप से अधिक था, भले ही 89% 9 की एक कम सफलता दर हासिल की. 7.

क्या कारण हो सकता है? सबसे महत्वपूर्ण हिस्सा ध्यान prot का पालन करने के लिए हैocol, नमूने (मुंह में धीरे कड़ी चोट ऊतक कई बार) लेने के लिए और पीसीआर प्रतिक्रिया में Chelex मोतियों की अधिकता को रोकने के लिए के लिए हिस्सा भी शामिल है. Chelex एक कटियन एक्सचेंजर है के रूप में यह गंभीर रूप से दूषित नमूनों में प्रवर्धन रोकने पीसीआर प्रतिक्रिया को रोकता है. दूषित नमूने आसानी से agarose जैल की जेब और प्राइमर dimers के अभाव में दिखाई मोतियों से पहचाना जा सकता है.

विफलता के लिए कम होने की संभावना कारणों सफलतापूर्वक सेक्स के नमूने भी प्रजातियों मतभेद या महिला के नमूने में बैंड अंतर का पता लगाने के लिए एक अलग तकनीक का उपयोग करने के कारण हो सकता है.

Hatchling ज़ेबरा फिन्चेस के नीचे पंख काटना अलग - अलग विषयों को चिह्नित करने के लिए एक सुरक्षित तरीका है. Nestlings गिने पैर बैंड (जैसे ज़ेबरा फिन्चेस में सुबह 10 बजे) प्राप्त करने के लिए काफी पुराने थे जब तक ये 'बाल कटाने' पहचान करने के लिए आसान थे. इस अंकन तकनीक आसानी से अलग experim को पूरा करने के लिए समायोजित किया जा सकता हैअंदरूनी मांगों, जैसे वीडियो रिकॉर्डिंग के लिए चिह्नों लड़कियों के सिर तक सीमित किया जा सकता है. घोंसले पांच nestlings से बड़े होते हैं अगर दो पदों पर कटौती का युग्म लागू किया जा सकता है. 'बाल कटाने' को लागू करने में एक पूर्वनिर्धारित अनुक्रम में रखते हुए (एक घोंसले में जैसे पहले hatchling हमेशा, 'बाल कटवाने ए' प्राप्त करता है दूसरा हमेशा आदि 'बाल कटवाने बी' प्राप्त करता है) पोटा चरण के दौरान अंडे सेने के आदेश के भीतर तेजी से मान्यता देता है. यह कम या यहां तक ​​कि लड़कियों की हैंडलिंग रोका जा सकता है जो त्वरित पहचान, सक्षम बनाता है. ज़ेबरा फिन्चेस में चार स्थानों में से एक पर चढ़ाव की कमी के कारण प्राकृतिक उतार चढ़ाव हो सकता है. इस प्रकार, यह हमेशा एक पूर्वनिर्धारित अंकन अनुक्रम करने के लिए छड़ी करने के लिए संभव नहीं हो सकता.

यहां तक ​​कि nestlings से निपटने में अनुभवहीन किसी के लिए यह नीचे पंख कटौती करने के लिए, सुरक्षित और आसान अंकन तकनीक सीखने के लिए एक जल्दी है. Nestlings की जन्मजात दूरी प्रतिक्रिया सिर आंदोलनों में शामिल हैं लेकिन, जैसा कि कुछ लोग इसे और अधिक कठिन मार्च के लिए जगह खोजनेसिर पर किंग्स. त्रुटि प्रवण पहचान सटीक चिह्नों पर निर्भर करता है. यह अपूर्ण चिह्नों / एकल बाएं बाहर नीचे पंख बाद में पहचान भ्रमित हो सकता है के रूप में अच्छी तरह से, किसी दिए गए स्थान पर पंख पूरे कटौती करने के लिए प्रख्यात महत्व का है.

विधियों का यह सेट बेहद तेजी से, आसान, गैर इनवेसिव, विश्वसनीय और कम लागत, पक्षियों के लिंग निर्धारण और उनकी गैर इनवेसिव, जल्दी, सुरक्षित और आसानी से पहचानने अंडे सेने के बाद मिनट के भीतर अंकन में सक्षम बनाता है.

Subscription Required. Please recommend JoVE to your librarian.


लेखकों का खुलासा करने के लिए कुछ भी नहीं है.


नैतिक समर्थन के लिए सुंदर जैल के लिए और टोबियास Krause करने उल्ला Kobalz को निरंतर सहायता के लिए Janett Birkenfeld के लिए क्षेत्र में उत्साही नमूना संग्रह, के लिए सिल्क कीप्पेड़, सारा Kiefer, माइकल वेस, Conny BARTSCH और सिल्क वोइट-Heucke के लिए बहुत धन्यवाद.


Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn



  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).



    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics