The Journal of Visualized Experiments (JoVE) is a peer reviewed, PubMed-indexed video journal. Our mission is to increase the productivity of scientific research.
1Department of Molecular and Cellular Biology, Beckman Research Institute of City of Hope, 2Graduate School of Biological Sciences, Beckman Research Institute of City of Hope, 3Shared Resource-DNA/RNA Peptide, Beckman Research Institute of City of Hope
This article is a part of JoVE Immunology and Infection. If you think this article would be useful for your research, please recommend JoVE to your institution's librarian.
Recommend JoVE to Your LibrarianCurrent Access Through Your IP Address
Current Access Through Your Registered Email Address
Zhou, J., Li, H., Zhang, J., Piotr, S., Rossi, J. Development of Cell-type specific anti-HIV gp120 aptamers for siRNA delivery. J. Vis. Exp. (52), e2954, doi:10.3791/2954 (2011).
The global epidemic of infection by HIV has created an urgent need for new classes of antiretroviral agents. The potent ability of small interfering (si)RNAs to inhibit the expression of complementary RNA transcripts is being exploited as a new class of therapeutics for a variety of diseases including HIV. Many previous reports have shown that novel RNAi-based anti-HIV/AIDS therapeutic strategies have considerable promise; however, a key obstacle to the successful therapeutic application and clinical translation of siRNAs is efficient delivery. Particularly, considering the safety and efficacy of RNAi-based therapeutics, it is highly desirable to develop a targeted intracellular siRNA delivery approach to specific cell populations or tissues. The HIV-1 gp120 protein, a glycoprotein envelope on the surface of HIV-1, plays an important role in viral entry into CD4 cells. The interaction of gp120 and CD4 that triggers HIV-1 entry and initiates cell fusion has been validated as a clinically relevant anti-viral strategy for drug discovery.
Herein, we firstly discuss the selection and identification of 2'-F modified anti-HIV gp120 RNA aptamers. Using a conventional nitrocellulose filter SELEX method, several new aptamers with nanomolar affinity were isolated from a 50 random nt RNA library. In order to successfully obtain bound species with higher affinity, the selection stringency is carefully controlled by adjusting the conditions. The selected aptamers can specifically bind and be rapidly internalized into cells expressing the HIV-1 envelope protein. Additionally, the aptamers alone can neutralize HIV-1 infectivity. Based upon the best aptamer A-1, we also create a novel dual inhibitory function anti-gp120 aptamer-siRNA chimera in which both the aptamer and the siRNA portions have potent anti-HIV activities. Further, we utilize the gp120 aptamer-siRNA chimeras for cell-type specific delivery of the siRNA into HIV-1 infected cells. This dual function chimera shows considerable potential for combining various nucleic acid therapeutic agents (aptamer and siRNA) in suppressing HIV-1 infection, making the aptamer-siRNA chimeras attractive therapeutic candidates for patients failing highly active antiretroviral therapy (HAART).
1. Preparation of the RNA library
2. In vitro generation of aptamers
3. SELEX progress monitored by filter binding assay
4. Cloning, sequencing and alignments
5. Generation of aptamer and chimera RNAs by in vitro transcription
6. Determination of dissociation constants by gel shift assays
7. Cell-surface binding studies by flow cytometry
8. Internalization and intracellular localization studies by Live-cell confocal microscopy
9. In vitro HIV-1 challenge and p24 antigen assay
10. The siRNA function detection by quantitative RT-PCR assay
11. Representative results:
1. New RNA aptamers against HIV-1BaL gp120 are isolated and characterized.
As described in the experimental section, an initial DNA oligonucleotide library containing a 50 nt random region flanked by fixed primer regions on the 5' and 3' ends is amplified and transcribed into an RNA pool. This initial library consists of up to 1015 diverse sequences (1 nmol), which fold into a vast array of various 3-D structures. The high complexity and diversity of the initial library might guarantee the presence of active structures with good binding affinity to the target.
Employ an in vitro SELEX procedure (Figure 1) to select 2'-fluoropyrimidine modified RNA aptamers which selectively bind the R5 strain HIV-1BaL gp120 envelope protein7. As shown in Figure 1, a nitrocellulose-based selection strategy is performed to isolate specific target-binding RNAs from non-binding RNA molecules. Since the protein sticks to nitrocellulose, only the RNA/protein complexes or aggregates can be retained on the membrane and free RNAs are washed out. Under denaturing conditions, the bound RNAs are recovered and are reverse transcribed to cDNA and then amplified into dsDNA, and subsequently in vitro transcribed to create a new RNA pool for next selection cycle. The selection stringency is increased by reducing the amount of target protein and increasing the amount of competitor tRNA. The amount of RNA pool, protein and competitor tRNA used in each selection round is shown in Table 1.
Monitor the progress of selection after each SELEX cycle by the filter binding assay. Evaluate the binding affinity as the percent of the RNA retained on the filter in the total RNA pool. The starting RNA pool (1-RNA) only shows 0.1% of the input RNAs retained on the membrane. However, after nine selection rounds the ninth RNA library (9-RNA) has 9.72% of the input RNA bound. Although additional selection rounds were conducted, no further enrichment is observed, suggesting that maximal binding of the RNA pool has been reached (Figure 2A). Similar with the filter binding assay, the gel shift assay also is one of the most popular strategies for determining dissociation constants. This procedure is easy and convenient. As shown in Figure 2B, gel shift assays further confirm the binding activities of the RNA pools. These results demonstrate that some ligands with high binding specificity for the target protein are successively enriched in these RNA pools..
Clone and sequence the highly enriched aptamer pools (12-RNA). According to the alignments of individual cloned aptamer sequences, six different groups are classified as shown in Table 2. About 40% of the clones (Group I and II aptamers) contain a conserved sequence: A(A/G)TTGAGGGACC(A/G). We choose one representative sequence from each group (for example: A-1, A-5, A-9, A-12, A-28 and B-68) for further characterization because of their relative abundance within their group. Through a native gel mobility shift assay, the dissociation constants (Kd) of these representative aptamers are calculated (Figure 3A). For example, A-1, the best of the aptamers, has an apparent Kd values of 52 nM (Figure 3B). As shown in Figure 3A, these selected aptamers can selectively bind with the target HIV-1 Bal gp120, but not the HIV gp120 CM protein.
2. Anti-gp120 aptamer specifically binds and is internalized by cells expressing HIV gp160 and inhibit HIV-1 infection in cell culture.
CHO-gp160 cells stably expressing the HIV envelope glycoprotein gp160 are used to test for binding and internalization of the selected anti-gp120 aptamers. These cells do not process gp160 into gp120 and gp41 since they lack the gag encoded proteases required for envelope processing. As a control we use the parental CHO-EE cell line which does not express gp160. Flow cytometric analyses (Figure 4A) reveal that the Cy3-labeled aptamers specifically bind to the CHO-gp160 cells but not the control CHO-EE cells. Furthermore, real-time live-cell Z-axis confocal microscopy indicates that the Cy3-labeled aptamer is selectively internalized within the CHO-gp160 cells (Figure 4B and 4C) after 2 hours of incubation, but not the CHO-EE control cells (Figure 4D). Figure 4C also shows that the aptamer aggregated within the cytoplasm, which suggests the gp120 aptamers maybe enter cells via receptor-mediated endocytosis.
In the HIV-1 challenge assay, HIV-1 infected-PBMC cells are treated with the aptamers. At different days post treatment with the aptamers, aliquots of the media are assayed for viral p24 antigen levels (Figure 4E). The results show that the anti-gp120 aptamers (A-1) inhibits HIV-1 p24 production with a nano-Molar concentration.
3. Anti-gp120 aptamer-siRNA chimera is designed and evaluated its efficacy as cell-type specific siRNA delivery system
As shown in Figure 5A, the aptamer and sense strand segment of the siRNAs contained nuclease-resistant 2'-Fluoro UTP and 2'-Fluoro CTP and are synthesized from corresponding dsDNA templates by in vitro bacteriophage transcription. In order to increase the flexibility of the molecule, a two nucleotide linker (UU) is inserted between the aptamer and the Dicer substrate portion. To prepare the siRNA containing chimeras, in vitro transcribed chimeric aptamer-sense strand polymers are annealed with equimolar concentrations of an unmodified antisense strand RNA. These data from gel shift assay (Figure 5B) and flow cytometry (Figure 5C) indicate that the chimeras maintain approximately the same binding affinities as the aptamers alone. The time-course images from real-time confocal microscopy (Figure 5D) show that Cy3-labeled chimera Ch A-1 can be successfully internalized into the cytoplasm of cells. As expected, no uptake of the chimera is observed with the CHO-EE control cells (Figure 5E).
Similarly, the antiviral potential of RNAs is evaluated by HIV-1 challenge assay. The results of HIV p24 antigen analyses (Figure 6A and 6B) show that both aptamer and chimera inhibit p24 production, but the strongest inhibition is observed with the chimera Ch A-1 treatment.
To confirm that the siRNA component is functioning along with the aptamer, following internalization of the Ch A-1 chimera in infected cells, we also evaluate the relative levels of inhibition of tat/rev gene expression by quantitative RT-PCR expression assays. We find that the treatment of infected cells with the chimeras is able to induce silencing of the tat/rev gene, while the aptamer alone did not affect tat/rev gene expression (Figure 6C and 6D). These results provide further support that the aptamer delivered siRNA triggers RNAi.
| The amount of protein, RNA pool and tRNA used for selection | |||||
| SELEX rounds | Ratio of Target/RNA | Gp120 protein | RNA pool | Competitor tRNA | Selection Buffer |
| 1 | 1/6.5 | 229.8 pmol | 1.5 nmol (40.1 μg) | 0 | Low salt SELEX buffer |
| 2 | 1/6.5 | 114.9 pmol | 0.75 nmol (20.1 μg) | 0.25 nmol (6.6 μg) | |
| 3 | 1/8 | 76.6 pmol | 0.625 nmol (16.7 μg) | 0.25 nmol (6.6 μg) | |
| 4 | 1/8 | 76.6 pmol | 0.625 nmol (16.7 μg) | 0.25 nmol (6.6 μg) | |
| 5 | 1/8 | 38.3 pmol | 0.306 nmol (8.18 μg) | 0.5 nmol (13.2 μg) | High salt SELEX buffer |
| 6 | 1/8 | 38.3 pmol | 0.306 nmol (8.18 μg) | 0.5 nmol (13.2 μg) | |
| 7 | 1/10 | 26.8 pmol | 0.268 nmol (7.16 μg) | 0.5 nmol (13.2 μg) | |
| 8 | 1/10 | 26.8 pmol | pmol 0.268 nmol (7.16 μg) | 1 nmol (26.4 μg) | |
| 9 | 1/10 | 15.3 pmol | 0.153 nmol (4.09 μg) | 1 nmol (26.4 μg) | |
| 10 | 1/10 | 15.3 pmol | 0.153 nmol (4.09 μg) | 1.5 nmol (39.6 μg) | |
| 11 | 1/12.5 | 7.66 pmol | 0.096 nmol (2.56 μg) | 2 nmol (52.8 μg) | |
| 12 | 1/12.5 | 7.66 pmol | 0.096 nmol (2.56 μg) | 2 nmol (52.8 μg) | |
Table 1. The selection conditions. The amount of protein, RNA pool and tRNA used for each selection and selection buffer are indicated.
| Group | RNA | Random sequences | Frequency (140 clones) |
| Group I | A-1 | AATTGAGGGACCACGCGCTGCTTGTTGTGATAAGCAGTTTGTCGGATGG | 33 (23.6%) |
| B-7 | AATTGAGGGACCAACGCGAGGATGTGGATAGTGTGTATTTGCGTGATGG | 3 | |
| A-32 | AATTGAGGGACCGTTGGTAAAAGCCGGAAATTGAGCTTTTACGGCGATGG | 5 | |
| B-55 | AATTGAGGTACCGCGTTATTAGGAACAAATTGGAATTCTAAACGCGATGG | 2 | |
| A-24 | AATAGAGGGACCCAGATATAGGCTACACGGATGATGGTGTATCTGGATGG | 1 | |
| B-19 | AATAGAGGAACCGTTTCAGAAGACTACAGGTTAGTCCAATGAAGCGACGG | 1 | |
| B-31 | AATAGAGGGACCGTGGACAATAATTTATGGTCA TTTATTGGCACGATGG | 1 | |
| Group II | A-12 | AGTAGAGGAACCAAGCAATGGATGAATGCAAAAGTGTAAATGCTTGATGG | 10 (7.1%) |
| Group III | A-9 | TGAGTTTGGGTAAATTTCCGGTTTCGGTTTACTCACGAAAGATCGGTCGG | 15 (10.7%) |
| Group IV | A-28 | TAAAGGAGGGAAGGATGAGACCGCACGAAAAATATCAGCATACGTTTGTG | 10 (7.1%) |
| Group V | A-5 | GAAACTAGTTTGAATAATGGTGTAGAGGAGGGTCAATAGTTTCGTTGGTG | 9 (6.4%) |
| Group VI | B-68 | ACATAGTAATGACACGGAGGATGGAGAAAAAACAGCCATCTCTTGACGGT | 2 |
| Others | Orphan sequence | 48 |
Table 2. The alignment and identification of RNA aptamers. Following the 12th round of selection, the selected RNA pool was cloned and sequenced. After alignment of all 140 clones, six groups of anti-gp120 aptamers were identified. Only the random sequences of the aptamer core regions (5'-3') are indicated. Isolates occurring with multiple frequencies are specified.

Figure 1: Schematic representation of the in vitro selection procedure using a nitrocellulose membrane, for generating RNA aptamers for HIV-1 Bal gp120 protein. (A) The starting RNA pool and target protein were incubated to form complex. (B) The bound RNA molecules were retained on the membrane and eluted from the membrane under denaturing condition. (C) The unbound RNAs were washed away. (D) The selected RNAs were reverse transcribed and amplified by PCR. (E) The relevant DNA was subsequently transcribed into new RNA pool for next selection cycles. (F) After 10-15 selection rounds, the selected aptamers were cloned and sequence.

Figure 2: The progress of HIV-1 gp120 aptamers selection. (A) The binding activity of the RNA pool at each cycle was analyzed by filter binding assay with competitor tRNA. Binding activities were calculated as the percentage of input RNA retained on the filter in protein/RNA complex. (B) The binding activity of the RNA pool at each cycle was analyzed by gel shift assay. The 12th RNA pool showed the highest binding activity.

Figure 3: Binding activity assay of selected individual aptamers against HIV-1Bal gp120. (A) The 5'-end P32 labeled individual aptamers were incubated with the increasing amounts of target gp120 protein or non-specific CM protein. The binding reaction mixtures were analyzed by a gel mobility shift assay. Aptamer A-1 and B-68 showed the best binding affinity with the target protein, but not CM protein. Data represent the average of four replicates. (B) Binding curve from a gel shift assay.

Figure 4: Cell-type specific binding and uptake studies of aptamers. (A) Cell surface binding of Cy3-labeled RNAs was assessed by flow cytometry. Cy3-labeled RNAs were tested for binding to CHO-gp160 cells and CHO-EE control cells. The selected aptamers showed cell-type specific binding affinity. The 2nd RNA pool and irrelevant RNAs were used as negative controls. Data represent the average of three replicates. (B) Internalization analysis. CHO-gp160 cells were grown in 35 mm plates and incubated with a 100 nM concentration of Cy3-labeled A-1 in culture media for real-time live-cell-confocal microscopy analysis. The images were collected at 15 min. intervals using 40X magnification. (C, D) Localization analysis. CHO-gp160 cells and CHO-EE control cells were grown in 35 mm plates. Before incubation with 100 nM of Cy3-labeled A-1, cells were stained with Hoechst 33342 (nuclear dye for live cells) and then analyzed using real-time confocal microscopy. (E) The selected anti-gp120 aptamers inhibit HIV-1 replication in human PBMCs previously infected with HIV-1 NL4-3 virus. Different concentrations and time pointes were presented. IC50 value was listed. Data represents the average of triplicate measurements of p24.

Figure 5: The design and evaluation of the aptamer-siRNA chimera delivery system. (A) Schematic aptamer-siRNA chimeric RNAs: the region of the anti-gp120 aptamer is responsible for binding to gp120 and the siRNA is targeting a common exon of HIV-1 tat/rev. The 2'-Fluoro modified aptamer-siRNA sense single strand was co-transcribed, followed by annealing of the complementary siRNA antisense strand to complete the chimeric molecule. A linker (UU) between the aptamer and siRNA is indicated in green. (B) The aptamer-siRNA chimeric RNAs that have comparable Kd values as well as parental aptamers specifically bind the HIV Bal gp120 protein. Data represent the average of three replicates. (C) Cell-type specific binding studies of aptamers. Cy3-labeled RNAs were tested for binding to CHO-gp160 cells and CHO-EE control cells. Cell surface bindings of Cy3-labeled RNAs were assessed by flow cytometry. The selected aptamers showed cell-type specific binding affinity. The 2nd RNA pool and irrelevant RNA were used as negative controls. Data represent the average of two replicates. (D, E) Internalization and intracellular localization analyses. CHO-gp160 cells were grown in 35 mm plates and were stained with Hoechst 33342 (nuclear dye for live cells). Subsequently, cells were incubated in culture medium with a 100 nM concentration of Cy3-labeled chimera for real-time live-cell confocal microscopy analysis as previously described.

Figure 6: Dual inhibition of HIV-1 infection mediated by aptamer-siRNA chimeras. Both anti-gp120 aptamer and aptamer-siRNA chimeras neutralized HIV-1 infection in (A) CEM cells (IIIB strain) and (B) human PBMCs (BaL strain) culture, respectively. Data represent the average of triplicate measurements of p24. The chimeras showed stronger inhibition than aptamer alone indicating that (C, D) the siRNA delivered by the aptamers down-regulated tat/rev gene expression in the PBMCs. Data represent the average of three replicates.
Subscription Required. Please recommend JoVE to your librarian.
Aptamers are in vitro evolved nucleic acids that assume specific and stable three-dimensional shapes, thereby providing highly specific, tight binding to targeted molecules8. The low nanomolar binding affinity and exquisite specificity of aptamers to their targets make them versatile tools for diagnostics, in vivo imaging, and therapeutics9. With the advent of aptamer technology for targeted siRNA delivery it is now feasible to use the aptamer binding function for receptor mediated endocytosis of siRNAs10-12. Aptamers raised against membrane receptors have emerged as promising delivery vehicles to target a distinct disease or tissue in a cell-type-specific manner13, which can enhance the therapeutic efficacy as well as reduce the unwanted toxic side effects of drugs.
So far, an increasing number of aptamers that target a specific cell type or subpopulation of malignant cells have been successfully isolated and characterized through either traditional purified membrane protein-based SELEX or intact cell-based SELEX processes. Efficient generation of new aptamers as cell-specific homing agents still poses a key challenge when performing selection with recombinant proteins due to unavailability of the desired receptor species, labile native and problematic biochemical or physical properties. Therefore, cell-based SELEX provides an alternative for the generation of aptamers that can bind specifically to a particular target cell population. However, it was noticed that dead cells always incur non-specific binding to nucleic acids, therefore causing Cell-SELEX failure. Moreover, in contrast with the traditional purified protein-based SELEX, the complexity and diversity of the cells surface also increase the difficulties for Cell-SELEX procedure. Thus far, most of the cell-specific aptamers for targeted delivery have been evolved by using the purified protein-based SELEX method.
Among those conventional strategies for isolation of aptamers, the nitrocellulose membrane based-SELEX is well-established and documented in numerous publications. Herein, we employ this procedure to successfully isolate several new anti-HIV gp120 RNA aptamers, which are able to specifically bind gp120 and are internalized into cells expressing the HIV envelope. As one of the advantages of this technique, it is not necessary to modify the target molecules (for example: protein) and immobilize the target on a solid-phase sorbent (such as: beads, resin column, plate or chip), which doesn't affect the target's original confirmation. It is more reliable and straightforward for selection. In order to enrich bound RNA species with higher affinity, the selection stringency is carefully controlled by adjusting the conditions, such as the selection buffer system, the concentration of target protein, competitor tRNA and washing times8. During selection, the binding affinity is monitored to make sure the enrichment and selection progress, thereby fine-tuning the condition for the next selection round. These aptamers can inhibit several different HIV-1 strains, indicating that anti-gp120 aptamers that inhibit the initial step of HIV-1 entry by blocking the binding of the gp120 and CD4 receptor may be useful in HIV-1 therapeutic applications. We also capitalize on the exquisite specificity of a gp120 aptamer to deliver anti-HIV siRNAs into HIV infected cells with the net result that the replication and spread of HIV is strongly inhibited by the combined action of the aptamer and a siRNA targeting the tat/rev common exon of HIV-17, 14. Therefore, the anti-gp120 aptamers can function both as antiviral agents and as siRNA delivery reagents.
Subscription Required. Please recommend JoVE to your librarian.
J. R and J. Z. have a patent pending on "Cell-type specific aptamer-siRNA delivery system for HIV-1 therapy". USPTO, No. 12/328994, publication date: June 11, 2009.
We thank Britta Hoehn, Guihua Sun, Harris Soifer and Lisa Scherer for helpful discussions. This work was supported by grants from the National Institutes of Health AI29329 and HL07470 awarded to J.J.R. The following reagents were obtained through the NIH AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: The CHO-EE and CHO-gp160 cell line; the pNL4-3 luc vector; HIV-1BaL gp120 from DAIDS, NIAID.
| Name | Company | Catalog Number | Comments |
| MF-Millipore membrane filter | EMD Millipore | HAWP01300 | Pore size 0.45 μm |
| Swinnex Filter holder | EMD Millipore | SX0001300 | 13 mm diameter |
| QIAquick Gel Extraction Kit | Qiagen | 28706 | DNA purification |
| Microcon YM-30 column | EMD Millipore | 42410 | RNA concentration |
| Bio-spin 30 column | Bio-Rad | 732-6250 | RNA purification |
| Taq PCR DNA polymerase | Sigma-Aldrich | D1806 | |
| ThermoScript RT-PCR system | Invitrogen | 11146-024 | |
| DuraScribe T7 transcription Kit | Epicentre Biotechnologies | DS010925 | |
| dNTP for PCR | Roche Group | 1 581 295 | |
| Ribonucleic acid, transfer from E.coli | Sigma-Aldrich | R1753 | tRNA competitor |
| HIV-1Ba-L gp120 protein | National Institutes of Health | 4961 | Target protein |
| Silencer siRNA labeling kit - Cy3 | Ambion | 1632 | |
| Acid phenol/chloroform 5/1 solution (pH 4.5) | Ambion | AM9720 | |
| Chloroform/Isopropanol 24/1 solution | Sigma-Aldrich | C0549 | |
| Calf intestinal phosphatase (CIP) | New England Biolabs | M0290L | |
| T4 polynucleotide kinase | New England Biolabs | M0201L | |
| Glycogen | Roche Group | 10 901 393 001 | RNA precipitation |
| Gamma-P32-ATP | MP Biomedicals | 013502002 | Radiactivity |
| 40% AccuGel 19:1 | National Diagnostics | EC-850 | |
| 10xTBE | National Diagnostics | EC-860 | |
| N,N,N,N’-Tetramethylethylenediamine (TMEMD) | Sigma-Aldrich | T9281 | |
| Ammonium persulfate (APS) | Sigma-Aldrich | A3678 | |
| L-methioine sulfoximine | Sigma-Aldrich | M5379-250 mg | |
| RPMI Media 1640 | Invitrogen | 11835-030 | |
| Sodium Bicarbonate solution, 7.5% w/v | Invitrogen | 25080-094 | |
| Minimum Essential Medium (MEM) (10ï‚’) | Invitrogen | 11430-030 | |
| MEM non-essential amino acid (100ï‚’) | Invitrogen | 11140-050 | |
| TA cloning kit with pCR 2.1 | Invitrogen | K2040-01 |