Helicase Activity Measurement of a Target Protein Using Biotin-Labeled RNA Duplexes

Overview

In this video, we demonstrate the procedure to determine the helicase activity of a target protein to unwind the biotin-labeled dsRNA substrate. The activity of the enzyme was identified by analyzing the electrophoretic mobility shift, followed by a chemiluminescence assay using chemiluminescent enzyme-conjugated streptavidin.

Protocol

1. Protein preparation

1. MOV10 expression constructs
   1. Generate cDNA expression constructs encoding mouse MOV10.
      1. Set up the polymerase chain reaction (PCR) reactions for each fragment. Mix 1 μL of mouse cDNA (from C57BL/6 mouse testis), 1 μL of dNTP, 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 1 μL of DNA polymerase, 25 μL of 2x PCR buffer, and 18 μL of double distilled H₂O (ddH₂O) in a final volume of 50 μL.
         NOTE: The primers for the amplification of Mov10 gene fragments are listed in Table 1.
      2. Perform PCR reactions using the following programs: 95 °C for 5 min, 35 cycles of heating at 95 °C for 15 s, annealing at 64 °C for 15 s, extension at 72 °C for 20 s (2 min for extending full-length MOV10), and final extension at 68 °C for 7 min.
   2. Analyze the amplified PCR DNA by gel electrophoresis, cut the band of the required size from the gel quickly under a UV lamp, and place it into a centrifuge tube. 
      NOTE: The expected product size visible on the agarose gel for MOV10 is 3015 bp.
   3. Purify the PCR DNA with a gel extraction kit following the manufacturer's protocol.
      1. Add an equal volume of dissolving buffer into the centrifuge tube from step 1.1.2 and melt the gel in a 50-55 °C water bath for 5-10 min, ensuring that the gel pieces melt completely. Centrifuge briefly to collect any droplets from the wall of the tube.   
         NOTE: The mass/volume concentration of the gel and the dissolving buffer is 1 mg/μL.
      2. Place the adsorption column in the collection tube, transfer the solution containing the dissolved gel fragment to the adsorption column, and centrifuge at 12,000 x g for 2 min.
      3. Discard the filtrate at the bottom of the collection tubes. Add 600 μL of the wash buffer to the column, centrifuge at 12,000 x g for 1 min, and discard the filtrate.
      4. Repeat step 1.1.3.3 once.
      5. Place the column back into the collection tube, and centrifuge at 12,000 x g for 2 min to remove all the remaining wash buffer.
      6. Place the adsorption column in a 1.5 mL sterilized centrifuge tube, add 50 μL of ddH₂O to the center of the adsorption column, and centrifuge at 12,000 x g for 1 min. Measure the DNA concentration of the eluate using a spectrophotometer.
   4. Restriction digestion of plasmids
      1. Digest the pRK5 vector with BamHI and XhoI by mixing 4 μg of pRK5 vector, 5 μL of 10x digest buffer, 1 μL of BamHI, and 1 μL of XhoI and ddH₂O to a final reaction volume of 50 μL. Incubate at 37 °C for 2 h.
   5. Analyze the vector DNA by gel electrophoresis, cut the desired size band from the gel quickly with a scalpel under a UV lamp and place it into a centrifuge tube.
   6. Purify the vector DNA with a gel extraction kit as 1.1.3 following the manufacturer's instructions.         
   7. Set up a standard recombinant ligation reaction by combining 0.03 pmol of linearized vector, 0.06 pmol of cDNA fragment, 2 μL of ligase, and 4 μL of 5x ligase buffer and ddH₂O in a final reaction volume of 10 μL.
      NOTE: Clone MOV10 into a pRK5 vector.
   8. Incubate the mixture at 37 °C for 30 min, and then cool the reaction immediately for 5 min on ice. Transform MOV10 recombinant plasmids into DH5α bacteria.
      NOTE: Verify all recombinant constructs by Sanger sequencing.
   9. Prepare glycerol stocks of bacterial cultures containing verified recombinant plasmids by adding an equal volume of 50% glycerol to liquid cultures, and storing at -80 °C.         
      NOTE: For each subsequent experiment, streak out bacteria from glycerol stocks onto a fresh agar plate and use a single colony for the expansion as described in step 1.2.
2. MOV10 protein extracts from HEK293T cells
   1. Transiently express the MOV10 proteins in cultured HEK293T cells.
      1. Prepare MOV10-pRK5 plasmid at a concentration >500 ng/μL.
      2. Seed HEK293T cells in 15 cm dishes. When the cell density reaches ~70%-90%, replace the cell culture medium with fresh Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin.
      3. For one transfection, dilute 60 μg of MOV10-pRK5 plasmid DNA in 3 mL of the reduced serum medium, then add 120 μL of the transfection enhancer reagent, and mix well.
      4. In a separate tube dilute 90 μL of the transfection reagent with 3 mL of reduced serum medium (without penicillin-streptomycin) and mix well.
      5. Add the diluted DNA to each tube of diluted transfection reagent. Incubate at room temperature for 15 min.
      6. Add the transfection mixture to the cell culture, and culture cells for ~36-48 h.
   2. After 36-48 h, collect cells from each plate in a 50 mL tube. Centrifuge at 500 x g for 5 min at 4 °C. Wash each pellet with 10 mL of ice-cold PBS, and collect cells by centrifugation at 500 x g for 5 min at 4 °C.
   3. Resuspend the pellet in 3 mL of cell lysis buffer containing complete ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail. Incubate for 30 min on ice. Centrifuge the lysate at 20,000 x g and 4 °C for 20 min.
   4. Add 100 μL of anti-FLAG magnetic beads per dish of cells in a 1.5 mL tube.
   5. Wash the magnetic beads 2x with K150 buffer (50 mM HEPES at pH 7.5, 150 mM KoAc, 1 mM DTT, 0.1% NP-40).
      1. Resuspend the magnetic beads in 1 mL of ice-cold K150 buffer.
      2. Incubate the magnetic beads for 2 min at 4 °C with gentle rotation and pellet the magnetic beads with the help of a magnet. Remove and discard the supernatant.
   6. Add the magnetic beads to the cell lysate supernatant from step 1.3.3 and incubate at 4 °C for 2 h.
   7. Wash the protein-bound magnetic beads 3x with K150 buffer, then 2x with K150 containing 250 mM NaCl, then 3x with K150 buffer as 1.3.5.
   8. Resuspend the beads in 300 μL of FLAG elution buffer (100 mM NaCl, 20 mM Tris-HCl at pH 7.5, 5 mM MgCl₂, 10% glycerol), add FLAG peptide to a final concentration of 0.5 μg/μL, and incubate with beads on a rotator at 4 °C for 1 h, then pellet the magnetic beads with the help of a magnet.
   9. Collect the supernatant which contains the eluted MOV10 proteins, determine the concentration, and store at -80 °C for future use.

2. Nucleic acid preparation

1. Purchase DNA and RNA oligonucleotides (oligos) with or without biotin labels from a suitable source. Dilute each oligo in RNase-free ddH₂O to 20 μM and keep it at -80 °C for future use.     
   NOTE: The oligo sequences of DNA/RNA substrates used in this study are listed in Table 2.
2. Prepare the following mixture for the double-stranded RNA (dsRNA) annealing reaction for MOV10 helicase activity assay: mix 60 mM N-2-hydroxyethylpiperazine-N-ethane-sulphonic acid (HEPES) at pH 7.5, 6 mM KCl, 0.2 mM MgCl₂, and RNase-free ddH₂O in a final reaction volume of 20 μL.
3. Anneal RNA oligos to form RNA duplex by heating a mixture of the biotin-labeled top strand (2 μM, final concentration) and a 1.5-fold of its unlabeled complementary bottom strand in the annealing buffer (step 2.2) at 95 °C for 5 min, and then slowly cool it to room temperature (RT).

3. In vitro biochemical assays

1. EMSA and enzymatic reactions
   1. For the MOV10 helicase activity assay, mix 50 mM Tris-HCl at pH 7.5, 20 mM KoAc, 2 mM MgCl₂, 0.01% NP-40, 1 mM DTT, 2 U/μL RNase inhibitor, 10 nM biotin-labeled RNA substrate, 2 mM adenosine triphosphate (ATP), 100 nM RNA trap, and 20 ng of MOV10 protein and ddH₂O in a final reaction volume of 20 μL. Incubate the reaction mixture at 37 °C for 10 min, 30 min, and 60 min. Add the 5x stop buffer to stop the reaction.
      NOTE: RNA trap, a biotin-unlabeled oligo with sequence, complementarity to the labeled oligo, which prevents the unwound dsRNA from annealing again.
2. Polyacrylamide gels
   1. Wash the gel plates (16 cm x 16 cm) and 1.5 mm combs. Assemble the gel electrophoresis units.
   2. To prepare a 10% native polyacrylamide gel, mix 14 mL of ddH₂O, 1.25 mL of 10x Tris-boric acid-EDTA (TBE), 8.3 mL of 30% acrylamide, 1.25 mL of 50% glycerol, 187.5 μL of 10% freshly prepared ammonium persulfate (APS), and 12.5 μL of tetramethylethylenediamine (TEMED).
   3. To prepare a 20% native polyacrylamide gel, mix 5.5 mL of ddH₂O, 1.25 mL of 10x TBE, 1.25 mL of 50% glycerol, 16.7 mL of 30% acrylamide, 187.5 μL of 10% APS, and 12.5 μL of TEMED.
   4. Pour the acrylamide solution immediately into the gel and insert the comb. Let the mixture polymerize for approximately 30 min.
3. Gel running
   1. Remove the comb, and fill the tanks with the electrophoresis running buffer (0.5x TBE).
   2. Rinse the sample wells with 0.5x TBE buffer, then pre-run the gel at 100 V on ice for 30 min. Replace the running buffer with fresh 0.5x TBE.
   3. Load 20-25 μL samples into each well.
   4. Use a 10% native acrylamide gel for the EMSA assay and a 20% native acrylamide gel for the enzymatic assays. Run electrophoresis at 100 V on the ice bath until the bromophenol blue marker has migrated to the bottom quarter of the gel. 
4. Disassemble the gel plates, and trim the gel by removing loading wells and unused lanes. Place the gel in 0.5x TBE buffer.
5. Cut the filter paper and the nylon membrane to the size of the gel. Pre-wet the clean filter paper and the nylon membrane.
6. Assemble the stack for transfer.
   1. Place the pre-wet membrane onto the pre-wet filter paper.
   2. Place the gel on the membrane.
   3. Cover the gel with another layer of pre-wet filter paper.
   4. Remove all air bubbles by rolling a clean pipette from center to edge.
7. Transfer the samples from the gel to the membrane in a semi-dry electrophoretic apparatus at 90 mA for 20 min.
8. Stop the transfer, and then dry the membrane on a new filter paper for 1 min.
9. Crosslink the samples by irradiating the membrane at 120 mJ/cm² for 45-60 s in a UV-light crosslinker equipped with 254 nm bulbs (auto crosslink function). Air dry the membrane at RT for 30 min.
10. Chemiluminescence detection
    1. Protocol 1: Use a standard volume of commercial chemiluminescent nucleic acid detection kit.
       1. Add 20 mL of blocking buffer to the membrane and incubate for 15-30 min with gentle shaking on a rotator at 20-25 rpm.
       2. Prepare conjugate/blocking buffer solution by adding 66.7 μL stabilized streptavidin-horseradish peroxidase conjugate to 20 mL of blocking buffer.
       3. Gently remove the blocking buffer and replace it with conjugate/blocking buffer. Incubate for 15 min on a rotator at 20-25 rpm.
       4. Wash the membrane 4x with shaking at 40-45 rpm for 5 min each.
       5. Add 30 mL of substrate equilibration buffer to the membrane. Incubate the membrane for 5 min with shaking at 20-25 rpm.
       6. Prepare substrate working solution by adding 6 mL of luminol/enhancer solution to 6 mL of stable peroxide solution. Avoid light. 
       7. Cover the entire surface of the membrane with substrate working solution and incubate for 5 min.
       8. Scan the membrane in a chemiluminescent imaging system for 1-3 s.

Table 1: Primers used to PCR amplify the gene fragments of Meiob and Mov10. The bold letters in forward and reverse primers are BamHI and NotI cutting sites; the italic bold letters in a reverse primer are XhoI cutting sites; the bold letters in boxes indicate the nucleotides corresponding to the point mutation R235A.

Fragments	Primers	Sequences (from 5’ to 3’)
MEIOB-A	forward	CGGGATCCATGTTACTTTCTTTGATACACTTGCC
	reverse	ATGCGGCCGCTACTTTTAGCTGTTCCACTG
MEIOB-C	forward	CCGCGTGGATCCATGGAACCAAAATACTTTACAACTTCA
	reverse	CGATGCGGCCGCCTCTTTATTTTCTCTTATATAATTCAGTAG
MEIOB-E	forward	CCGCGTGGATCCATGTTACTTTCTTTGATACACTTGCC
	reverse	CGATGCGGCCGCTACTTTTAGCTGTTCCACTG
MEIOB-E-mut	forward	CTCTGATGTGGCAATAAATTTTAAC
	reverse	GTTAAAATTTATTGCCACATCAGAG
MOV10	forward	GACGACGATGACAAGGGATCCATGCCTAGCAAGTTCAGCTGCC
	reverse	GCTTACTCAGCTAAGCTCGAGTCAGAGCTCATTTCTCCACTCTG

Table 2: Sequences of DNA/RNA substrates used in this work.

For figures	Names	Sequences (From 5' to 3')
Figure 2, 5	36 nt ssDNA	5'-Biotin-GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT-3' (DNA)
Figure 3	36 nt ssRNA	5'-Biotin-GUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU-3' (RNA)
Figure 4	54 nt 5'-tailed dsRNA	5'-Biotin-ACCGCUGCCGUCGCUCCG-3' (RNA) 5'-ACGAGGGAGACGAGGAGACGGAGCGACGGCAGCGGU-3'(RNA)

Materials

Name	Company	Catalog Number	Comments
Equipment
Centrifuge	Eppendorf, Germany	5242R
Chemiluminescent Imaging System	Tanon, China	5200
Digital sonifer	Branson, USA	BBV12081048A	450 Watts; 50/60 HZ
Semi-dry electrophoretic blotter	Hoefer, USA	TE77XP
Tube Revolver	Crystal, USA	3406051
UV-light cross-linker	UVP, USA	CL-1000
Materials
Nylon membrane	Thermo Scientific, USA	TG263940A
TC-treated Culture Dish	Corning, USA	430167	100 mm
TC-treated Culture Dish	Corning, USA	430597	150 mm
Microtubes tubes	AXYGEN, USA	MCT-150-C	1.5 mL
Tubes	Corning, USA	430791	15 mL
Reagents
Anti-FLAG M2 magnetic beads	Sigma, USA	M8823
ATP	Thermo Scientific, USA	591136
BCIP/NBT Alkaline Phosphatase Color Development Kit	Beyotime, China	C3206
CelLyticTM M Cell Lysis Reagent	Sigma, USA	107M4071V
ClonExpress II one step cloning kit	Vazyme, China	C112
Chemiluminescent Nucleic Acid Detection Kit	Thermo Scientific, USA	T1269950
dNTP	Sigma-Aldrich, USA	DNTP100-1KT
DMEM	Gibco, USA	10569044
EDTA	Invitrogen, USA	AM9260G	0.5 M
EDTA-free protease inhibitor cocktail	Roche, USA	4693132001
EndoFree Maxi Plasmid Kit	Vazyme, China	DC202
FastPure Gel DNA Extraction Mini Kit	Vazyme, China	DC301-01
FBS	Gibco, USA	10437028
FLAG peptide	Sigma, USA	F4799
Glycerol	Sigma, USA	SHBK3676
HEPES buffer	Sigma, USA	SLBZ2837	1 M
KOAc	Sangon Biotech, China	127-08-02
MgCl2	Invitrogen, USA	AM9530G	1 M
NaCl	Invitrogen, USA	AM9759	5M
NP-40	Amresco, USA	M158-500ML
Opti-MEM medium	Gibco, USA	31985062
PBS	Gibco, USA	10010023	pH 7.4
RNase Inhibitor	Promega, USA	N251B
Streptavidin alkaline phosphatase	Promega, USA	V5591
TBE	Invitrogen, USA	15581044
Tris-HCI Buffer	Invitrogen, USA	15567027	1 M, pH 7.4
Tris-HCI Buffer	Invitrogen, USA	15568025	1 M, pH 8.0
Tween-20	Sangon Biotech, China	A600560