누구는 누구입니까? 비 침습적 인 방법 개별적으로 섹스와 마크 Altricial 병아리

Biology

GE Global Research must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

이 프로토콜은 매우 빠르고, 쉽고, 비 침습, 신뢰성과 저비용 수 방법의 편리한 세트, 조류의 분자 성 결정과 자신의 비 침습, 빠르고, 안전하고 쉽게 알아볼 곧 부화 후 마킹을 제공합니다. 병아리의 제한된 처리가 필요합니다. 방법이 편리한 도구는 RRR-지침을 완전히 준수합니다.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

대부분의 실험은 초기 자손의 성별을 결정뿐만 아니라 초기에 개별 인정 신생아의 표시를 필요로합니다. 적용 할 때마다 동물 복지 가이드 라인에 따르면, 비 침습 기술을 선호한다. 우리 그룹에서, 우리는 실험실과 현장에서 노래 조류의 종에서 작동하고, 우리는 성공적으로 섹스에 비 침습적 인 방법을 적용하고 개별적으로 병아리를 표시합니다. 이 문서는 포괄적 인 비 침습 도구 상자를 제공합니다. 새를 Sexing하기 전에 보조 성적 특성의 발현을 PCR을위한 DNA 함유 물질의 수집이 필요합니다. 우리는 구강 면봉의 DNA를 추출하여 모든 연령 (포스트 부화)의 성 조류에 빠르고 쉬운 방법을 설립했다. 결과, 3 시간 내에 얻을 수있다. 개별 표시 병아리의 다운 깃털이 부화 순서 내에서 빠른 식별을 허용하는 특정 패턴으로 트리밍됩니다하십시오. 방법의이 세트는 표준 장비 실험실에서 쉽게 적용 가능하며 일하고에 특히 적합특별한 장비와 같은 분야에서 G는 샘플링과 저장을 위해 필요합니다. 병아리의 취급을 최소화하고 표시 및 sexing 기술함으로써 동물 복지 가이드 라인의 RRR 원리를 지원하는 비 침습된다.

Introduction

개별 인식, sexing과 유전자형이 실험 연구의 다양한 기본 전제 조건이다. DNA 베어링 재료를 얻기 및 (심지어 어린 나이에) 명확하게 주제를 표시하는 생리, 행동, 그리고 생존에 미치는 영향을 최소화해야한다. 가능하면, 침략적인 절차는 RRR 원칙 1에 따라 피해야한다.

비 침습적 인 방법뿐만 아니라 동물에 대한 도움이됩니다뿐만 아니라 동물이 적은 치료에 의해 영향으로 얻어진 데이터를 향상시킬 수 있습니다.

조류, DNA의 sexing는 배설물이, 깃털 3,4 또는 구강 면봉 3,5,9와 같은 비 침습적으로 얻을 수있는 재료의 수에 수행 할 수 있습니다. 그들이 수행 쉽기 때문에 상관없이 피사체의 상태와 연령 구강 면봉의 조류 sexing에 대한 선택의 방법은 거의 실패하지 않습니다 및 취급이 짧고,,입니다.

구강 면봉 지금까지 DNA시판 키트 3,6 또는 시간 표준 DNA 추출 프로토콜 3,6-8 소모로 추출 하였다. 장비뿐만 아니라 오히려 비싸지 만, 자신의 프로토콜은 현장 작업을위한 과제를 부과 할 수 있습니다. 일부 세부 절차, 예를 들면 건조 및 샘플의 배양은, 현장에서 실제 없습니다. 특히 실험 프로토콜이 이미 몇 분 후 부화로에서 섹스 의존 치료를 필요로 설정의 결과를 얻을 수있는, 빠르고 비 침습적, 믿을 수있는 쉬운 방법을 촉구있다.

조류 분류군에 걸쳐 표시 개인을위한 많은 도구 상자 (10)를 개발하고있다. 사용 가능한 기술의 광범위한 연구의 목적, 종류 및 예산의 다양한 차지한다. 그러나, 작은는 nestlings를 표시하는 추가 과제와 연구자를 직면하고있다. 어떤 종에서 (예를 들면 passerines) 병아리 다리 밴드를 적용하기에 너무 작고 다른 방법을 필요로하는부모 - 자식의 동작을 변경하지 않습니다. 인식과 동물 복지 현장 및 실험실 연구에서 기술 향상에 대한 관심이 증가함에 따라, 비 침습 기술의 사용을 강력하게 권장하고 바람직하다.

이 프로토콜은 개별적으로 다리 밴드를 적용하기 전에 아주 어린는 nestlings를 표시하는 비 침습, 빠르고, 쉽게 인식하고 지속적인 방법을 제공하는 것은 가능하다. 이 표시 방법은 가장 중요한 조류 실험실 모델 종 중 하나, 얼룩말 핀치 (Taeniopygia의 guttata) 11 ~ 13에 도입된다. 이 프로토콜은 개별 마킹 기술 10 이전에 게시 된 모든 목적을 준수하며 이미 성공적으로 14, 15을 적용하고있다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

모든 절차는 동물 보호 (TierSchG)에 대한 독일의 법률을 준수 하였다.

시약 및 소모품의 1. 준비

  1. 분자 수준의 물에 5 % (w / w) Chelex-100 솔루션을 준비합니다. 표준 1.5 ml의 반응 튜브에 200 ㎕의 분취 량을 준비합니다. Chelex 수지 현탁액으로부터 빠른 침전이 그것의 분취 량을 준비하는 동안 계속해서 다시 균질화 정지 할 필요가있다. 그것은 하나의 일괄 처리로 50 ㎖ 이상을 준비하고 자기 교반기를 사용하여 균질 현탁액을 유지하는 것이 바람직합니다. Chelex 용액은 주위 조건에서 수년 동안 저장 될 수있다.
  2. 테스트 할 수있는 새의 부리 폭보다 작은 폭 와트 만의 종이 조각을 잘라. 용지의 길이는 샘플을 채취하는 방법에 따라 다릅니다 :
    1. 집게를 사용하여 조각은 새의 부리에 삽입되는 집게​​없이 샘플 수집을 가능하게 충분히 길어야한다. 로대략적인 견적은 0.5 cm의 부리 길이 1cm의 길이와 종이가 잘해야한다.
    2. 집게를 사용하지 않는 경우, 매 이상이어야하지만 매의 강성은 여전히​​ 상피 세포의 샘플링을 허용한다.
  3. 분석 할 수있는 각각의 샘플에 대해 PCR 프리믹스 중 하나 나누어지는을 준비합니다. μL (25)의 총 부피에서 PCR을 위해 믹스 0.18 밀리미터의 dNTPs, 2 mM의 MgCl2를, 70 mM 트리스 - 염산, 17.25 mM의 황산 암모늄, 0.1 % 트윈 -20, 0.32 μM의 P2 프라이머 (TCTGCATCGCTAAATCCTTT), 0.32 μM의 P8을 포함 프라이머 (CTCCCAAGGATGAGRAAYTG) (16)와 2 기의 DNA 형성 촉매 효소. 집에서 만든 DNA 형성 촉매 효소 (17)는 사용할 수 있습니다. DNA-솔루션의 최대 금액의 추가를 허용하려면 6 μL 프리믹스는 몇 주 동안 준비하고 -20 ° C에 저장할 수 있습니다.

2. 시료 채취

장갑을 착용하는 것은 PCR 프라이머는 인간의 DNA에 어닐링 할 수 없기 때문에 조류의 성별 결정에 필수적인 것은 아니다. 에다른 유전자형의 목적은 권할 수 있습니다.

  1. 그 새를 캡처하고 부드럽게 '벨소리의 그립'(18)와 한 손 예에 고정. 새를 짜내하지 않도록하십시오.
  2. 집게로 왓트 만 종이 조각을 잡고 뺨, 혀와 choana의 내부를 가로 질러 여러 번 슬쩍. 보통 샘플은 30 초 미만 내에​​서 얻어진다.
    1. 성인 동물 : 종류에 따라 그것의 부리를 열고 새를 얻을 어려울 수 있습니다. 보통 부리의면을 만지지 부드러운 압력을 적용하여 작동합니다.
    2. 는 nestlings : 새끼 나는 nestlings에서 샘플링하는 것은 자신의 구걸 행위가 부리의 내부에 쉽게 액세스를 제공,이 기술을 사용하여 특히 쉽습니다. 자신의 nestbox가 열릴 때 쉽게 예를 구걸로도, 전혀 취급하지 않고 샘플을 얻을 수있을 수 있습니다.
  3. 즉시 준비된 반응 관 contai에서 용지를 저장할5 %의 닝 200 μL (W / W) Chelex-100 솔루션입니다.

당신은 또한 /하려는 경우 6 장에서 설명한대로 지금 바로, 병아리를 표시해야합니다.

DNA 추출하기 전에 샘플 3. 저장

  1. -20 ° C에서 실험실에서 작업하는 경우, 저장 샘플 이 주위 온도에서 저장 샘플 수 또는 (현장에서 예) 어려운되지 않습니다.
  2. 샘플은 실내 온도에서 -20 ℃까지의 온도 범위에서 3 년 이상 저장 될 수있다

4. DNA 추출

  1. 시료가 동결되면, 상온 해동.
  2. 종이 조각이 Chelex-100 용액에 잠긴 튜브의 바닥에 있는지 확인합니다.
  3. 56 ℃에서 15 분 동안 샘플을 품어
  4. 소용돌이 짧게 튜브의 내용을 스핀 다운.
  5. 100 ℃에서 8 분의 샘플을 품어
  6. 3 분 동안 15,000 XG에서 샘플을 스핀.
  7. 의를 사용하여이후의 유전자형에 upernatant.

5. 분자 성 결정

  1. 샘플 당 6 μL 프리믹스 플러스 마이너스 (필수)과 양성 대조군 (옵션)에 대한 두 개의 추가 튜브 하나 PCR 튜브를 준비합니다. 일상적인 성 결정에 대한 긍정적 인 컨트롤과 마지막으로 성공한 sexing의 샘플이 (가) 있습니다.
  2. PCR 프리믹스로 DNA 추출에서 상층의 19 μl를 추가합니다. Chelex 비즈의 이월을 방지하기 위해 용액의 표면에서 피펫해야합니다. Chelex는 양이온 교환 체이며, 따라서 심각 모든 효소 반응을 억제로서 이것은 중요하다.
  3. 3 분, 72 °에서 45 초 신장 단계에서 다음 55 ° C에서 30 초 어닐링 단계, 다음에 30 초 용융 단계 94 ° C, 45 회 각각 94 ° C에서 배양 다음 PCR 프로그램을 실행 C. 최종 추적 오프 단계에서, 반응은 72 ℃에서 5 분 동안 배양
  4. 2 %의 기준 TBE 또는 TAE의 agaro 준비 PCR 제품을 분리하는 자체 젤.
  5. 적절한 전압 설정을 사용하여 아가 로스 젤을 실행합니다.
  6. UV 빛의 밑에 밴드를 시각화하고 사진 촬영을합니다. 여성에서 발생하는 샘플의 두 밴드가 잘 분리되어 있는지 확인하십시오.
  7. 하나 (남성) 또는 2 개 (여성) 밴드의 존재에 의해 여성의 샘플에서 남성을 구분합니다.

6.는 nestlings 마킹

  1. 종 / 연구를위한 일정 적절한에 부화 된 병아리에 둥지를 확인 (대부분의 병아리가 부화 다음과 같이 아침에 예를 들어 매일 검사가 권장됩니다.)
  2. 다른 특성 위치에 둥지 내의 각 여자의 아래로 깃털을 잘라. 얼룩말 핀치에서 다운의 술은 새 새끼의 몸 (그림 4A)에 걸쳐 네 개의 특성과 별개의 지역에서 성장. 각 병아리를 들어 하나의 영역 (그림 4B)를 잘라. 한 둥지 사이 개 이상의 병아리가 있다면, 고유 한 넷 '이발'는 결합 될 수있다.
얼룩말 핀치에 대한> "ove_content : 아래로 깃털을 감지하고 새끼의 크기가 울리는 허용 어려워 때 부화 포스트 십일에 다리 밴드를 적용합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

협측 면봉 작은 조류의 다양한 성 결정을위한 DNA를 얻기 위해 사용될 수있다

, 카나리아 (Serinus 카나리아), 벵골 피리새 류 (Lonchura의 선조체), 나이팅게일 (Luscinia의 megarhynchos), 박새 (Parus 주요)와 찌르레기 (Turdus - 샘플은 얼룩말 피리새 류 (5 년 Taeniopygia의 guttata, 99 개인, 0 세 일간)에서 수집 된 merula) (다른 종 : 샘플 크기 1-3, 나이 알 수 없음) (그림 1).

얼룩말 피리새 류에서 가져온 샘플의 경우, PCR들에 대한 성공률은 100 %였다. PCR의 결과는 항상 (는 nestlings있는) 표현형 검사 (성인) 이전 또는 이후에 의해 결정 성을 일치. 밴드의 강도는 DNA 함유 물질의 비슷한 양의 모든 연령대에서 얻은 있음을 나타내는는 nestlings 또는 성인 사이에 체계적으로 차이가 없었다.

그림 1 "FO : 콘텐츠 너비 ="/ files/ftp_upload/51429/51429fig1highres.jpg "SRC ="/ files/ftp_upload/51429/51429fig1.jpg "/>"SRC = FO "6 인치
그림 1. 분자 sexing. 다양한 조류 종에서 얻은 구강 면봉 sexing 결과의 예. 2 % 아가 로스 젤에 티듐 브로마이드로 염색. 왼쪽에서 오른쪽으로 : 크기 마커, 얼룩말 핀치 남성, 벵골 핀치 여성, 블랙 버드 남성, 큰 가슴 남성, 나이팅게일 남성, 카나리아 남성, 물 관리, 크기 마커.

이것은 PCR들에 Chelex 이월 오염을 방지하는 것이 중요

PCR 반응에 Chelex 수지 오염의 효과를 입증하기 위해, 우리는 PCR 반응에 Chelex 비즈의 작은 금액 (그림 2)를 포함. 도 2a에서 알 수있는 바와 같이, Chelex 비즈 이월 오염은 상기 오염 된 샘플에서 프라이머 이량 체 (의 부족에 의해 도시되어 DNA의 증폭 <방지강한> 그림 2B). 그림 2A 레인 2에서 우리는 Chelex 이상 수행하지 않고 PCR에 대해 동일한 샘플을 사용했다. 보통 오염 된 샘플은 아가로 오스 겔 (그림 2B)의 주머니에 검은 반점에 의해 쉽게 인식 할 수 있습니다.

그림 2
그림 2. Chelex 오염. A) PCR 반응에 Chelex 이월는 DNA의 증폭을 억제한다. 왼쪽부터 오른쪽으로 :. 크기 마커, 얼룩말 핀치 남성, 얼룩말 핀치 여성, Chelex의 의도적 인 이월과 같은 샘플, 물 관리, 크기 마커 B) Chelex 비즈 Chelex없이 왼쪽 젤의 주머니에 어두운 얼룩 (로 쉽게 볼 수 있습니다 오른쪽으로 Chelex. Chelex의 존재 하에서 PCR 반응의 저해는 중증 누락 프라이머 D에 의해 도시된다오염 된 샘플 IMER 형성.

샘플은 3 년 이상 DNA 추출하기 전에 실온에서 저장 될 수있다

성공적인 추출 여전히 오랜 저장 한 후에 수행 할 수 있는지 여부를 조사하기 위해, 샘플은 동일한 조류에서 반복적으로 수행하고, 최대로 3 년 동안 주위 온도에서 실험실에 저장된다. 샘플은 태양의 빛과 열을 자연 노출 창가에 저장되었습니다. 3 년 DNA 추출 및 sexing PCR을 실시 하였다. 결과는 한 3 년 이전 (오른쪽 샘플링 후) 수행 및 저장의 효과 (그림 3) 표시되지 않은 일치.

그림 3
도 3. Chelex는 befo 샘플의 장기 저장을 허용표에 표시된대로 두 동물 (남성 왼쪽, 여성 오른쪽) 재 및 DNA 추출 후. 샘플은 서로 다른 조건에서 보관 하였다. 신호는 모든 샘플에서 성공적으로 얻었다.

그림 4
그림 4. 병아리의 표시. A) 도식 표현, 얼룩말 핀치는 nestlings에서 다운 깃털 성장의 네 가지 영역의 명칭 :.는 nestlings의 A = 머리, B = 백, C = 날개 (모두), D = 측면 (모두) B) 예제 사진되는 하나 각각의 '이발'(AD) 또는 아니오 '헤어 스타일'(E) 중 하나를 받았다.

추출 된 DNA는 4 ° C에서 3 년 이상 저장 될 수있다

첫 번째 실험에서 얼룩말 핀치 샘플은 표준 실험실 (금)에서 3 년 동안 보관 하였다4 ° C에서 성공적 총재는 재시험. 모든 샘플은 직접 DNA 추출 (그림 3) 후 동일한 PCR 결과를 얻었다.

새끼는 부화에 대한 개별 인정을 가능하게하기 위해 다운 깃털을 트리밍하여 표시 할 수 있습니다

바로 자신의 아래로 깃털을 절단하여 부화 후 개별는 nestlings를 표시하면 (그림 4, 5, 6)이를 쉽게 인식했다. 다운 깃털이 자신의 수염과 같은 솜털 모양이는 부드러운 날개를 형성하기 위해 함께 가입하지 않습니다. 그들은 아직도 그때까지 몸 (그림 5) 커버 개발 깃털의 끝에서 부화 후 10 일째에 인식 할 수있다. 서로 다른 위치에서 자신의 부재는 때로는는 nestlings (그림 6)을 취급하지 않고, 인식이 쉽습니다. 이러한 소위 '이발'을 적용하면 성공적으로 얼룩말 FINC 둥지의 신체 사이즈까지 부화까지의 시간의 간격을 채우는 우아한 기술이다신은 다리 밴드의 적용이 가능합니다.

그림 5
포스트 해치 하루 10에서 그림 5. 표시됨 얼룩말 핀치는 nestlings는. 사진은 (위) 또는 (화살표)를 표시하지 않고 하나는 nestlings을 보여줍니다. A = 머리, B는 = 다시, C = 날개, D = 측면 : 화살표 아래로 깃털 '이발'의 각각의 명칭에 따라 그 위치를 가리 킵니다.

그림 6
명명법에 따라 산후 둥지 안에 표는 nestlings의 그림 6. 인식 (나이 = 십일 의미).두 날개가 누락으로 만 머리에 누락으로 인해 자신의 눈에 띄는 다운 깃털에 자리에 쉽게 A = 머리,,. B = 백, 다운 깃털 보이는 모든 위치에 있지만, 다시. C = 날개는 세심한 관찰자가 필요합니다 깃털 아래 만의 새끼 자세는 머리에서 아래로 깃털이 오른쪽 측면을 포함한다.의 측면을 볼 수 없으므로 D = 측면은 만 제거하는 과정으로 인식 할 수있다. 그것은 머리에 아래로 맑은 깃털의 성장을 보여줍니다로 확실하게 D로 인식 할 수있는, 다시 그것의 날개. E 뒤로 (B) '이발'헤드 (A)과의 조합을 =에로 ​​아래로 깃털을 구별하기 쉬운 머리와 다시가 누락되었습니다. F 만 표시 머리와 같은 다른 옵션을 제거를 통해 차별화 할 수있는 '미용실'(머리)와 D (측면)의 조합을 = 것은 분명하고 다른 알 수없는 새끼 마킹 머리를 전시하지 않습니다. G의 =하지 않았다모든 표시를 수신하고 부화 마지막으로 형제보다 훨씬 작다. 또한 G는 모든 위치에서 깃털을 표현하지 않는 새끼에 대한 좋은 예입니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Chelex를 이용한 구강 면봉 Sexing는 매우 높은 성공률을 나타내었다. 다리 밴딩이 가능해질 때까지 절단 해츨링의 다운 깃털는 nestlings 사이에 차별화를 가능하게했다.

구강 면봉 Chelex-DNA 추출이 성공적 분자 sexing을 수행하기에 충분한 DNA를 얻었다. 성별 결정은 성적으로 동종 이형의 깃털에 의해 확인으로 100 % 정확했다. 여기에보고 성공률이 이전의 연구에서보고 된 7,9 속도보다 현저히 높다. Chelex와 DNA 추출 물질이 손실 될 수있는 피펫 및 침전 단계를 최소화 할 수 있습니다. 그러나 다른 종에 우리의 프로토콜을 검증하는 연구 중 하나는 (푸스의 APU 군단은) 여전히이 이미 아리마 등에보고 된 82 %보다 현저히 높았다에도 불구하고 89 % 9의 낮은 성공률을 기록했다. 7.

무엇이 원인이 될 수 있을까? 가장 중요한 부분은주의 깊게 제자를 수행하는 것입니다ocol, 샘플 (입안에 부드럽게 강타 조직을 여러 번)를 취할 및 PCR 반응에 Chelex 비즈의 이월을 방지하는 방법에 대한 부분을 포함. Chelex는 양이온 교환 체 그대로 심하게 오염 된 샘플에서 증폭을 방지하는 PCR 반응을 억제한다. 오염 된 샘플은 쉽게 아가 로스 젤의 포켓 프라이머 이량 체의 부족에 표시 비즈에 의해 인식 될 수있다.

실패 어려울 이유가 성공적으로 섹스 샘플은 종의 차이 또는 여성의 샘플에서 밴드의 차이를 감지 할 수있는 다른 기술의 사용으로 인해이 될 수 있습니다.

갓 부화 한 얼룩말 핀치의 다운 깃털을 절단 개별적으로 과목을 표시 할 수있는 안전한 방법입니다. 는 nestlings이 번호가 다리 대역 (예를 들어, 얼룩말 핀치 하루 10시)을받을 정도로 오래 될 때까지이 '이발'은 쉽게 인식 할 수 있었다. 이러한 마킹 기술은 용이하게 상이한 experim 맞게 조정될 수도ental 요구는, 예를 들어, 비디오 녹화를위한 표시는 새끼의 머리를 제한 할 수 있습니다. 둥지 다섯는 nestlings보다 큰 경우에는이 위치에서 절단의 조합이 적용될 수있다. '이발'적용하는 미리 정의 된 순서를 유지 (둥지에서 예를 들어, 첫 번째 부화 항상, '헤어 스타일'을받는 두 번째는 항상 '등 이발 B'를 수신) 라크로 세 단계에 걸쳐 부화 순서 내에서 신속하게 식별 할 수 있습니다. 이 감소 또는 새끼 취급을 방지 할 수 있습니다 빠른 식별을 가능하게한다. 얼룩말 핀치에, 4 곳 중 한 곳에서 다운 부족으로 인해 자연적인 변동이 발생할 수 있습니다. 따라서, 항상 미리 마킹 시퀀스에 충실하지 못할 수있다.

심지어는 nestlings 처리에 경험이없는 사람은 다운 깃털을 잘라, 안전하고 쉬운 마킹 기술을 배울 수있는 신속입니다. 는 nestlings의 타고난 벌어진 응답이 머리의 움직임을 포함하기 때문에, 어떤 사람들은 더 어렵 월을 배치 발견머리에 왕. 오류가 발생하기 쉬운 식별은 정확한 표시에 의존한다. 그것은 불완전한 표시 / 단일 왼쪽 아웃 다운 깃털 나중에 신원을 혼동 수 있으므로 철저하게, 주어진 자리에서 깃털을 전체를 잘라 저명한 중요하다.

방법의이 세트는 매우 빠르고, 쉽고, 비 침습, 신뢰성과 저렴한 비용, 조류의 성 결정과 자신의 비 침습, 빠르고, 안전하고 쉽게 인식 부화 후 몇 분 안에 표시 할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자가 공개하는 게 없다.

Acknowledgements

도덕적 지원을위한 아름다운 젤과 토비아스 크라우스 울라 Kobalz에 계속 지원을위한 Janett Birkenfeld에 현장에서 열정적 인 시료 채취에 대한 실케 키퍼, 사라 키퍼, 마이클 와이즈, 코니 BARTSCH 및 실케 보이트 - Heucke에 많은 감사.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics