¿Quién es quién? Métodos no invasivos para Individualmente Sexuales y Mark altriciales Chicks

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Este protocolo proporciona un conjunto práctico de los métodos, que permite extremadamente rápido, fácil, no invasivo, confiable y de bajo costo, la determinación del sexo molecular de las aves y su no invasivo, rápido, seguro y fácil de reconocer que marca poco después de la eclosión. Sólo se requiere un limitado manejo de los pollitos. Esta caja de herramientas práctica de métodos cumple en su totalidad con las RRR-directrices.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Muchos experimentos requieren la determinación temprana del sexo de la descendencia, así como principios de marcado de los recién nacidos para el reconocimiento individual. De acuerdo con las directrices de bienestar animal, las técnicas no invasivas se debe preferir siempre que sea aplicable. En nuestro grupo, trabajamos en diferentes especies de aves de la canción en el laboratorio y en el campo, y la aplicamos con éxito métodos no invasivos para el sexo e individualmente marcamos polluelos. Este artículo presenta una caja de herramientas no invasivas integral. Sexing aves antes de la expresión de características sexuales secundarias requiere la colección de material de ADN-cojinete para la PCR. Hemos establecido un método rápido y fácil de las aves del sexo de cualquier edad (post eclosión) mediante la extracción de ADN a partir de hisopos bucales. Los resultados se pueden obtener dentro de 3 horas. Por abajo plumas de pollo marcado individuo se recortan en los patrones preestablecidos que permiten una rápida identificación en el orden de eclosión. Este conjunto de métodos de fácil aplicación en un laboratorio equipado de serie y especialmente adecuado para WorkinSe requiere g en el campo como ningún equipo especial para el muestreo y el almacenamiento. Manejo de los pollos se reduce al mínimo y el marcado y sexado son técnicas no invasivas apoyando así la RRR-principio de directrices de bienestar animal.

Introduction

El reconocimiento individual, sexaje y genotipado son requisitos fundamentales en una variedad de estudios experimentales. La obtención de material para cojinetes de ADN y marcado sujetos sin ambigüedad (incluso a una edad temprana) debe tener un mínimo impacto en la fisiología, el comportamiento y la supervivencia. Siempre que sea posible, los procedimientos invasivos deberían evitarse de acuerdo con el principio RRR 1.

Los métodos no invasivos no sólo son beneficiosos para el animal, pero también pueden mejorar los datos obtenidos como animales se ven menos afectadas por los tratamientos.

En las aves, la determinación del sexo de ADN se puede realizar en un número de materiales que se pueden obtener de forma no invasiva como excrementos de 2, 3,4 plumas o hisopos bucales 3,5,9. Independientemente de la condición y edad hisopos bucales del sujeto son el método de elección para el sexaje aviar, ya que son fáciles de realizar, rara vez fallan y la manipulación es corto.

Hasta el momento, el ADN de los hisopos bucalesse extrajo bien con los kits disponibles en el mercado 3,6 o que consumen tiempo protocolos de extracción de ADN convencionales 3,6-8. Kits no sólo son bastante caros, pero sus protocolos pueden imponer desafíos para el trabajo de campo. Algunos detalles de procedimiento, por ejemplo, el secado y la incubación de las muestras, no son prácticos en el campo. Especialmente en un entorno donde los protocolos experimentales requieren tratamiento depende del sexo ya desde unos pocos minutos después de la eclosión, se inste a un método rápido, no invasivo, confiable y fácil de obtener resultados.

Al otro lado de la taxa de aves una caja de herramientas considerable para las personas que marcan ha desarrollado 10. La amplia gama de técnicas disponibles da cuenta de la variedad de objetivos de la investigación, las especies y los presupuestos. Sin embargo, marcado de los pequeños polluelos se ha enfrentado a los investigadores con los retos adicionales. En algunas especies (por ejemplo, paseriformes) pollitos son demasiado pequeños para aplicar en las patas y requieren de procedimientos alternativos, queno alterar el comportamiento de padres y crías. Mientras que el conocimiento y el interés en la mejora del bienestar y de las técnicas en los estudios de campo y de laboratorio de los animales es cada vez mayor, el uso de técnicas no invasivas es altamente recomendable y preferible.

Este protocolo proporciona un método no invasivo, rápido, fácil de reconocer y persistente para marcar individualmente pollos muy jóvenes, antes de aplicar bandas para las piernas es factible. Este método de marcado se introduce en una de las más importantes especies modelo de laboratorio de aves, el pinzón de cebra (Taeniopygia guttata) 11-13. El protocolo se cumplan todos los objetivos previamente publicados para técnicas de marcado individuales 10 y ya ha sido aplicado con éxito 14,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos los procedimientos se realizaron de conformidad con la ley alemana para la protección de los animales (TierSchG).

1. Preparación de Reactivos y Consumibles

  1. Preparar un 5% (w / w) Chelex-100 solución en agua de grado molecular. Preparar alícuotas de 200 l en tubos de reacción de 1,5 ml de estándar. Como la resina Chelex precipita rápido de la suspensión es necesario volver a homogeneizar la suspensión constantemente durante la preparación de las alícuotas. Es aconsejable preparar 50 ml o más en un lote y mantener la suspensión se homogeneizó usando un agitador magnético. La solución Chelex se puede almacenar durante años en condiciones ambientales.
  2. Cortar trozos de papel Whatman con una anchura menor que la anchura de pico del ave a ser probado. La longitud del papel depende del método para tomar la muestra:
    1. Con unas pinzas, la pieza debe ser lo suficientemente largo para permitir la recogida de muestras sin la pinza que se inserta en el pico del ave. Comoestimación aproximada, para una longitud de pico de 0,5 cm un pedazo de papel con la longitud de 1 cm debe estar bien.
    2. Si no usa fórceps, la pieza debe ser más largo, pero la rigidez de la pieza todavía debe permitir el muestreo de las células epiteliales.
  3. Preparar una alícuota de la premezcla de PCR para cada muestra a analizar. Para una PCR en un volumen total de 25 l de la mezcla contiene 0,18 mM de dNTP, 2 mM de MgCl 2 mM, Tris-HCl 70, sulfato de amonio 17,25 mM, 0,1% de Tween-20, cebador P2 0,32 M (TCTGCATCGCTAAATCCTTT), P8 0,32 M cebador (CTCCCAAGGATGAGRAAYTG) 16 y 2 unidades de Taq polimerasa. Casera Taq polimerasa 17 se puede utilizar. Para permitir la adición de la cantidad máxima de ADN-solución, una premezcla de 6 l se puede preparar y se almacenó a -20 ° C durante varias semanas.

2. Toma de Muestras

El uso de guantes no es esencial para la determinación del sexo aviar como los cebadores de PCR no pueden hibridar con el ADN humano. Paraotros fines de genotipificación podría ser aconsejable.

  1. Capturar el pájaro de interés y suavemente sostener en una mano por ejemplo con el "agarre de timbre '18. Asegúrese de no apretar el pájaro.
  2. Sostenga un pedazo de papel Whatman con un fórceps y pásela varias veces a través del interior de las mejillas, la lengua y la coana. Por lo general, las muestras se obtienen en menos de 30 segundos.
    1. Los animales adultos: dependiendo de la especie que podría ser difícil conseguir el pájaro para abrir el pico. Por lo general, tocando el lado del pico y la aplicación de una presión suave funcionará.
    2. Los pichones: Muestreo de crías o polluelos es especialmente fácil de utilizar esta técnica, ya que su comportamiento mendicidad proporciona un fácil acceso al interior del pico. Incluso podría ser posible obtener la muestra sin gastos de envío en absoluto, ya que ruegan fácilmente por ejemplo, cuando se abre la caja para anidar.
  3. Inmediatamente almacenar el papel en un tubo de reacción preparados contaiNing 200 l de la 5% (w / w) Chelex-100 de la solución.

Si usted también piensa / que marcar los polluelos, hágalo ahora como se describe en la sección 6.

3. Almacenamiento de Muestras antes de Extracción de ADN

  1. Si trabajan en el laboratorio, guarde las muestras a -20 ° C. Si esto no es posible almacenar las muestras o difíciles (por ejemplo, en el campo) a temperatura ambiente.
  2. Las muestras se pueden almacenar durante más de 3 años a temperaturas que van desde temperatura ambiente a -20 ° C.

4. Extracción de ADN

  1. Si se congela la muestra, descongele a temperatura ambiente.
  2. Asegúrese de que la hoja de papel es en la parte inferior del tubo sumergido en la solución de Chelex-100.
  3. Incubar las muestras durante 15 min a 56 ° C.
  4. Brevemente Vortex y girar hacia abajo el contenido del tubo.
  5. Se incuban las muestras durante 8 minutos a 100 ° C.
  6. Haga girar las muestras a 15.000 g durante 3 min.
  7. Utilice los supernatant para la posterior determinación del genotipo.

5. Molecular Determinación del Sexo

  1. Preparar un tubo de PCR con 6 l de premezcla por muestra además dos tubos adicionales para el negativo (obligatorio) y positivo de control (opcional). Para la determinación del sexo de rutina incluyen una muestra de la última determinación del sexo éxito como un control positivo.
  2. Añadir 19 l del sobrenadante de la extracción de ADN a la premezcla de PCR. Asegúrese de pipeta de la superficie de la solución para evitar el arrastre de los granos de Chelex. Esto es crucial, como Chelex es un intercambiador de cationes y por lo tanto inhibe severamente todas las reacciones enzimáticas.
  3. Ejecutar el siguiente programa de PCR: La incubación a 94 ° C durante 3 min, 45 ciclos cada uno con una etapa de fusión 30 seg 94 ° C, seguido por una etapa de recocido 30 seg a 55 ° C, seguido de una etapa de elongación 45 seg a 72 ° C. En un paso final ahuyentar, las reacciones se incubaron durante 5 min a 72 ° C.
  4. Prepare una TBE estándar de 2% o TAE agaro SE gel para separar los productos de la PCR.
  5. Ejecute el gel de agarosa con valores de voltaje apropiados.
  6. Visualice las bandas de la luz ultravioleta y tomar una foto. Asegúrese de que las dos bandas en las muestras procedentes de las hembras están bien separados.
  7. Distinguir los varones de muestras de mujeres por la presencia de uno de dos bandas (hembra) (macho) o.

6. Marcado Nestlings

  1. Compruebe nidos para los pollitos recién nacidos en un horario adecuado para la especie / estudio (por ejemplo, revisiones diarias por las mañanas se les aconseja que la mayoría de los polluelos salen del cascarón en ese entonces).
  2. Cortar las plumas hacia abajo de cada pollo en un nido en un lugar característico diferente. En los pinzones cebra mechones de bajadas crecen a cuatro zonas características y distintas a través del cuerpo (Figura 4A) del polluelo. Para cada pollito cortar un área (Figura 4B). Si hay más de cuatro polluelos en un nido, se pueden combinar los únicos cuatro «recortes».
ove_content "> Para los pinzones cebra: Aplicar en las patas a los diez días después de la eclosión, cuando plumón se vuelven difíciles de detectar y tamaño pichón permite sonar.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Hisopos bucales se pueden utilizar para obtener el ADN para la determinación del sexo en una variedad de pájaros pequeños

Se recogieron muestras de pinzones cebra (guttata Taeniopygia, 99 individuos, de edad 0 días - 5 años), Canarias (Serinus canaria), bengalíes Pinzones (Lonchura striata), ruiseñores (Luscinia megarhynchos), Grandes Tetas (Parus major) y mirlos (Turdus merula) (para todas las demás especies: tamaño de la muestra 1-3, edad desconocida) (Figura 1).

Para las muestras tomadas de pinzones cebra, la tasa de éxito de las PCR fue del 100%. El resultado de la PCR siempre se correspondía con el sexo determine previo (en adultos) o más tarde (en pollos) inspección fenotípica. La intensidad de las bandas no difirió de manera sistemática entre los pichones o adultos que indican que una cantidad similar de material de ADN de soporte se obtienen a partir de todas las edades.

Figura 1 "fo: content-width =" 6 pulgadas "fo: src =" / files/ftp_upload/51429/51429fig1highres.jpg "src =" / files/ftp_upload/51429/51429fig1.jpg "/>
Figura 1. Molecular sexado. Ejemplos de resultados de sexaje de hisopos bucales obtenidas de varias especies de aves. 2% de gel de agarosa teñido con bromuro de etidio. De izquierda a derecha: marcador de tamaño, pinzón de cebra macho, hembra bengalí Finch, Mirlo macho, macho Gran Tit, Nightingale varón, masculino de Canarias, el control del agua, el tamaño del marcador.

Es importante para prevenir la contaminación por arrastre de Chelex en las PCR

Para demostrar el efecto de la contaminación de resina Chelex en una reacción de PCR, se incluyó una pequeña cantidad de cuentas de Chelex en una reacción de PCR (Figura 2). Como puede verse en la Figura 2A, la contaminación por arrastre de perlas de Chelex impide la amplificación de ADN que se ilustra aún más por la falta de formación de dímero de cebadores en la muestra contaminada (<strong> Figura 2B). En la Figura 2A carril 2 se utilizó la misma muestra para la PCR sin llevar más de Chelex. Por lo general, las muestras contaminadas son fácilmente reconocibles por las manchas oscuras en los bolsillos del gel de agarosa (Figura 2B).

Figura 2
Figura 2. Contaminación Chelex. A) Chelex arrastre en la reacción de PCR inhibe la amplificación de ADN. De izquierda a derecha:. Marcador de tamaño, pinzón de cebra macho, hembra Zebra Finch, misma muestra con el arrastre intencional de Chelex, control del agua, tamaño marcador B) cuentas de Chelex son fácilmente visibles como manchas oscuras en el bolsillo del gel (izquierda sin Chelex , derecha con Chelex. La severa inhibición de la reacción de PCR en presencia de Chelex también se ilustra por el cebador que falta dformación imer en la muestra contaminada.

Las muestras se pueden almacenar a temperatura ambiente antes de la extracción de ADN de más de tres años

Con el fin de investigar si la extracción exitosa todavía se puede realizar después de un almacenamiento largo, se tomaron muestras repetidamente de la misma ave y se almacenan en el laboratorio a temperatura ambiente durante como máximo tres años. Las muestras fueron almacenadas cerca de una ventana con la exposición natural a la luz y el calor del sol. Después de tres años de ADN se extrajo y la determinación del sexo de PCR a cabo. El resultado coincide con la que realizó tres años antes (a la derecha después del muestreo) y no indica ningún efecto del almacenamiento (Figura 3).

Figura 3
Figura 3. Chelex permite el almacenamiento a largo plazo de muestras before y después de la extracción de ADN. Las muestras de dos animales (hombres de izquierda, derecha femenino) se almacenaron bajo condiciones diferentes, como se indica en la tabla. Las señales se obtuvieron con éxito de todas las muestras.

Figura 4
Figura 4. Marcado de los polluelos. A) Representación esquemática y la nomenclatura de las cuatro áreas distintas de crecimiento de las plumas en los polluelos de pinzones cebra:. A = cabeza, B = volver, C = alas (ambos), D = flancos (ambos) B) Ejemplo de imágenes de los pichones que, o bien recibido una de las respectivas «recortes» (AD) o no 'haircut' (E).

ADN extraído puede almacenarse durante más de tres años a 4 ° C

Muestras pinzón cebra del primer experimento se almacenaron durante tres años en un vie estándar de laboratoriodge a 4 ° C y con éxito vuelto a probar. Todas las muestras dieron los mismos resultados de la PCR como directamente después de la extracción de ADN (Figura 3).

Las crías pueden ser marcados por el recorte de sus plumas hacia abajo para permitir el reconocimiento individual de la eclosión en

Marcado polluelos individuales justo después de la eclosión, cortando sus plumas hacia abajo los hacía fácilmente reconocible (Figuras 4, 5, 6). Abajo plumas tienen un aspecto esponjoso como sus púas no se unen entre sí para formar una paleta suave. Aún así, pueden ser reconocidos en el día después de la eclosión 10 en las puntas de las plumas en desarrollo, que para entonces cubren el cuerpo (Figura 5). Su ausencia en lugares distintos hace que el reconocimiento fácil, a veces incluso sin la manipulación de los polluelos (Figura 6). La aplicación de estos llamados `cortes de pelo 'es una técnica elegante, que llena con éxito la brecha por el tiempo desde el nacimiento hasta que el tamaño del cuerpo de pichones finc cebrahes hace que la aplicación de las bandas de pierna factible.

La figura 5
Figura 5. Marcado pichones Zebra Finch en días tras la eclosión 10. Las imágenes muestran los pichones ya sea con (tijeras) o sin (flecha) marcas. Una flecha apunta hacia la ubicación de interés de acuerdo con la respectiva nomenclatura de los «recortes» de plumas hacia abajo: A = B = cabeza, espalda, C = alas, D = flancos.

La figura 6
Figura 6. Reconocimiento de los polluelos marcados (edad media = 10 días) en el nido natal de acuerdo con la nomenclatura.A = cabeza, fácil de detectar debido a sus destacadas plumas hacia abajo, que sólo faltan en la cabeza. B = volver, plumón visible en todos los lugares, pero en la parte posterior. C = alas, necesita un observador atento como las dos alas están desaparecidos plumón, pero está enclavado postura hace que las plumas de la cabeza hacia abajo cubren la banda derecha. D = flancos, sólo pueden ser reconocidas por el proceso de eliminación como sus flancos no se pueden ver. Se distingue fiablemente como D, ya que muestra claramente el crecimiento de plumas en la cabeza, la espalda y las alas. E = una combinación de la cabeza de corte de pelo "(A) y trasero (B), es fácil de distinguir como plumón en la cabeza y la espalda están desaparecidos. F = una combinación de un 'corte de pelo' (cabeza) y D (flancos), que sólo puede ser diferenciado a través de la eliminación de otras opciones como su cabezal de marcado es obvia y no hay otro pichón no identificada presenta un cabezal de marcado. T = no lo hicieronrecibir cualquier marca y es mucho más pequeño que sus hermanos, ya que fue el último en salir del cascarón. Adicionalmente G es un buen ejemplo de un pichón que no expresa plumón en todas las localidades.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Sexado de hisopos bucales usando Chelex mostró una muy alta tasa de éxito. Plumón de corte de crías permitieron la diferenciación entre los pichones hasta que las bandas de la pierna era posible.

Extracción Chelex-ADN de hisopo bucal produjo suficiente ADN para llevar a cabo con éxito el sexado molecular. La determinación del sexo fue de 100% correcto como validado por el plumaje presenta dimorfismo sexual. La tasa de éxito reportado aquí es muy superior a la reportada por dos estudios anteriores 7,9. La extracción de ADN con Chelex minimiza pipeteo y precipitación pasos en los que el material se puede perder. Sin embargo, uno de los estudios de validación de nuestro protocolo en una especie diferente (Apus apus) aún logra una menor tasa de éxito de 89% 9 a pesar de que esto ya era claramente superior al 82% reportado en Arima et al. 7.

¿Cuál podría ser la causa? La parte más importante es seguir con atención la protOcol, incluyendo la parte de la forma de llevar las muestras (tejido suave golpe varias veces en la boca) y para impedir la transferencia de cuentas de Chelex en la reacción de PCR. Como Chelex es un intercambiador de cationes que inhibe seriamente la reacción de PCR prevención de amplificación en muestras contaminadas. Las muestras contaminadas pueden ser fácilmente reconocidos por los granos visibles en los bolsillos de los geles de agarosa y la falta de dímeros de cebadores.

Menos posibles razones de la falta de éxito muestras del sexo también puede ser debido a las diferencias entre especies o el uso de una tecnología diferente para detectar la diferencia de banda en las muestras de mujeres.

Cortar las plumas hacia abajo de los pinzones cebra crías es una forma segura de marcar individualmente sujetos. Estos «recortes» eran fáciles de reconocer hasta que los pichones tenían la edad suficiente para recibir en las patas numeradas (por ejemplo, en el día 10 en los pinzones cebra). Esta técnica de marcado se puede ajustar fácilmente para satisfacer diferentes experimdemandas entales; por ejemplo, para las grabaciones de vídeo marcas pueden limitarse a la cabeza de los pollos. Las combinaciones de cortes en dos posiciones se pueden aplicar si los nidos son más grandes que cinco pichones. Mantener una secuencia predefinida en la aplicación de «recortes» (por ejemplo, el primero de crías en un nido siempre recibe 'corte de pelo A', la segunda siempre recibe 'haircut B', etc) permite el reconocimiento rápido dentro de la orden de eclosión durante la fase de pichones. Esto permite la identificación rápida, lo que puede reducir o incluso evitar la manipulación de los pollitos. En los pinzones cebra, la falta de bajadas en uno de los cuatro lugares puede ocurrir debido a las fluctuaciones naturales. Por lo tanto, no siempre puede ser posible para pegarse a una secuencia de marcado predefinido.

Incluso para alguien sin experiencia en el manejo de los pollos es una forma rápida de aprender, técnica de marcado seguro y fácil de cortar las plumas hacia abajo. Sin embargo, como la respuesta abierta innata de los pollos incluye movimientos de la cabeza, algunas personas les resulta más difícil colocar marreyes en la cabeza. Error de identificación propensos basa en marcas precisas. Es de importancia eminente para cortar completamente la totalidad de plumón en un lugar determinado, como marcas imperfectas / sola izquierda-out hasta las plumas pueden más tarde confundir identidad.

Este conjunto de métodos permite extremadamente rápido, fácil, no invasivo, confiable y de bajo costo, la determinación del sexo de las aves y su no invasivo, rápido, seguro y fácil de reconocer que marca en cuestión de minutos después de la eclosión.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgements

Muchas gracias a Silke Kipper, Sarah Kiefer, Michael Weiß, Conny Bartsch y Silke Voigt-Heucke para la recolección de la muestra entusiasta en el campo, a Janett Birkenfeld para la asistencia continuada, a Ulla Kobalz por las hermosas geles y Tobias Krause como apoyo moral.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics