Direct Reprogramming of Mouse Fibroblasts into Melanocytes

Summary

Here, we describe an optimized direct reprogramming system for melanocytes and a high-efficiency, concentrated virus packaging system that ensures smooth direct reprogramming.

Abstract

The loss of function of melanocytes leads to vitiligo, which seriously affects the physical and mental health of the affected individuals. Presently, there is no effective long-term treatment for vitiligo. Therefore, it is imperative to develop a convenient and effective treatment for vitiligo. Regenerative medicine technology for direct reprogramming of skin cells into melanocytes seems to be a promising novel treatment of vitiligo. This involves the direct reprogramming of the patient's skin cells into functional melanocytes to help ameliorate the loss of melanocytes in patients with vitiligo. However, this method needs to be first tested on mice. Although direct reprogramming is widely used, there is no clear protocol for direct reprogramming into melanocytes. Moreover, the number of available transcription factors is overwhelming.

Here, a concentrated lentivirus packaging system protocol is presented to produce transcription factors selected for reprogramming skin cells to melanocytes, including Sox10, Mitf, Pax3, Sox2, Sox9, and Snai2. Mouse embryonic fibroblasts (MEFs) were infected with the concentrated lentivirus for all these transcription factors for the direct reprogramming of the MEFs into induced melanocytes (iMels) in vitro. Furthermore, these transcription factors were screened, and the system was optimized for direct reprogramming to melanocytes. The expression of the characteristic markers of melanin in iMels at the gene or protein level was significantly increased. These results suggest that direct reprogramming of fibroblasts to melanocytes could be a successful new therapeutic strategy for vitiligo and confirm the mechanism of melanocyte development, which will provide the basis for further direct reprogramming of fibroblasts into melanocytes in vivo.

Introduction

Vitiligo is a skin disease that seriously affects the physical and mental health of the affected individuals. For various reasons, including metabolic abnormalities, oxidative stress, generation of inflammatory mediators, cell detachment, and autoimmune response, the functional melanocytes are lost, and the secretion of melanin is stopped, leading to the development of vitiligo^1,2. This condition occurs widely and is particularly problematic on the face. The main treatment is the systemic use of corticosteroids and immunomodulators. Phototherapy can be used for systemic or local diseases, and there are surgical treatments, such as perforated skin transplantation and autologous melanocyte transplantation^3,4,5. However, patients who use drug therapy and phototherapy are prone to relapse, and these treatments have poor long-term therapeutic effects. Surgical treatment is traumatic and only moderately effective^2,6. Therefore, a new and effective therapeutic strategy is needed for vitiligo.

The reprogramming of induced pluripotent stem cells (iPSCs) reverses these cells from their terminal state to a pluripotent state, a process mediated by the transcription factors, Oct4, Sox2, Klf4, and c-Myc⁷. However, due to the possibility of tumorigenicity and the long production time, this technology has been met with skepticism when applied to clinical settings⁸. Direct reprogramming is a technology that makes one type of a terminal cell transform into another type of a terminal cell⁹. This process is achieved by suitable transcription factors. Various cells have already been directly reprogrammed successfully, including cardiomyocytes¹⁰, neurons¹¹, and cochlear hair cells¹². Some researchers have even reprogrammed skin tissue directly in situ, which can be used for wound repair¹³. The advantages of direct reprogramming include reduced wait times and costs, lower risk of cancer, fewer ethical problems, and a better understanding of the mechanism underlying cell fate determination⁹.

Although the direct reprogramming method is widely used, there is currently no definite method for the direct reprogramming of skin cells into melanocytes, especially because of the numerous transcription factors to be considered^14,15. The transcription factors, Mitf, Sox10, and Pax3, have been used for direct reprogramming of skin cells into melanocytes¹⁴. In contrast, the combination of MITF, PAX3, SOX2, and SOX9 has also been used for direct reprogramming of skin cells into human melanocytes in another study¹⁵. In this protocol, despite the use of a different screening method, the same result was obtained with the combination of Mitf, Sox10, and Pax3 for direct reprogramming of skin cells into melanocytes as described previously¹⁴. Developing a system to generate melanocytes from other skin cells can provide a scheme for transforming other skin cells of vitiligo patients into melanocytes. Hence, it is crucial to construct a simple and efficient method for this direct reprogramming to generate melanocytes successfully.

Protocol

This work was approved by the Laboratory Animal Management and Use Committee at Jiangsu University (UJS-IACUC-AP--20190305010). The experiments were performed in strict accordance with the standards established by the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC International). There were no experiments involving humans, so this work did not need approval from the human research ethics committee. Refer to the Table of Materials for details about reagents.

1. Construction of a concentrated lentivirus packaging system for transcription factors

1. Production of the concentrated virus (Figure 1A, B)
   1. Plate 1.5 × 10⁶ HEK-293T cells into a 60 mm dish and culture these cells with normal medium (see Table 1) at 37 °C in a humidified incubator with 5% CO₂.
      NOTE: If the virus needs to be packaged in batches, a 100 mm cell culture dish can be used (for details, see Table 2).
   2. After 24 h, ensure that the HEK-293T cells have reached 80-90% confluence on the day of transduction, and replace the medium with 3.5 mL of DMEM (150 µL of DMEM per 1 cm²). Leave the cells at 37 °C in a humidified incubator with 5% CO₂ for 2 h.
      NOTE: The replacement medium must be serum-free, so that the cells can be "starved" for better plasmid transfection.
   3. Prepare the mixture of plasmids (mix A) containing 3 µg of the target plasmids of Mitf, Sox10, Pax3, Sox2, Sox9, or Snai2; 1 µg of the packaging plasmid PMD2.G, and 2 µg of the packaging plasmid PSPAX2. Make up the volume of mix A to 150 µL with serum-free DMEM. Prepare the mix of the transfection reagent (mix B) by adding 12 µL of the transfection reagent (the volume is twice the total mass of all the plasmids), and make up the volume of mix B to 150 µL with serum-free DMEM.
      NOTE: When preparing the mixes, it is important to add liquid slowly to avoid air bubbles.
   4. Combine mix A and mix B after allowing them to stand for 5 min at room temperature. Incubate the mixture at room temperature for 20-30 min to form the transfection complex.
   5. Take the HEK-293T cells out of the incubator, replace the medium with DMEM + 2% FBS, add the mixture from step 1.1.4 dropwise, and mix the liquid gently.
   6. After 8 h, change the medium with 3.5 mL of normal medium. After changing the medium, collect the virus supernatant every 24 h and 48 h.
   7. Mix the virus supernatants collected at two different time points. Centrifuge at 200 × g for 5 min at 4 °C. Pass the supernatant through 0.45 µm filters and collect it in a 50 mL sterile conical tube.
      NOTE: The virus collected at 24 h can be stored at 4 °C and mixed with the virus collected at 48 h.
   8. Concentrate the virus supernatant by centrifuging at 6000 × g at 4 °C overnight (~16 h). Ensure that the virus pellet is visible at the bottom of the conical tube after centrifuging.
   9. Pour out the supernatant slowly. Dissolve the virus pellet in a volume of normal medium that is 1/100^th of the volume of the virus supernatant. Using a P1000 micropipette, pipette up and down gently until a homogeneous mixture is obtained. Divide the concentrated virus into microcentrifuge tubes as needed. Store at −80 °C.
      NOTE: The virus is concentrated 100x with this method. The concentrated virus (100x) can be stored for >1 year at −80 °C. Avoid repeated freezing and thawing of the virus.
2. Detection of concentrated virus titer (Figure 1C)
   1. Plate 1 × 10⁵ HEK-293T cells into one well of a 6-well plate. Remember to add one well as a negative control. Culture these cells with normal medium at 37 °C in a humidified incubator with 5% CO₂.
   2. Add 0.1 µL or 0.2 µL of fluorescent concentrated virus (100x) to each well after 24 h, and add 4 ng/µL of the cationic polymeric transfection reagent to each well. About 8-12 h after infection, replace the medium with normal medium.
      NOTE: To ensure the accuracy and efficiency of the fluorescence detection, the infection rate must be 10-30%. Adding 0.1 µL or 0.2 µL of the fluorescent concentrated virus can maintain the infection efficiency within this range. The concentrated virus titer can reach 1 × 10⁸ transducing units (TU)/mL at least.
   3. Approximately 48 h after infection, wash the dish with 1 mL of sterile phosphate-buffered saline (PBS) to remove dead cells.
   4. Trypsinize these cells using 250 µL of 0.05% trypsin-EDTA per well in a 6-well plate for 1 min at room temperature. Centrifuge at 200 × g for 5 min at 4 °C and then remove the supernatant.
   5. Resuspend the cell pellet in 1 mL of PBS, add the suspension to a 5 mL polystyrene round-bottom tube, and detect the infection efficiency of the virus fluorescence (green fluorescent protein, GFP⁺) using flow cytometry.
   6. Calculate the concentrated virus titer using the following formula: 10⁵ (cell volume) × infection rate (GFP⁺%)/added virus volume (0.1 µL or 0.2 µL).

2. Direct reprogramming of fibroblasts to melanocytes (Figure 2A)

1. Coat one well of a 6-well cell culture plate with 1 mL of 0.1% gelatin solution at room temperature for 15-30 min. Ensure that the well is completely covered with the 0.1% gelatin solution. Aspirate the 0.1% gelatin solution after coating.
   NOTE: Prepare 0.1% gelatin solution (100 mL) as follows: 0.1 g of gelatin powder is dissolved in 100 mL of ultrapure water in an autoclaved glass bottle and then stored at 4 °C for no more than 2 months.
2. Plate 5 × 10⁴ MEFs into one well of a 6-well plate coated with 0.1% gelatin (as in step 2.1), and culture these cells with normal medium at 37 °C in a humidified incubator with 5% CO₂ overnight.
3. After 24 h, confirm that the MEFs have reached 40-50% confluence. Replace the medium with normal medium.
4. On Day 0, take out the concentrated virus from the freezer and melt the virus on ice. Calculate the volume of the virus to be added by using eq. (1). Add the concentrated virus for the six transcription factors, Mitf, Pax3, Sox10, Sox9, Sox2, and Snai2 (see Table of Materials) to each well according to the calculated volume, and then add 4 µg/mL of the cationic polymeric transfection agent.
   Cell number (5 × 10⁴) × 30 (multiplicity of infection, MOI)/virus titer (1)
5. On Day 1, 8-12 h after infection, remove the medium containing the virus and replace it with fresh normal medium while adding 0.5 µg/mL puromycin to screen stable infected cell lines.
6. On Day 2, 48 h after infection, replace the supernatant medium gradually with the reprogramming medium. First, change 1/4^th of the total medium volume, and add 3 µM CHIR99021.
7. From Day 3 to Day 7, depending on the condition of the cells, change the medium by replacing with a higher proportion of reprogramming medium (see Table 1) gradually, and switch to complete reprogramming medium within 5 days.
   NOTE: During this period, puromycin and CHIR99021 must be used every day. Many dead cells will appear on the first and second day of changing the reprogramming medium. This is normal as the cells gradually adapt to the transformation. Therefore, the medium needs to be changed gradually to ensure the healthy proliferation of the cells.
8. To passage the cells, add 500 µL of 0.05% trypsin-EDTA to digest the cells for 3 min at room temperature. When ~60% of the cells have floated up, stop the digestion by adding normal medium 2x the volume of the digestive enzyme. Collect the cell suspension in a 15 mL sterile conical tube, centrifuge at 200 × g for 5 min at 4 °C, remove the supernatant, resuspend the cell pellet with the reprogramming medium, and plate the cells in a 60 mm sterile dish at a density of 3 × 10⁴/cm². Culture these cells at 37 °C in a humidified 5% CO₂ incubator.
   ​NOTE: From Day 8 to Day 21, these cells are sub-cultured every 3-5 days and cultured in 60 mm sterile dishes to expand. They can be cultured to reach at least passage 5.

3. Optimization for direct reprogramming and identification

1. Screening for the optimized transcription factors
   1. Repeat steps 2.1-2.7, reducing one of the six transcription factors each time. Infect the MEFs with the virus with combinations of five transcription factors.
   2. Seven days after infection, extract the RNA of these cells¹⁶, and analyze the expression levels of their melanocytic genes using reverse-transcription PCR (RT-PCR)¹⁷ to screen for the transcription factors with the greatest impact on conversion to melanocytes by removing them one by one (Figure 3A).
   3. Use the top three transcription factors impacting the conversion to melanocytes to infect the MEFs. Repeat steps 2.1-2.7.
      NOTE: Seven days after infection, the melanocytic genes should be detectable in these transformed cells (Figure 3B). Primer information for iMels characterization is included in Table 3.
2. Identification of induced melanocytes (iMels)
   1. Use immunofluorescence staining¹⁸ to verify that the iMels express melanocytic proteins, including TYRP-1 and DCT (Figure 4A).
   2. Melanin-specific 3,4-dihydroxyphenylalanine (DOPA) staining (Figure 4B)
      1. Prepare 4% paraformaldehyde (10 mL) as follows: dissolve 0.4 g of paraformaldehyde powder in 10 mL PBS. Place the solution in an oven at 56 °C for 2 h to promote dissolution.
         NOTE: The solution can be kept at 4 °C for no more than one month.
      2. Culture the iMels in a 30 mm dish and wash the dish twice with pre-warmed PBS. Add 1 mL of 4% paraformaldehyde to fix the cells for 20 min, and wash the dish 3 times with PBS.
      3. Prepare 0.1% DOPA stain solution (10 mL) just before use by dissolving 0.01 g of L-DOPA powder in 10 mL of PBS. Place the solution in a water bath at 37 °C for 30 min; shake it several times to promote dissolution.
      4. Add 1 mL of freshly prepared 0.1% DOPA staining solution. Incubate in an oven at 37 °C for 2-5 h. If there are no brown-black particles, continue to incubate at 37 °C for another 2 h but not for >5 h. Check the samples every 30 min.
      5. Wash the dish 3 times with PBS for 1 min each time. Stain the nucleus with 1 mL of hematoxylin staining solution for 2 min.
      6. For long-term storage, dehydrate the samples using 95% ethanol for 3 min and then 100% ethanol for 5 min. Seal the dish with xylene and neutral balsam.
   3. Melanin-specific Masson-Fontana staining (Figure 4B)
      1. Plate iMels in a 30 mm dish and fix the cells with 4% paraformaldehyde for 20 min; wash the dish 3 times with PBS.
      2. Add 1 mL of solution A (ammonia silver solution) from the Masson-Fontana staining kit (see Table of Materials), place the dish in a dark box, and place the dark box in an oven at 56 °C for 15-40 min.
         NOTE: If brown-black particles are not visible after 15 min in the oven, return the samples to the 56 °C oven to continue incubating but not for >40 min. Some water can be added to the dark box to prevent drying up.
      3. Aspirate solution A and wash the dish 5-6 times with distilled water, 1-2 min each time.
      4. Add 1 mL solution B (hypo solution) from the Masson-Fontana staining kit, and leave the dish at room temperature for 3-5 min.
      5. Aspirate solution B and wash the dish with tap water 3 times, 1 min each time.
      6. Add 1 mL of solution C (neutral red dye) from the Masson-Fontana staining kit, and leave the dish at room temperature for 3-5 min.
      7. Aspirate solution C and wash the dish 3 times with distilled water, 1 min each time.
      8. Add 1 mL of 100% ethanol for rapid dehydration, and aspirate the ethanol after 3 min.
         NOTE: Stained samples can be stored for a long time after sealing with xylene and neutral balsam.

Representative Results

This article includes the protocols of a concentrated lentivirus packaging system to produce lentivirus of transcription factors for direct reprogramming of fibroblasts to melanocytes and protocols for screening for transcription factors and direct reprogramming of melanocytes from MEFs.

The success of concentrated lentivirus production was evaluated by observing the fluorescence intensity of GFP (Figure 1A) or by flow cytometry (Figure 1B) after infecting HEK-293T cells for 48 h with unconcentrated lentivirus (1x) and concentrated lentivirus (100x). The titer of the concentrated virus was 10⁸ TU/mL or more, which is relatively high (Figure 1C).

Direct reprogramming of fibroblasts to melanocytes is achieved through the infection with transcription factor lentivirus and transformation with the optimized reprogramming medium. The scheme for the generation of iMels from MEFs is shown in Figure 2A. Cell morphology gradually changes during direct reprogramming. Cell synapses become elongated, and cell nuclei enlarge. However, these cells gradually age after ~Day 20 (~5 passages) (Figure 2B).

One transcription factor was removed at a time from the original set of six transcription factors (Mitf, Pax3, Sox10, Sox9, Sox2, and Snai2) to determine the transcription factor with the greatest impact on reprogramming. Removal of Mitf, Pax3, or Sox10 resulted in the silencing of the expression of melanocytic genes Tyr, Tyrp1, and Mlana (Figure 3A), indicating that these three transcription factors had the greatest impact on fibroblast conversion to melanocytes. The expression of melanocytic genes induced by direct reprogramming with three transcription factors was higher than that of all six transcription factors (Figure 3B).

Finally, the characteristics of the iMels obtained by using this optimized system of direct reprogramming were identified. The expression of melanocytic markers (TYR, TYYP1) was detected using immunofluorescent staining (Figure 4A). Melanin-specific staining methods, including DOPA and Masson-Fontana staining, also showed positive results (Figure 4B).

Figure 1: Production of concentrated virus and estimation of titer. (A) Fluorescence intensity of GFP after infecting HEK-293T cells with unconcentrated lentivirus (1x) and concentrated lentivirus (100x) (B) Comparison of the infection rates of unconcentrated lentivirus (1x) and concentrated lentivirus (100x) as detected by flow cytometry. (C) Titer estimation of concentrated lentivirus. Scale bars = 250 µm. Abbreviations: GFP = green fluorescent protein; TU = transducing units. Please click here to view a larger version of this figure.

Figure 2: Generation of iMels from MEFs. (A) Schematic diagram of iMels generation. (B) Changes in cell morphology during conversion from MEFs to iMels in direct reprogramming on day 0, day 3, day 10, and day 20+. Scale bars = 100 µm. Abbreviations: iMels = induced melanocytes; MEFs = mouse embryonic fibroblasts. Please click here to view a larger version of this figure.

Figure 3: Screening for optimized transcription factors. (A) qRT-PCR of Tyr, Tyrp1, and Mlana mRNA levels in cells transduced with five transcription factors (one of the original six transcription factors has been removed). MEF + EV and MEF + 6F are used as negative control and positive control, respectively. The mRNA expression is normalized to Gapdh expression. (B) qRT-PCR of Tyr,Tyrp1, and Mlana mRNA levels in cells transduced with the original six transcription factors and with three transcription factors. MEF, MEF + EV, and MMC are used as a blank, negative control, and positive control, respectively. The mRNA levels are normalized to Gapdh levels. All values are mean ± SD of three independent experiments. The primer sequences are shown in Table 3. Abbreviations: qRT-PCR = quantitative reverse-transcription PCR; MEF = mouse embryonic fibroblasts; MEF+EV = mouse embryonic fibroblasts + empty vector; MMC = mouse melanocyte; 6F = six transcription factors comprising Mitf, Pax3, Sox10, Sox9, Sox2, and Snai2; 3F: three transcription factors comprising Mitf, Pax3, and Sox10. Please click here to view a larger version of this figure.

Figure 4: Functional identification of iMels. (A) Immunostaining of melanocytic markers (TYR, TYYP1) in iMels. Scale bar = 50 µm. See the Table of Materials for the dilution of antibodies used in this study. (B) Masson-Fontana staining and DOPA staining. MEF and the Melan-a cell line are used as negative control and positive control, respectively. Scale bar = 50 µm. Abbreviations: iMels = induced melanocytes; DOPA = 3,4-dihydroxyphenylalanine; MEF = mouse embryonic fibroblast. Please click here to view a larger version of this figure.

	Components	Dose (concentration, volume)	Final Concentration
Normal Medium (100 mL)	DMEM/HIGH GLUCOSE	89 mL
	Heat-inactivated FBS	10 mL
	Antibiotics(Pen/Strep)	10000 U/mL, 1 mL	100 U/mL
Reprogramming medium (100 mL)	RPMI-1640	88 mL
	Heat-inactivated FBS	10 mL
	Recombinant Human SCF	200 μg/mL, 50 μL	100 ng/mL
	Recombinant Human bFGF	4 μg/mL, 250 μL	10 ng/mL
	Recombinant Human insulin	10 mg/mL, 50 μL	5 μg/mL
	EDN3 human	100 μM, 100 μL	0.1 μM
	Cholera Toxin	0.3 mg/mL, 0.56 μL	20 pM
	Phorbol 12-myristate 13-acetate (TPA)	1 mM, 20 μL	200 nM
	Hydrocortisone	100 μg/mL, 500 μL	0.5 μg/mL
	Adenine	40 mg/mL, 60 μL	24 μg/mL

Table 1: Components of normal and reprogramming media.

Culture Dish	Seeding Density (cells/dish)	Medium (mL)	Plasmid System			Transfection reagent (µL)
			Target plasmid (μg)	PMD2.G (μg)	PSPAX2 (μg)
35 mm	6 ×105	1.5	1.5	0.5	1	6
60 mm	1.5 × 106	3.5	3	1	2	12
100 mm	4 × 106	8	8	3	6	34

Table 2: Details of the lentivirus packaging system.

RT-PCR Primers
Target	Primer sets
Gapdh	Forward: CAACGACCCCTTCATTGACC
	Reverse: CATTCTCGGCCTTGACTGTG
Tyr	Forward: GGGCCCAAATTGTACAGAGA
	Reverse: ATGGGTGTTGACCCATTGTT
Tyrp1	Forward: AAGTTCAATGGCCAGGTCAG
	Reverse: TCAGTGAGGAGAGGCTGGTT
Mlana	Forward: AGACGCTCCTATGTCACTGCT
	Reverse: TCAAGGTTCTGTATCCACTTCGT

Table 3: Primer information.

Discussion

The quality of the virus is crucial for the success of direct reprogramming to melanocytes in this protocol. The method of packaging and concentrating viruses in this protocol is simple and easy to repeat and does not rely on any other auxiliary concentrated reagent. This protocol can be followed successfully in most laboratories. To ensure the quality of the concentrated virus, the following points need special attention. One is the cell status of HEK-293T. Although HEK-293T cells are immortalized cells, the cells used to make the concentrated virus must be healthy cells within 10 passages (the titer decreases with higher passages).

Another critical point is the proportion of the transfection reagent (in this case, lipofectamine) used. As cells are damaged after adding the transfection reagent, the ratio of the reagent to plasmids must be checked repeatedly to ensure the optimal condition of the cells and the quality of the virus. The 2:1 ratio of transfection reagent to plasmids is most suitable for HEK-293T cells for packaging the virus in this system. In addition, all steps require gentle handling throughout the process. As virus particles can be absorbed after coating, which affects the virus titer, it is not advisable to coat the dish with any matrix when packaging the virus. Due to the possibility of detachment of HEK-293T, the supernatant must be replaced carefully, especially when fresh medium is added after collecting the virus supernatant after 24 h. Some other considerations include cell density, the length of the transfection time, and the serum content in the medium. These are important issues that affect transfection efficiency. The conditions presented in this protocol are the most suitable, based on results obtained after many repeated experiments.

In the process of direct reprogramming to melanocytes, it is important to consider the state of the original cell MEFs and the density of MEFs used for direct reprogramming. Before starting the direct reprogramming, MEFs must be cultured in non-coated cell culture dishes. Cells in the proliferation phase (40-50% confluence) should be selected for direct reprogramming; the infection efficiency decreases with increasing cell density. The reprogrammed cells need to be plated in gelatin-coated culture dishes.

The length of time needed for the virus to infect cells is also critical; too long an infection time will impair cell survival, whereas too short an infection time will reduce the efficiency. Eight hours were found to be appropriate for the concentrated virus to infect MEFs in this protocol. The last critical point is the correct way of changing the reprogramming medium. MEFs need to adapt to a new medium. The state of the cells must be checked every day, and the medium must be changed carefully according to the cell status. Changing the reprogramming medium too quickly will cause a large number of cells to die.

When cultivating and subculturing iMels, the passage density of the cells is critical. iMels need a relatively high density to maintain growth. Cell synapses should be in contact with each other for the normal proliferation of these cells. If the density is too low, the cells may stop proliferating. Here, the density of 3 × 10⁴/cm² was found to be a suitable passage density for iMels. After 5 passages, the iMels begin aging (Figure 2B); the melanin is more mature at this time, and the resultant cells can be used for immunofluorescence, DOPA, or Masson-Fontana staining. Earlier passages of cells can be used for RT-PCR because the expression of genes will change at a relatively early stage.

Although direct reprogramming is widely studied, there is little research on the direct reprogramming of fibroblasts to melanocytes. Different studies have used different transcription factors^14,15, leading to much confusion. This protocol explains how to produce high-quality concentrated viruses and screen several transcription factors to select the most important ones for direct reprogramming to melanocytes. The medium was supplemented with nutritional factors for the direct reprogramming to melanocytes in this protocol (Table 2). Finally, functional iMels were identified successfully. The clear and optimized melanocyte direct reprogramming system could provide new treatment strategies for depigmentation diseases such as vitiligo.

However, there are still some limitations to the technology presented in this article. First, it is challenging to estimate the efficiency of this protocol. CRISPR-Cas9 gene editing could be combined with this protocol to knock in melanocytic genes, such as Tyr or Tyrp-1, into the initial cells to observe the percentage of induced cells during the reprogramming process. In addition, the lentivirus introduction system used in this protocol may carry the risk of gene recombination and insertion mutation¹⁹. In the future, more efficient and safer introduction methods could be used, such as non-viral recombinant protein expression vectors or mRNA vectors. The experiment in this protocol is still at the in vitro stage. The next step is to reprogram the melanocytes directly in vivo, causing non-pigmented skin to become pigmented and to use the direct reprogramming system to design an effective treatment of vitiligo.

Materials

Name	Company	Catalog Number	Comments
0.05% Trypsin-EDTA	Gibco	25300-062	Stored at -20 °C
0.45 μM filter	Millipore	SLHVR33RB
5 mL polystyrene round bottom tube	Falcon	352052
95%/100% ethanol	LANBAO	210106	Stored at RT
Adenine	Sigma	A2786	Stock concentration 40 mg/mL Final concentration 24 µg/mL
Alexa Fluor 555 Goat anti-Mouse IgG2a	Invitrogen	A21137	Dilution of 1:500 to use
Antibiotics(Pen/Strep)	Gibco	15140-122	Stored at -20 °C
Anti-TRP1/TYRP1 Antibody	Millipore	MABC592	Host/Isotype: Mouse IgG2a Species reactivity: Mouse/Human Dilution of 1:200 to use
Anti-TRP2/DCT Antibody	Abcam	ab74073	Host/Isotype: Rabbit IgG Species reactivity: Mouse/Human Dilution of 1:200 to use
CHIR99021	Stemgent	04-0004	Stock concentration 10 mM Final concentration 3 μM
Cholera toxin	Sigma	C8052	Stock concentration 0.3 mg/mL Final concentration 20 pM
Cy3 Goat anti-Rabbit IgG (H+L)	Jackson Immunoresearch	111-165-144	Dilution of 1:500 to use
DMEM (High glucose)	HyClone	SH30243.01	Stored at 4 °C
DMSO	Sigma	D2650	Stored at RT
FBS	Gibco	10270-106	Stored at -20 °C Heat-inactivated before use
Gelatin	Sigma	G9391	Stored at RT
GFP-PURO plasmids (Mitf, Sox10, Pax3, Sox2, Sox9 and Snai2)	Hanheng Biological Technology Co., Ltd.	pHBLPm003198 pHBLPm001143 pHBLPm002968 pHBLPm002981 pHBLPm004348 pHBLPm000325	Stored at -20 °C
Hematoxylin	Abcam	ab220365	Stored at RT
Human EDN3	American-Peptide	88-5-10A	Stock concentration 100 μM Final concentration 0.1 μM
Hydrocortisone	Sigma	H0888	Stock concentration 100 µg/mL Final concentration 0.5 µg/mL
L-DOPA	Sigma	D9628	Stored at RT
Lipofectamine 2000	Invitrogen	11668-019	Transfection reagent, stored at 4 °C
Masson-Fontana staining kit	Solarbio	G2032	Stored at 4 °C
Neutral balsam	Solarbio	G8590	Stored at 4 °C
Paraformaldehyde	Sigma	P6148	Stored at RT
PBS (-)	Gibco	C10010500BT	Stored at RT
Phorbol 12-myristate 13-acetate (TPA)	Sigma	P8139	Stock concentration 1 mM Final concentration 200 nM
Polybrene	Sigma	H9268	cationic polymeric transfection reagent; Stock concentration 8 μg/µL Final concentration 4 ng/µL
Puromycin	Gibco	A11138-03	Stored at -20 °C
Recombinant human bFGF	Invitrogen	13256-029	Stock concentration 4 μg/mL Final concentration 10 ng/mL
Recombinant human insulin	Sigma	I3536	Stock concentration 10 mg/mL Final concentration 5 µg/mL
Recombinant human SCF	R&D	255-SC-010	Stock concentration 200 μg/mL Final concentration 100 ng/mL
RPMI-1640	Gibco	11875-093	Stored at 4 °C
Xylene	Sigma	1330-20-7	Stored at RT