Human Saphenous Vein Endothelial Cell Isolation and Exposure to Controlled Levels of Shear Stress and Stretch

Summary

We describe a protocol to isolate and culture human saphenous vein endothelial cells (hSVECs). We also provide detailed methods to produce shear stress and stretch to study mechanical stress in hSVECs.

Abstract

Coronary artery bypass graft (CABG) surgery is a procedure to revascularize ischemic myocardium. Saphenous vein remains used as a CABG conduit despite the reduced long-term patency compared to arterial conduits. The abrupt increase of hemodynamic stress associated with the graft arterialization results in vascular damage, especially the endothelium, that may influence the low patency of the saphenous vein graft (SVG). Here, we describe the isolation, characterization, and expansion of human saphenous vein endothelial cells (hSVECs). Cells isolated by collagenase digestion display the typical cobblestone morphology and express endothelial cell markers CD31 and VE-cadherin. To assess the mechanical stress influence, protocols were used in this study to investigate the two main physical stimuli, shear stress and stretch, on arterialized SVGs. hSVECs are cultured in a parallel plate flow chamber to produce shear stress, showing alignment in the direction of the flow and increased expression of KLF2, KLF4, and NOS3. hSVECs can also be cultured in a silicon membrane that allows controlled cellular stretch mimicking venous (low) and arterial (high) stretch. Endothelial cells' F-actin pattern and nitric oxide (NO) secretion are modulated accordingly by the arterial stretch. In summary, we present a detailed method to isolate hSVECs to study the influence of hemodynamic mechanical stress on an endothelial phenotype.

Introduction

Endothelial cell (EC) dysfunction is a key player in saphenous vein graft failure^1,2,3,4. The sustained increase of shear stress and cyclic stretch induces the proinflammatory phenotype of human saphenous vein endothelial cells (hSVECs)^3,4,5,6. The underlying molecular pathways are still not fully understood, and standardized protocols for in vitro studies may leverage the efforts for novel insights in the area. Here, we describe a simple protocol to isolate, characterize, and expand hSVECs and how to expose them to variable levels of shear stress and cyclic stretch, mimicking the venous and arterial hemodynamic conditions.

hSVECs are isolated by collagenase incubation and can be used up to passage 8. This protocol requires less manipulation of the vessel compared with the other available protocols⁷, which reduces contamination with smooth muscle cells and fibroblasts. On the other hand, it requires a larger vessel segment of at least 2 cm to have efficient EC extraction. In the literature, it has been reported that ECs from large vessels can also be obtained by mechanical removal^7,8. Although effective, the physical approach has the disadvantages of low EC yield and higher fibroblast contamination. To increase the purity, extra steps are needed using magnetic beads or cell sorting, increasing the cost of the protocol due to the acquisition of beads and antibodies^7,8. The enzymatic method has faster and better outcomes regarding EC purity and viability^7,8.

The most frequently used ECs to study endothelial dysfunction are human umbilical vein endothelial cells (HUVECs). It is known that the EC phenotype changes in different vascular beds, and it is essential to develop methods that represent the vessel under investigation^9,10. In this respect, the establishment of a protocol to isolate a hSVEC and culture it under mechanical stress is a valuable tool to understand the contribution of hSVEC dysfunction in vein graft disease.

Protocol

Unused segments of saphenous veins were obtained from patients undergoing aortocoronary bypass surgery at the Heart Institute (InCor), University of São Paulo Medical School. All individuals gave informed consent to participate in the study, which was reviewed and approved by the local ethics committee.

1. Isolation, culture, and characterization of primary human saphenous vein endothelial cells (hSVECs)

1. Preparation
   1. Autoclave a pair of straight or curved forceps and tissue scissors (7-8 cm).
   2. Prepare sterile gelatin. Mix 0.1 g (0.1% w/v) or 3 g (3% w/v) of porcine skin gelatin with 100 mL of ultrapure water, autoclave for 15 min, and store at 4 °C. Warm to 37 °C to liquefy before coating the cell culture dishes and slides.
   3. Prepare sterile collagenase (1 mg/mL) inside the laminar flow hood. Dilute the collagenase in PBS and sterilize it with a 0.2 µm filter.
   4. Coat a 60 mm cell culture dish and an 8-well chamber slide with 0.1% w/v gelatin for at least 30 min at 37 °C. Remove the excess gelatin prior to seeding the cells.
   5. Prepare complete endothelial cell medium: endothelial cell growth basal medium (EBM-2) supplemented with EGM2 growth factors.
      NOTE: The EGM2 growth factors is supplied as a kit by a company listed in the Table of Materials. The concentration of the factors is not disclosed by the company.
   6. Make 2% and 5% bovine serum albumin (BSA), 4% paraformaldehyde (PFA), and 0.1% Triton X-100 solutions, all in phosphate-buffered saline (PBS).
2. Isolation and culture of hSVECs
   1. Collect at least a 2-3 cm long saphenous vein segment for this procedure.
      NOTE. All the cell culture procedures must be carried out under sterile conditions and inside a laminar flow hood.
   2. Transfer the vein segment to a Petri dish filled with pre-warmed PBS. Insert a pipette tip into one end of the vein and gently flush with PBS to remove all the blood inside the lumen. Flush it until the washing flow becomes completely clear.
   3. Close one of the ends of the vein with a sterile cotton suture. Carefully fill the vessel with 1 mg/mL collagenase type II solution. Close the other end of the vessel with a cotton suture (Figure 1A). Incubate the vessel with collagenase solution in a humidified atmosphere of 5% CO₂ at 37 °C for 1 h.
   4. After that, cut one of the ends of the vessel inside a 15 mL tube and collect the collagenase solution. Cut the other end and flush the luminal surface with 1-2 mL of PBS to collect all the detached ECs. Put all the PBS together with collagenase solution inside the same tube.
   5. Centrifuge the tube at 400 x g for 5 min at room temperature (RT) to pellet the cells.
      ​NOTE. The cell pellet is very small and difficult to visualize. If the blood is not completely removed before collagenase treatment (step 1.2.2.), the blood cells will also precipitate, and the pellet will be reddish.
   6. Remove the supernatant and resuspend the cell pellet in 3-4 mL of complete endothelial cell medium (EBM-2 supplemented with EGM2 growth factors) and an additional heparin solution (5 U/mL, final concentration). Plate the cells in a 60 mm cell culture dish pre-coated with 3% w/v gelatin.
      NOTE: Gelatin was the first choice due to its ease of accessibility and low cost. As the coating with gelatin successfully maintains the EC phenotype, no other coating substance was tested. Collagens and fibronectin can be tested in studies aiming to investigate the influence of different extracellular matrix components on EC adhesion and the phenotype.
   7. Incubate the cells at 37 °C in a humidified atmosphere with 5% CO₂ for 4 days without changing the medium. After that, change the media every other day. From this moment on, the additional cell media supplementation with heparin is no longer necessary. Examine the plate under the microscope to ensure that the red blood cells were removed.
   8. After 3-10 days post-extraction, depending on the size and diameter of the vein segment, visualize the hSVECs by phase-contrast microscopy.
   9. Evaluate the degree of confluence and their cobblestone morphology in phase-contrast microscopy.
   10. Continue changing the media every 2 days until the cells reach 70%-80% confluency.
   11. Passage the hSVECs with 0.25% trypsin-0.02% ethylenediaminetetraacetic acid (EDTA) solution.
       1. Wash the cells with pre-warmed PBS.
       2. Add 1 mL of trypsin-EDTA solution to the 60 mm cell culture dish. Incubate at 37 °C for 2 min or until all the cells are detached.
       3. Add 2 mL of complete endothelial cell medium to inactivate the trypsin.
       4. Transfer the cell suspension to a 15 mL tube and centrifuge at 300 x g for 3 min at RT.
       5. Discard the supernatant and resuspend the cells in 1 mL of culture medium.
       6. Count the cell suspension in 1:1 trypan blue (0.4%) to plate viable cells.
       7. To expand the culture, plate the cells in a 100 mm cell culture dish with 10 mL of pre-warmed complete endothelial cell medium and culture it at 37 °C in a humidified atmosphere with 5% CO₂.
          NOTE. On average, the seeding of 4 x 10⁴ hSVEC/cm² will be 100% confluent after 48 h.
   12. To cryopreserve the cells, resuspend the pellet from step 1.2.11.5 in 5% dimethyl sulfoxide (DMSO) in fetal bovine serum (FBS) and store in liquid nitrogen.
3. Characterization of hSVECs: Flow cytometry staining for CD31
   1. Transfer 1 x 10⁵ hSVECs to one 1.5 mL tube and centrifuge at 300 x g for 3 min at RT. Discard the supernatant and resuspend the pellet in 100 µL of PBS containing 2% BSA and CD31-FITC monoclonal antibody (1:100).
   2. Stain the cells for 30 min at RT in the dark.
   3. Wash the stained cells by adding 0.5 mL of PBS and centrifuge them at 300 x g for 3 min at RT. Discard the supernatant and resuspend the cell pellet in 400 µL of PBS with 2% BSA.
   4. Use unlabeled hSVECs, without CD31 antibody, as the negative control.
   5. Proceed to flow cytometer acquisition analysis using a blue laser and FITC channel (excitation/emission max [Ex/Em] of 498/517 nm). If other fluorochromes are used, check whether the cytometer has appropriate filter sets for their detection. Separate the cells from debris in the function of their size and granularity, then gate single cells by forward scatter and side scatter.
4. Characterization of hSVECs: Fluorescent staining for CD31 and VE-cadherin
   1. Plate 0.1 x 10⁵ cells in the gelatin-coated 8-well chamber slide. Incubate the cells overnight at 37 °C, 5 % CO₂, to allow the cells to attach to the culture surface.
   2. Remove the medium and wash the cells once with PBS.
   3. Add 0.3 mL/well of 4% PFA to fix the cells. Incubate for 15 min at RT.
   4. Wash three times with PBS.
   5. Add 0.3 mL/well of 0.1% Triton X-100 solution to permeabilize the cells. Incubate for 15 min at RT.
   6. Wash three times with PBS.
   7. To block non-specific antibody binding sites, add 0.3 mL/well of 5% BSA solution to the cells. Incubate for 15 min at RT.
   8. Wash three times with PBS.
   9. Incubate the cells with the primary antibodies (CD31 and VE-cadherin, 1:100) diluted in PBS with 2% BSA overnight with gentle rocking at 4 °C. Leave one well incubating with PBS with 2% BSA (no primary antibody) as the negative control.
   10. Wash three times with PBS.
   11. Incubate the cells with fluorescently labeled secondary antibodies diluted (1:500) in PBS for 1 h at RT. Add 4',6-diamidino-2-phenylindole (DAPI) for nuclear staining to a final concentration of 1 mg/mL.
   12. Wash three times with PBS.
   13. Remove the media chamber with the separator. Place one drop of the mounting medium reagent (50% glycerol in PBS) and place a glass slide (24 mm x 60 mm) while avoiding trapping bubbles.
   14. Observe the cells under a fluorescence microscope.
       ​NOTE: DAPI is detected with a DAPI light cube (Ex: 335-379 nm; Em: 417-477 nm), and CD31/VE-cadherin is detected using a green fluorescent protein (GFP) light cube (Ex: 459-481 nm; Em: 500-550 nm). Light cubes with a similar excitation/emission wavelength range are also adequate for these fluorochromes. If other fluorochromes are used, check whether the microscope used has appropriate filter sets for their detection.

2. Shear stress on hSVECs

1. Preparation
   1. Coat the flow chamber slide with 0.1% w/v gelatin for at least 30 min at 37 °C. Remove excess gelatin prior to seeding the cells.
   2. Equilibrate the fluidic unit and sterile perfusion set with 10 mL reservoirs overnight inside the incubator in a humidified atmosphere of 5% CO₂ at 37 °C.
2. Shear stress experiment
   1. Seed 2 x 10⁵ ECs suspended in 100 µL of EC medium into the gelatin-coated flow chamber slide. Incubate the cells for 4 h at 37 °C and 5% CO₂ to allow the cells to attach to the culture surface.
   2. Place the perfusion set on the fluidic unit as described in the manufacturer's instructions. Fill the reservoirs and the perfusion set in about 12 mL of pre-warmed complete endothelial cell medium. Remove manually air bubbles from the perfusion set to equilibrate the level of both reservoirs at 5 mL.
   3. Place the fluidic unit with the mounted perfusion set, without the chamber slide, in the incubator and connect its electric cable to the computer-regulated pump. Remove all air bubbles from the reservoirs and perfusion set, running a predefined protocol in the pump control software.
      NOTE. It is very important to remove air bubbles for the system to function correctly.
   4. Take the fluidic unit with the mounted perfusion set to the laminar flow hood and attach the slides with a confluent cell monolayer.
   5. Place the fluidic unit with the mounted perfusion and slides with cells in the incubator and connect its electric cable to the pump.
   6. In the pump control software, set up the following parameters: viscosity of the medium (0.0072), type of slide, perfusion set calibration factor, shear stress rate (20 dyn/cm²), type of flow (unidirectional), and time (72 h), and start the flow (see the equipment instructions for further details). Harvest the cells treated with the same media without exposure to flow as static controls.
   7. After the stimulus is completed, wash the cells once with PBS and proceed to harvest the samples according to the required assay. For fluorescent staining, see step 2.3.1, and for RNA extraction, see step 2.3.2.
3. Demonstration of the effectiveness of the shear stress protocol
   1. Fluorescent staining of actin filaments (F-actin)
      1. Fix and permeabilize the cells as indicated in steps 1.4.2-1.4.6. Use a volume of 100 µL in the µ-slide.
      2. Stain the F-actin with fluorescent-labeled phalloidin (diluted at 1:200 in PBS) and counterstain the nucleus with DAPI (final concentration of 1 mg/mL in PBS) for 2 h at RT, protected from light.
      3. Wash three times with PBS.
      4. Observe the cells under a fluorescence microscope.
         NOTE: DAPI is detected with a DAPI light cube (Ex: 335-379 nm; Em: 417-477 nm) and phalloidin is detected with a GFP light cube (Ex: 459-481 nm; Em: 500-550 nm). Light cubes with a similar range of excitation/emission wavelength are also adequate for these fluorochromes. If other fluorochromes are used, check whether the microscope used has appropriate filter sets for their detection.
   2. Gene expression by real-time quantitative reverse transcription (RT-qPCR)
      1. Collect the cells from the µ-slide with 350 µL of a commercial guanidine-thiocyanate-containing lysis buffer. Isolate the total RNA with column-based extraction kits, according to the manufacturer's instructions.
         NOTE: Due to the limited number of cells cultured in the µ-slide, the use of column-based extraction of RNA is recommended.
      2. Prepare cDNA using a cDNA synthesis kit with transcriptase reverse enzyme, according to the manufacturer's instructions.
      3. Verify the expression of the gene(s) regulated by shear stress: KLF2, KLF4, and NOS3. Use the housekeeper gene PPIA/cyclophilin to normalize the results. The specific primers for the reaction are listed in Table 1.
      4. Perform RT-qPCR using an SYBR green fluorescent DNA stain kit under the following reaction conditions: i) 50 °C for 2 min, ii) 95 °C for 15 min, iii) 94 °C for 15 s, iv) 60 °C for 30 s, v) 72 °C for 30 s. Repeat steps iii through v for 40 cycles. Add a melting step at the end of the reaction to verify the primer's specificity.

3. Cyclic stretch on hSVECs

1. Preparation
   1. Apply silicone-based lubricant to the tops and sides of the 6-well equibiaxial loading station of 25 mm.
      NOTE: This reduces friction between the culture plate membrane and the station, allowing better distribution of the cyclic strain. This step must be done before each experiment.
2. Cyclic stretch experiment
   1. Seed 4 x 10⁵ cells suspended in 3 mL to each well of the 6-well flexible-bottomed culture plates coated with collagen I (Table of Materials). Plan to have a plate(s) in static condition as a control group. Keep the cells in the incubator (37 °C in humidified air with 5% CO₂) until they reach 100% confluency (usually 48 h after seeding). Prior to the start of the stretch protocol, wash the cells once with pre-warmed PBS and add 3 mL of fresh culture medium per well.
   2. Insert the baseplate with all lubricated loading stations in the incubator and appropriately connect the tubing with the controller equipment of the tension cell stretching bioreactor system (see the equipment instructions for further details).
   3. Attach each culture plate to one red gasket, provided by the tension cell stretching bioreactor system. Then, put them into the baseplate inside the incubator.
      1. Make sure the plates are fully seated, pressed, and sealed to the baseplate to avoid air leaking during the vacuum pumping. It is important to have all four culture plates in the baseplate to have the proper vacuum and the stretching loading.
      2. In case of having fewer experimental plates, use an empty one(s) to complete the four positions in the baseplate. Add the acrylic sheet (supplied with the equipment) on top of the culture plates to improve the baseplate sealing. Place the static plates in the same incubator.
   4. Turn on the controller equipment and the computer system. Open the software icon and configure the desired regimen: size of the loading station to be used, type of strain, percentage of elongation, waveform shape, frequency, and time. For detailed information, see the manufacturer's instructions. Select and download the regimen. Here, the following regimen was used: 1/2 sinus waveform shape, 1 Hz frequency, 5% of elongation (to mimic venous stretch), and 15% of elongation (to mimic arterial stretch) up to 72 h.
   5. Turn on the vacuum system and click on Start on the computer screen to run the stretching. Check if the silicone membrane is moving and stretching the cells.
   6. After the stimulus is completed, wash the cells once with PBS and proceed to harvest the samples according to the required assay. Here, to demonstrate the effectiveness of cyclic stretch, collect the hSVEC culture medium, keep it at -80 °C for further nitric oxide (NO) measurement, and fix the cells for fluorescent staining.
      NOTE. The baseplate cannot be stored inside the incubator when not in use; otherwise, the temperature can modify the flat shape and make it useless.
3. Demonstration of the effectiveness of the cyclic stretch protocol
   1. Fluorescent staining of F-actin
      1. Fix the cells as indicated in step 1.4.3. Use a volume of 1 mL per well.
      2. Wash the cells three times with PBS. Maintain the cells in PBS so they do not dry while preparing the silicone membrane for the next steps.
      3. Use a cotton swab to remove the excess silicone-based lubricant from the bottom of the membrane. Then, gently apply window cleaner or hand soap with a new cotton swab. Repeat the process until all the lubricant is removed from the membrane. Then, clean with deionized water.
         NOTE. It is important to completely remove the lubricant from the silicone membrane to have microscopy images of good quality.
      4. Carefully cut the silicone membranes into small pieces to fit on 8-well chamber slides for staining. Permeabilize the cells as indicated in step 1.4.5.
      5. After the washing steps, stain the F-actin using phalloidin and the nucleus with DAPI. Proceed to the analysis, as indicated in steps 2.3.1.2 and 2.3.1.3. Use a volume of 0.3 mL per chamber well.
      6. Remove the media chamber with the separator. Place one drop of mounting medium reagent (50% glycerol in PBS) and place a glass slide (24 mm x 60 mm).
      7. Observe the cells under a fluorescence microscope.
         NOTE: DAPI is detected with a DAPI light cube (Ex: 335-379 nm; Em: 417-477 nm) and phalloidin is detected with a red fluorescent protein (RFP) light cube (Ex: 511-551 nm; Em: 573-613 nm). Light cubes with a similar range of excitation/emission wavelength are also adequate for these fluorochromes. If other fluorochromes are used, check whether the microscope used has appropriate filter sets for their detection.
   2. NO measurement-estimated by the nitrite (NO₂) accumulation in the hSVEC conditioned medium using a potassium iodide-based reductive chemiluminescence assay
      1. Preparation
         1. Prepare a standard curve from 0.01-10 mM of sodium nitrite (NaNO₂ in ultrapure water) solution.
         2. Add 5 mL of acetic acid and 1 mL of potassium iodide (50 mg in 1 mL of ultrapure water) into the purge vessel of the nitric oxide analyzer.
      2. NO measurement
         1. Add 20 µL of the NaNO₂ standard curve into the purge vessel of the nitric oxide analyzer. Measure it according to the manufacturer's protocol.
   3. Add 20 µL of the conditioned medium into the purge vessel of the nitric oxide analyzer. Measure it according to the manufacturer's protocol.
   4. Calculate the NO₂ concentrations based on the standard curve calibration. Adjust the values obtained by the total volume of the conditioned medium analyzed^6,11.

Representative Results

Typically, adhered ECs can be observed 3-4 days after extraction. hSVECs initially form clusters of cells and display a typical "cobblestone" morphology (Figure 1B). They express the EC markers CD31 (Figure 1C,D) and VE-cadherin (Figure 1D). hSVECs can be easily propagated on a non-coated treated cell culture dish, and they retain the endothelial phenotype in culture up to eight passages.

hSVECs, when cultured under shear stress, align in the direction of the flow (Figure 2A). The shear stress of 20 dyn/cm² for 72 h induces the expression of typical mechanosensitive genes, KLF2, KLF4, and NOS3, indicating the effectiveness of the shear stimulus in hSVECs (Figure 2B)^12,13,14.

The cyclic stretch outcome is dependent on the intensity applied to the hSVECs. Cells under low stretch show a cortical F-actin pattern similar to static cells (Figure 3A), without change in the NO release up to 72 h (Figure 3B). Arterial levels of stretch remodel the actin cytoskeleton after 24 h (Figure 3A) and decrease NO release after 72 h (Figure 3B).

Figure 1: Endothelial cells from human saphenous veins (hSVECs) exhibit typical endothelial morphology and specific EC marker expression. (A) Saphenous vein segment fulfilled with type II collagenase solution for the extraction of ECs. (B) Representative time-course of hSVEC growth after extraction. After 3-4 days, it is possible to visualize clusters of cells that proliferate until they reach confluency. Scale bar = 100 µm. (C) FACS analysis of cultured hSVECs at passage 1. The green line indicates that 99.7% of the cell population is positive for the endothelial-specific marker CD31. The black line is the negative control. (D) Immunostaining for CD31 (green), (E) VE-cadherin (green), and nuclei DAPI (blue) in hSVECs at passage 1. Scale bar = 50 µm. Please click here to view a larger version of this figure.

Figure 2: hSVECs align in the direction of flow and express mechanosensitive genes when exposed to unidirectional shear stress. Confluent cell monolayer of hSVECs cultivated under static or unidirectional laminar shear stress conditions. (A) Phase-contrast images (top) and phalloidin staining (bottom) of hSVECs exposed to a shear stress of 20 dyn/cm² for 72 h. Green: actin filaments; blue: cell nuclei. Scale bar = 100 µm (phase-contrast) and 20 µm (fluorescence). (B) Gene expression of KLF2, KLF4, and NOS3 determined by qRT-PCR. Values represent mean ± SEM. ** p < 0.01 versus the static group. Please click here to view a larger version of this figure.

Figure 3: The hSVEC phenotype under cyclic stretch is dependent on the intensity applied. (A) Confluent cell monolayer of hSVECs cultivated under static, low (venous), or high (arterial) stretch in a flexible bottom plate for 24 h. Phase-contrast images (top) and phalloidin staining (bottom) showing the actin fibers (red) and nuclei with DAPI (blue). Scale bar = 100 µm (phase-contrast) and 50 µm (fluorescence). (B) NO measurement was estimated based on NO₂ accumulation in the cell culture media for 72 h. Values represent mean ± SEM. *** p < 0.001 versus the static group. Please click here to view a larger version of this figure.

Gene	Protein	Forward 5’-3’		Reverse 5’-3’
KLF2	Krüppel-like Factor 2	CCACTCACACCTGCAGCTA		GTGGTAGGGCTTCTCACCTG
KLF4	Kruppel-like Factor 4	CACCTGGCGAGTCTGACATG		CAGCGGTTATTCGGGGCAC
NOS3	Nitric Oxide Synthase, Endothelial	GCACAGTTACCAGCTAGCCA		GCCGGGGACAGGAAATAGTT
PPIA	Cyclophilin A,	CATTTGGTGCAAGGGTCACA		TCTGCTGTCTTTGGGACCTTGTC
	Peptidylprolyl isomerase A

Table 1: qRT-PCR primers for shear stress and reference genes.

Discussion

The saphenous vein segment should have be least 2 cm to successfully isolate hSVECs. Small segments are difficult to handle and tie the ends of the vessel to maintain the collagenase solution to isolate the cells. The reduced luminal surface area does not yield sufficient cells to expand the culture. To minimize the risk of contamination with non-ECs, the manipulation of the saphenous vein segment needs to be very gentle during the entire procedure. It is important to be careful when introducing the pipette tips into the luminal surfaces to remove blood and during the introduction of the collagenase solution. The exposure to enzyme solution should be very well controlled (no longer than 1 h) to reduce the contamination of the culture with non-ECs. The use of a specific EC medium supplemented with the growth factors cocktail is crucial for the hSVEC culture growth. The additional heparin during the first days of culture is important to reduce residual red blood cells from the vein segment and to inhibit smooth muscle cell proliferation¹⁵. When passing the cells for experiments or for maintaining the culture, make sure to plate the cells with a confluence higher than 40%. The ECs need minimum contact to ensure good proliferation and survival. The hSVECs can easily be cultured on a non-coated (e.g., gelatin or fibronectin) surface. However, the coating during the first days after EC extraction will increase EC adhesion and yield. The hSVECs have a constant proliferation rate and maintain the endothelial phenotype up to eight passages, without expressing mesenchymal cell markers (such as SM22 and calponin). In our experience, the proliferation rate may vary depending on the tissue donor but not with a cell passage. It is recommended to cryopreserve hSVECs in FBS with 5% DMSO to increase the viability after thawing the cells.

To conduct a shear stress experiment, there are critical steps to be considered. To avoid air bubbles forming inside the system, the perfusion set and connectors must be equilibrated overnight at 37 °C and 5% CO₂. The bubbles can block the flow through the system or damage the endothelial monolayer interfering with the cell phenotype. When seeding the cells into the flow chamber slide, it is recommended to have it confluent to use after 4 h or on the next day. Additionally, it is mandatory to change the medium of the slide every day at static conditions if the experiment runs for several days. The volume of the flow chamber slide is ~160 µL, and it is not sufficient to maintain the cells for long periods of culture. The system has the advantage of readily observing the cells by microscopy (brightfield/phase-contrast or staining for fluorescence microscopy). The limitation is the low yield of proteins (20-25 µg/slide) and RNA (1 µg/slide). To overcome this, the system allows the connection of several slides in a series using the same fluidic unit (see the manufacturer's instructions). Then, it is possible to use the volume of the lysis buffer for one slide to extract the protein or RNA from several slides.

The stretch system is easy to handle and allows the application of different intensities and types of stretching. It is important to lubricate all loading stations before each experiment to reduce friction between the culture plate membrane and the station and to guarantee proper distribution of the cyclic strain. Assure that the plates are completely sealed to the baseplate to produce the vacuum necessary to reach the desired stretch. The equiaxial stimulus does not produce a uniform strain inside the well. The cells at the edge of the well need to be discarded, as indicated by the manufacturer. The membrane area of interest is determined based on the loading station diameter and the percentage of elongation. It is possible to perform the immunostaining in the entire membrane or cut it into smaller pieces to reduce the quantity of antibodies used in the assay. In this case, the membranes must be handled very carefully, avoiding damage to the cells. Researchers should also take care not to turn the membrane upside down and lose the cells while doing the staining. It is always possible to confirm the correct face of the membrane with the cells under optic microscopy.

The major limitation of in vitro studies like these is that they do not fully recapitulate the in vivo environment. For this reason, it is important to always perform analysis to ensure that hSVECs maintain the EC phenotype (expressing EC markers) and reproduces expected results under mechanical stress (F-actin orientation and regulation/production of mechanical response proteins).

In summary, we provide a detailed procedure to isolate hSVECs and expose them to controlled levels of shear stress and stretch. When an SV graft is suddenly exposed to arterial conditions after CABG, endothelial damage occurs and contributes to graft failure. These protocols may be instrumental in advancing our understanding of how mechanical forces influence hSVEC dysfunction associated with vein graft disease.

Materials

Name	Company	Catalog Number	Comments
0.25% Trypsin-0.02% EDTA solution	Gibco	25200072
15 µ slide I 0.4 Luer	Ibidi	80176
4',6-Diamidino-2-Phenylindole, Dilactate (DAPI)	Thermo Fisher Scientific	D3571
6-wells equibiaxial loading station of 25 mm	Flexcell International Corporation	LS-3000B25.VJW
8-well chamber slide with removable well	Thermo Fisher Scientific	154453
Acetic Acid (Glacial)	Millipore	100063
Acrylic sheet 1 cm thick	Plexiglass
Anti-CD31 antibody	Abcam	ab24590
Anti-CD31, FITC antibody	Thermo Fisher Scientific	MHCD3101
Anti-VE-cadherin antibody	Cell Signaling	2500
Bioflex plates collagen I	Flexcell International Corporation	BF3001C
Bovine serum albumin solution	Sigma-Aldrich	A8412
Cotton suture EP 3.5 15 x 45 cm	Brasuture	AP524
Cyclophilin forward primer	Thermo Fisher Scientific	Custom designed
Cyclophilin reverse primer	Thermo Fisher Scientific	Custom designed
Dimethyl sulfoxide (DMSO)	Sigma-Aldrich	D4540
EBM-2 basal medium	Lonza	CC3156
EGM-2 SingleQuots supplements	Lonza	CC4176
Fetal bovine serum (FBS)	Thermo Fisher Scientific	2657-029
Flexcell FX-5000 tension system	Flexcell International Corporation	FX-5000T
Fluoromount aqueous mounting medium	Sigma-Aldrich	F4680
Gelatin from porcine skin	Sigma-Aldrich	G2500
Glycerol	Sigma-Aldrich	G5516
Goat anti-Mouse IgG Alexa Fluor 488	Thermo Fisher Scientific	A11001
Goat anti-Rabbit IgG Alexa Fluor 488	Thermo Fisher Scientific	A11008
Heparin sodium from porcine intestinal mucosa 5000 IU/mL	Blau Farmacêutica	SKU 68027
Ibidi pump system (Pump + Fluidic Unit)	Ibidi	10902
KLF2 forward primer	Thermo Fisher Scientific	Custom designed
KLF2 reverse primer	Thermo Fisher Scientific	Custom designed
KLF4 forward primer	Thermo Fisher Scientific	Custom designed
KLF4 reverse primer	Thermo Fisher Scientific	Custom designed
NOA 280 nitric oxide analyzer	Sievers Instruments	NOA-280i-1
NOS3 forward primer	Thermo Fisher Scientific	Custom designed
NOS3 reverse primer	Thermo Fisher Scientific	Custom designed
Paraformaldehyde (PFA)	Sigma-Aldrich	158127
Perfusion set 15 cm, ID 1.6 mm, red, 10 mL reservoirs	Ibidi	10962
Phalloidin - Alexa Fluor 488	Thermo Fisher Scientific	A12379
Phalloidin - Alexa Fluor 568	Thermo Fisher Scientific	A12380
Phosphate buffered saline (PBS), pH 7.4	Thermo Fisher Scientific	10010031
Potassium Iodide	Sigma-Aldrich	221945
QuanTitec SYBR green PCR kit	Qiagen	204143
QuantStudio 12K flex platform	Applied Biosystems	4471087
RNeasy micro kit	Quiagen	74004
Slide glass (24 mm x 60 mm)	Knittel Glass	VD12460Y1D.01
Sodium nitrite	Sigma-Aldrich	31443
SuperScript IV first-strand synthesis system	Thermo Fisher Scientific	18091200
Triton X-100	Sigma-Aldrich	T8787
Trypan blue stain 0.4%	Gibco	15250-061
Type II collagenase from Clostridium histolyticum	Sigma-Aldrich	C6885