Wie is wie? Niet-invasieve methoden om Individueel Sex en Mark Altricial Chicks

Biology

GE Global Research must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dit protocol biedt een handige set van methoden, die extreem snel, gemakkelijk, niet-invasieve, betrouwbare en goedkope maakt, moleculaire geslachtsbepaling van vogels en hun niet-invasief, snel, veilig en gemakkelijk herkenbare markering kort na het uitkomen. Slechts beperkte behandeling van kuikens is vereist. Deze handige gereedschapskist van methoden voldoet volledig bij de RRR-richtlijnen.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Veel experimenten vereisen vroege bepaling van het geslacht nakomelingen evenals vroege markeren van pasgeborenen voor individuele erkenning. Volgens de richtsnoeren voor dierenwelzijn, moeten niet-invasieve technieken de voorkeur wanneer van toepassing. In onze groep werken we op verschillende soorten zang vogels in het lab en in het veld, en we met succes non-invasieve methoden toepassen om seks en individueel markeren kuikens. Dit document presenteert een uitgebreid non-invasieve gereedschapskist. Geslachtsbepaling vogels voorafgaand aan de expressie van secundair seksuele kenmerken vereist het verzamelen van DNA-dragende materiaal voor PCR. We hebben een snelle en eenvoudige methode om seks vogels van elke leeftijd (na het uitbroeden) door extractie van DNA uit buccale swabs. Resultaten kunnen worden bereikt binnen 3 uur. Voor donsveren individuele markering kuiken zijn bekleed met specifieke patronen zorgt voor een snelle identificatie binnen het uitkomen bestelling. Deze set van methoden is gemakkelijk toepasbaar in een standaard uitgeruste lab en in het bijzonder geschikt voor working het veld geen speciale apparatuur nodig voor bemonstering en opslag. Afhandeling van kuikens wordt geminimaliseerd en markering en geslachtsbepaling technieken zijn niet-invasieve waardoor de RRR-principe van de richtsnoeren voor dierenwelzijn ondersteunen.

Introduction

Individuele erkenning, sexen en genotypering zijn fundamentele vereisten in een verscheidenheid van experimentele studies. Het verkrijgen van DNA lagermateriaal en opschriften onderwerpen ondubbelzinnig (zelfs op jonge leeftijd) moeten minimaal effect op de fysiologie, gedrag en overleving. Waar mogelijk moet invasieve procedures worden vermeden volgens de RRR principe 1.

Niet-invasieve methoden zijn niet alleen nuttig voor het dier, maar ook kan de verkregen gegevens verbeteren dieren minder beïnvloed door de behandelingen.

Bij vogels kan DNA sexen worden uitgevoerd op een aantal niet-invasief verkrijgen materialen uitwerpselen 2, veren 3,4 of buccale uitstrijkjes 3,5,9. Ongeacht de conditie en leeftijd speekselmonsters onderwerp zijn de methode van keuze voor aviaire geslachtsbepaling, want ze zijn eenvoudig uit te voeren, zelden mislukken en de behandeling is kort.

Tot nu toe, DNA van buccale uitstrijkjeswas ofwel geëxtraheerd met commercieel verkrijgbare kits 3,6 of tijdrovend standaard DNA-extractie protocols 3,6-8. Kits zijn niet alleen vrij duur, maar hun protocollen kunnen uitdagingen opleggen voor veldwerk. Sommige proceduredetails, zoals drogen en incubatie van de monsters, zijn niet praktisch in het veld. Vooral in een omgeving waar de experimentele protocollen vereisen sex afhankelijk behandeling al vanaf een paar minuten na uitkomen, er is dringen voor een snelle, niet-invasieve, betrouwbare en eenvoudige methode om resultaten te verkrijgen.

Aan de overkant van de aviaire taxa een aanzienlijke toolbox voor het markeren van individuen is ontwikkeld 10. Het brede scala van beschikbare technieken goed voor de verscheidenheid van de onderzoeksdoelstellingen, soorten en budgetten. Echter, het markeren van kleine nestjongen heeft onderzoekers met extra uitdagingen geconfronteerd. In sommige soorten (bijv. passerines) kuikens te klein om beenbanden passen en vereisen alternatieve werkwijzen dieveranderen niets aan ouder-nakomelingen gedrag. Naarmate het bewustzijn en interesse in het verbeteren van het welzijn en technieken in het veld en laboratoriumstudies dier groeit, wordt het gebruik van niet-invasieve technieken sterk aangemoedigd en voorkeur.

Dit protocol voorziet in een niet-invasieve, snel, gemakkelijk herkenbaar en hardnekkig methode om individueel markeren zeer jonge nestjongen alvorens beenbanden haalbaar is. Deze markering methode wordt ingevoerd op een van de belangrijkste aviaire laboratorium model soorten, de zebravink (Taeniopygia guttata) 11-13. Het protocol voldoet aan alle van de eerder gepubliceerde doelstellingen voor individuele markeringstechnieken 10 en is reeds met succes toegepast 14,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle procedures werden uitgevoerd in overeenstemming met de Duitse wet voor de bescherming van dieren (TierSchG).

1. Voorbereiding van de reagentia en verbruiksartikelen

  1. Bereid een 5% (w / w) Chelex-100 oplossing moleculaire kwaliteit water. Aliquots van 200 pi in standaard 1,5 ml reageerbuisjes. Aangezien de Chelex hars precipiteert snel uit de suspensie is het noodzakelijk om opnieuw homogeniseren de suspensie continu tijdens de bereiding van de monsters. Het is aan te raden om 50 ml of meer bereiden in een batch en houden de schorsing gehomogeniseerd met behulp van een magneetroerder. De Chelex oplossing kan worden bewaard jaar bij omgevingsomstandigheden.
  2. Knip stukjes Whatman papier met een breedte kleiner dan de breedte van de snavel vogel te testen. De lengte van het papier afhankelijk van de methode tot monsterneming:
    1. Behulp van een tang, moet het stuk lang genoeg om monstername mogelijk te maken zonder de tang in de bek van de vogel wordt ingebracht zijn. Alsruwe schatting, voor een snavel lengte van 0,5 cm een ​​stuk papier met de lengte van 1 cm zou fijn moeten zijn.
    2. Indien niet gebruikt tang moet het stuk langer, maar de stijfheid van het stuk moet nog bemonstering van epitheelcellen mogelijk.
  3. Bereid een portie van PCR premix voor elk monster worden geanalyseerd. Voor een PCR in een totaal volume van 25 pi mix bevat 0,18 mM dNTPs, 2 mM MgCl2, 70 mM Tris-HCl, 17,25 mM ammoniumsulfaat, 0,1% Tween-20, 0,32 uM primer P2 (TCTGCATCGCTAAATCCTTT), 0,32 uM P8 primer (CTCCCAAGGATGAGRAAYTG) 16 en 2 eenheden Taq polymerase. Zelfgemaakte Taq polymerase 17 worden gebruikt. Voor toevoeging van de maximale hoeveelheid DNA-oplossing toe, kan een 6 ul voormengsel worden bereid en bewaard bij -20 ° C gedurende enkele weken.

2. Sample Collection

Het dragen van handschoenen is niet essentieel voor aviaire geslachtsbepaling als PCR primers niet kunnen hechten aan menselijk DNA. Voorandere genotypering doeleinden is het misschien raadzaam.

  1. Leg de vogel van belang en zachtjes houd hem in de ene hand bijvoorbeeld met de 'Ringer-grip' 18. Zorg ervoor dat de vogel niet te knijpen.
  2. Houd een stuk Whatman papier met een pincet en veeg het meerdere malen over de binnenzijde van de wangen, de tong en de choana. Meestal monsters worden verkregen binnen minder dan 30 seconden.
    1. Volwassen dieren: afhankelijk van de soort is het misschien moeilijk om de vogel om zijn bek open te krijgen. Meestal raken de kant van de bek en licht aandrukt werkt.
    2. Nestlings: Bemonstering van jongen of nestjongen is vooral gemakkelijk met behulp van deze techniek, omdat hun bedelen gedrag biedt gemakkelijke toegang tot de binnenkant van de bek. Het zou zelfs mogelijk zijn om het monster te verkrijgen zonder afhandeling daarvan helemaal niet, omdat ze gemakkelijk bedelen bijvoorbeeld wanneer hun nestkast wordt geopend.
  3. Onmiddellijk slaan het papier in een voorbereide reageerbuis containersning 200 ul van de 5% (w / w) Chelex-100 oplossing.

Als u van plan ook / nodig om de kuikens te markeren, doe dat dan nu, zoals beschreven in hoofdstuk 6.

3. Opslag van Steekproeven voor DNA-extractie

  1. Het werken in het laboratorium, opslag monsters bij -20 ° C. Als dit niet mogelijk is of moeilijk (bv op het gebied) op te slaan monsters bij omgevingstemperaturen.
  2. Monsters kunnen worden opgeslagen gedurende meer dan 3 jaar bij temperaturen uiteenlopend van kamertemperatuur tot -20 ° C.

4. DNA Extraction

  1. Als het monster bevroren, ontdooien bij kamertemperatuur.
  2. Zorg ervoor dat het papier op de bodem van de buis ondergedompeld in de Chelex-100 oplossing.
  3. Incubeer monsters gedurende 15 minuten bij 56 ° C.
  4. Vortex kort en spin down van de inhoud van de buis.
  5. Incubeer de monsters gedurende 8 minuten bij 100 ° C.
  6. Spin de monsters bij 15.000 xg gedurende 3 minuten.
  7. Gebruik de supernatant voor verdere genotypering.

5. Moleculaire Sex Bepaling

  1. Bereid een PCR-buis met 6 pi premix per monster plus twee extra buizen voor de negatieve (verplicht) en positieve controles (optioneel). Voor routine geslachtsbepaling onder een steekproef van de laatste succesvolle sexen als een positieve controle.
  2. Voeg 19 ul van de supernatant van de DNA-extractie om de PCR voormengsel. Zorg ervoor dat u pipet van het oppervlak van de oplossing voor overdracht van Chelex kralen te voorkomen. Dit is cruciaal, aangezien Chelex een kationenwisselaar en aldus ernstig remt alle enzymatische reacties.
  3. Voer het volgende PCR-programma: Incubatie bij 94 ° C gedurende 3 min, 45 cycli elk met een 30 sec smeltstap 94 ° C, gevolgd door 30 seconden annealing stap bij 55 ° C, gevolgd door een 45 seconden verlenging bij 72 ° C. In een laatste verjagen stap worden de reacties geïncubeerd gedurende 5 minuten bij 72 ° C.
  4. Bereid een 2%-norm TBE of TAE agaro se gel om de PCR producten gescheiden.
  5. Voer de agarosegel met de juiste voltage-instellingen.
  6. Visualiseer de banden onder UV-licht en maak een foto. Zorg ervoor dat de twee banden in de monsters afkomstig zijn van koeien zijn goed van elkaar gescheiden.
  7. Onderscheid man uit vrouwelijke monsters door de aanwezigheid van een (mannelijk) of twee (vrouwelijke) bands.

6. Markering Nestlings

  1. Controleer nesten voor pas uitgekomen kuikens op een schema voor de soort geschikte / studie (bv dagelijkse controles in de ochtend wordt geadviseerd als de meeste kuikens uitkomen dan).
  2. Snijd de donsveren van elk kuiken in een nest op een andere karakteristieke locatie. In zebravinken plukjes downs groeien in vier karakteristieke en verschillende gebieden over de hele genesteld lichaam (Figuur 4A). Voor elk kuiken snijden een gebied (Figuur 4B). Als er meer dan vier kuikens binnen een nest, de unieke vier 'haircuts' kunnen worden gecombineerd.
ove_content "> Voor zebravinken: Breng beenbanden om tien dagen na het uitkomen wanneer donsveren geworden moeilijk te detecteren en genesteld formaat maakt rinkelen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Speekselmonsters kan worden gebruikt om DNA voor geslachtsbepaling verkrijgen diverse kleine vogels

De monsters werden verzameld uit Zebravinken (Taeniopygia guttata, 99 personen, leeftijd 0 dagen - 5 jaar), Canarische Eilanden (Serinus canaria), Bengaalse Vinken (Lonchura striata), Nightingales (Luscinia megarhynchos), Koolmezen (Parus major) en Merels (Turdus merula) (voor alle andere soorten: steekproefgrootte 1-3, leeftijd onbekend) (Figuur 1).

Voor monsters genomen van zebravinken, het slagingspercentage voor de PCR's was 100%. Het PCR-resultaat altijd overeen met de geslachten bepaald door eerdere (bij volwassenen) of later (in nestjongen) fenotypische inspectie. De intensiteit van de banden niet systematisch verschillen tussen nestjongen of volwassenen aangeeft dat vergelijkbare hoeveelheden DNA-dragende materiaal worden opgedaan met alle leeftijden.

Figuur 1 "fo: content-width =" 6in "fo: src =" / files/ftp_upload/51429/51429fig1highres.jpg "src =" / files/ftp_upload/51429/51429fig1.jpg "/>
Figuur 1. Moleculaire geslachtsbepaling. Voorbeelden van geslachtsbepaling resultaten van buccale uitstrijkjes verkregen uit verscheidene vogelsoorten. 2% agarose gel gekleurd met ethidiumbromide. Van links naar rechts: size marker, zebravink mannetje, Bengaalse Finch vrouw, Blackbird mannelijke, Koolmees mannetje, Nightingale mannelijke, Canarische mannelijke, waterbeheersing, grootte marker.

Het is belangrijk Chelex overdracht besmetting te voorkomen in de PCRs

Om het effect van Chelex hars besmetting in een PCR-reactie te demonstreren, inclusief we een kleine hoeveelheid Chelex kralen in een PCR-reactie (Figuur 2). Zoals te zien is in figuur 2A, overdracht besmetting Chelex kralen verhindert de amplificatie van DNA dat verder geïllustreerd door het ontbreken van primer dimeer vorming in het verontreinigde monster (<strong> Figuur 2B). In figuur 2A laan 2 hetzelfde monster voor de PCR gebruikte we zonder overdracht Chelex. Meestal besmette monsters zijn gemakkelijk herkenbaar door donkere vlekken in de zakken van de agarosegel (Figuur 2B).

Figuur 2
Figuur 2. Chelex verontreiniging. A) Chelex overdracht in de PCR reactie remt de amplificatie van DNA. Van links naar rechts:. Formaatmarkering, Zebravinken man, Zebra Finch vrouw, hetzelfde monster met opzettelijke overdracht van Chelex, waterbeheersing, grootte marker B) Chelex kralen zijn goed zichtbaar als donkere vlekken in de zak van de gel (links zonder Chelex , rechts Chelex. de ernstige remming van de PCR-reactie in aanwezigheid van Chelex blijkt ook de ontbrekende primer ddimeer-vorming in de besmette monster.

Monsters kunnen worden opgeslagen bij kamertemperatuur voor DNA-extractie gedurende meer dan drie jaar

Om te onderzoeken of succesvolle extractie nog kan worden uitgevoerd na langdurige opslag werden monsters telkens van dezelfde vogel genomen en opgeslagen in het laboratorium bij omgevingstemperatuur gedurende maximaal drie jaar. De monsters werden bij een raam opgeslagen natuurlijke blootstelling aan licht en warmte van de zon. Na drie jaar DNA werd geëxtraheerd en de geslachtsbepaling PCR uitgevoerd. Het resultaat was gelijk aan de ene uitgevoerd drie jaar eerder (direct na bemonstering) en geen effect van opslag (figuur 3) aan te geven.

Figuur 3
Figuur 3. Chelex staat lange-termijn opslag van de monsters before en na DNA-extractie. Monsters van twee dieren (mannelijke links, vrouw rechts) werden bewaard onder verschillende omstandigheden zoals aangegeven in de tabel. Signalen werden met succes verkregen van alle monsters.

Figuur 4
Figuur 4. Markering van kuikens. A) Schematische weergave en nomenclatuur van de vier verschillende gebieden van de groei veer in zebravink nestjongen:. A = hoofd, B = rug, C = vleugels (beide), D = flanken (beide) B) Voorbeeld foto's van nestjongen die ofwel ontving een van de respectieve 'haircuts' (AD) of geen 'haircut' (E).

Geëxtraheerde DNA kan worden opgeslagen gedurende meer dan drie jaar bij 4 ° C

Zebravink monsters uit het eerste experiment werden gedurende drie jaar in een standaard laboratorium vrijDGE bij 4 ° C en met succes getest. Alle monsters leverden dezelfde PCR resultaten direct na DNA-extractie (Figuur 3).

Hatchlings kunnen worden gemarkeerd door trimmen hun donsveren individuele erkenning mogelijk te maken van het uitkomen op

Markering individuele nestjongen direct na het uitkomen van het snijden van hun donsveren maakte ze gemakkelijk te herkennen (figuren 4, 5, 6). Donsveren hebben een pluizige uiterlijk als hun weerhaken worden niet samengevoegd tot een gladde lamel vormen. Ze kunnen nog steeds worden opgenomen tegen posthatch dag 10 op de uiteinden van de ontwikkeling van veren, die door dek het lichaam (figuur 5). Hun afwezigheid op verschillende locaties maakt herkenning gemakkelijk, soms zelfs zonder het hanteren van de pinda (Figuur 6). Het toepassen van deze zogenaamde 'haircuts' is een elegante techniek, die met succes vult het gat voor de tijd van uitkomen tot de lichaamsgrootte van genesteld zebra Finches maakt de toepassing van beenbanden haalbaar.

Figuur 5
Figuur 5. Marked Zebravinken nestjongen op na uitkomst dag 10. Foto's tonen nestjongen ofwel met (schaar) of zonder (pijl) markeringen. Een pijl wijst naar de locatie van belang zijn, overeenkomstig de desbetreffende nomenclatuur van 'haircuts' donzen: A = hoofd, B = rug, C = vleugels, D = flanken.

Figuur 6
Figuur 6. Erkenning van gemerkt nestjongen (gemiddelde leeftijd = 10 dagen) binnen de geboortehoroscoop nest volgens de nomenclatuur.A = hoofd, gemakkelijk te herkennen vanwege zijn prominente donsveren, die alleen ontbreekt op het hoofd. B = back, dons zichtbaar op alle locaties, maar op de rug. C = vleugels, moet een attente waarnemer als beide vleugels ontbreken donsveren, maar genesteld's houding maakt de donsveren van het hoofd bedekken de rechtervleugel. D = flanken, kunnen alleen door het proces van eliminatie erkend als de flanken niet kan worden gezien. Het betrouwbaar kunnen worden erkend als D als het toont duidelijk de groei veer aan het hoofd, de rug en de vleugels. E = een combinatie van hoofd 'haircuts' (A) en achterzijde (B), is het gemakkelijk om op zo neer te onderscheiden veren het hoofd en rug ontbreken. F = een combinatie van 'haircuts' A (hoofd) en D (flanken), die alleen kan worden gedifferentieerd door het elimineren van andere opties zijn kop markering is duidelijk en geen andere niet-geïdentificeerde genesteld vertoont een hoofd markering. G = nietontvangen geen markeringen en is een stuk kleiner dan zijn broers en zussen als het was de laatste uit te broeden. Daarnaast G is een goed voorbeeld voor een genesteld dat niet uitdrukken donsveren op alle locaties.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Geslachtsbepaling van buccale swabs gebruik Chelex toonde een zeer hoog slagingspercentage. Donsveren snijden hatchling ingeschakeld onderscheid tussen nestjongen tot been banding mogelijk was.

Chelex-DNA-extractie van speekselmonsters leverde genoeg DNA om moleculaire geslachtsbepaling succes uit te voeren. Geslachtsbepaling was 100% correct zijn gevalideerd door seksueel dimorf verenkleed. Het slagingspercentage hier gemeld is aanzienlijk hoger dan het percentage gemeld door twee eerdere studies 7,9. De DNA extractie met Chelex minimaliseert pipetteren en precipitatie stappen waarin materiaal verloren. Echter, een van de studies die ons protocol in een andere soort (Apus apus) nog behaalde een lagere slagingspercentages van 89% 9 ook al was dit al duidelijk hoger dan de 82% gerapporteerd in Arima et al.. 7.

Wat kan de oorzaak zijn? Het meest cruciale onderdeel is aandachtig volgen de protOCOL, inclusief het gedeelte voor hoe je monsters (voorzichtig uithaal weefsel meerdere malen in de mond) en om overdracht van Chelex kralen te voorkomen in de PCR-reactie. Als Chelex een kationenwisselaar het streng remt de PCR-reactie voorkomen amplificatie in gecontamineerde monsters. Besmette monsters kunnen gemakkelijk herkend worden door kralen zichtbaar in de zakken van agarosegelen en het ontbreken van primer dimeren.

Minder voorkomende reden niet succesvol geslacht monsters kunnen ook het gevolg zijn soorten verschillen of het gebruik van een andere technologie om de band verschil detecteert in de vrouwelijke monsters.

Het snijden van de donsveren van hatchling zebravinken is een veilige manier om onderwerpen individueel markeren. Deze 'haircuts' waren gemakkelijk te herkennen totdat nestjongen oud genoeg waren om genummerde beenbanden (bijvoorbeeld op dag 10 in zebravinken) ontvangen. Deze markering techniek kan gemakkelijk worden aangepast aan verschillende experim voldoenentele eisen, bijvoorbeeld voor video-opnamen markeringen kan worden beperkt tot het hoofd van de kuikens. Combinaties van bezuinigingen op twee posities kan worden toegepast als nesten zijn groter dan vijf nestjongen. Het bijhouden van een vooraf bepaalde volgorde in het toepassen van 'haircuts' (bv. de eerste hatchling in een nest ontvangt altijd 'haircut A', de tweede ontvangt altijd 'haircut B' enz.) maakt een snelle erkenning binnen het uitbroeden orde in het gehele genesteld fase. Dit maakt een snelle identificatie, die kan verminderen of zelfs voorkomen afhandeling van kuikens. In zebravinken, kan een gebrek aan downs in een van de vier locaties optreden als gevolg van natuurlijke fluctuaties. Zo is het niet altijd mogelijk zijn vast te houden aan een vooraf gedefinieerde markering reeks.

Zelfs voor iemand die onervaren in het omgaan met pinda is een snel te leren, veilig en gemakkelijk markeren techniek om de veren te snijden. Echter, zoals de aangeboren gapende reactie van nestjongen omvat hoofdbewegingen, sommige mensen vinden het moeilijker om mar plaatsenkoningen op het hoofd. Foutgevoelig identificatie is gebaseerd op nauwkeurige markeringen. Het is van eminent belang om grondig te snijden de gehele donsveren op een bepaalde plek, als onvolmaakt markeringen / single links-out donsveren later identiteit kunnen verwarren.

Deze set van methoden maakt een uiterst snelle, eenvoudige, niet-invasieve, betrouwbare en goedkope, geslachtsbepaling van vogels en hun niet-invasief, snel, veilig en gemakkelijk herkenbare markering binnen enkele minuten na het uitkomen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgements

Veel dank aan Silke Kipper, Sarah Kiefer, Michael Weiß, Conny Bartsch en Silke Voigt-Heucke naar enthousiaste monstername in het veld, om Janett Birkenfeld voor verdere hulp, om Ulla Kobalz voor de mooie gels en Tobias Krause voor morele steun.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics