RNA-Protein Pull-Down Assay to Isolate RNA-Binding Proteins via Affinity Extraction

Overview

This video demonstrates an in vitro RNA pull-down assay to identify RNA-binding proteins (RBPs), which interact with the adenylate-uridylate-rich element (ARE) sequences in mRNA. The target RBPs from a cell lysate are mixed with an RNA probe to form RNA-protein complexes. The complexes are isolated via affinity purification utilizing the affinity of the desthiobiotin label of the RNA probe to a streptavidin-labeled magnetic bead.

Protocol

1. Preparation of Cytosolic and Nuclear Protein Fraction

1. Plate 4 x 10⁶ ACC-MESO-4 cells in a T150 cell culture flask grown in RPMI - 1640 medium supplemented with 10% FBS, 1x penicillin/streptomycin (100x), and 2 mM L-Glutamine (200 mM). When cells reach a confluence of 80-90% (~5-5.5 x 10⁶ cells), proceed with protein extraction of nuclear and cytosolic fractions.
   NOTE: ACC-MESO-4 cell line was obtained from the RIKEN BioResource Centre.
2. Aspirate medium, wash the cells by adding 15 mL of 1x PBS, tilt the plate gently a few times, and aspirate the 1x PBS. Add 3 mL of 0.25% Trypsin-EDTA and incubate the culture flask at 37 °C for 3 min.
   NOTE: Look at the cells under the microscope for detachment; if still attached tap the flask against the palm of a hand 3 times.
3. Add 7 mL of RPMI-1640 medium supplemented with 10% FBS, 1x penicillin/streptomycin (100x), and 2 mM L-Glutamine (200 mM), collect the cells in a 15 mL tube, and spin down at 200 x g for 5 min.
4. Aspirate medium and resuspend the cell pellet with 1.5 mL of 1x PBS, then transfer the cells into a 1.5 mL microcentrifuge tube. Spin down at 500 x g and 4 °C for 5 min. Discard the supernatant.
   NOTE: From this step onwards, perform all centrifugation steps at 4 °C and keep all reagents on ice.
5. Resuspend the cell pellet with ice-cold 1.5 mL of 1x PBS and spin down the cells at 500 x g and 4 °C for 3 min. Discard the supernatant.
   NOTE: The required amounts of CER I, CER II, and NER reagents are 10, 0.55, and 5 volumes of estimated cell pellet packed volume, respectively; the following protocol assumes a volume of 20 µL. We recommend preparing only the required amount of reagent CER I.
6. Add 200 µL of ice-cold cytoplasmic extraction reagent (CER I) supplemented with 2 µL of 1x proteinase inhibitor, e.g., dilute 1 tablet of Protease Inhibitor (EDTA-free) in 500 µL of water to obtain 100x stock. This amount of reagent CER I is enough to lyse 20 µL of a cell pellet-packed volume.
   1. To estimate the cell pellet packed volume, compare the tube containing the cell pellet with a 1.5 mL tube filled with 10, 20, 50, or 100 µL of 1x PBS.
7. Resuspend the cell pellet by vigorously vortexing the tube for 15 s and incubate the tube on ice for 10 min. Add 11 µL of ice-cold cytoplasmic extraction reagent II (CER II) to the tube, vigorously vortex for 5 s, and incubate for 1 min on ice.
8. Vortex vigorously for 5 s and centrifuge the tube at 16,000 x g and 4 °C for 5 min. Transfer the supernatant to the clean pre-chilled tube on ice. The supernatant is the cytoplasmic fraction that is further used in the RNA-pulldown experiment.
9. Resuspend the remaining pellet in 100 µL of ice-cold nuclear extraction reagent (NER) supplemented with 1 µL of proteinase inhibitor (100x) and vigorously vortex for 15 s. We recommend preparing only the required amount of NER reagent supplemented with protease inhibitors.
10. Incubate the sample on ice for 40 min with occasional vortexing for 15 s (every 10 min).
11. Centrifuge the tube at 16,000 x g for 10 min. Transfer the supernatant (this is the nuclear protein fraction) to a clean pre-chilled tube.
12. Immediately proceed by measuring protein concentration using the bicinchoninic (BCA) method (see Table of Materials).To control for protein purity of each fraction, perform immunoblotting (Figure 1) against α-tubulin (positive detection only in the cytosolic fraction) and Poly ADP-ribose polymerase - PARP (positive detection only in the nuclear fraction).
13. In order to keep protein activity and their native state, prepare 25 µL of aliquots of cytosolic and nuclear extracts. Snap-freeze these aliquots by placing them in liquid nitrogen for 5 s and store directly at -80 °C.

2. Labeling of RNA with Desthiobiotin

1. Have RNA probes commercially synthesized and HPLC purified. Resuspend with nuclease-free water at 10 µM.
   NOTE: Probe sequences are listed in Table 1.
2. Use 50 pmol of RNA per RNA-pulldown reaction. Thaw and keep all reagents on ice except for PEG 30%, used to label the 3' terminus of RNA oligo.
3. Transfer 5 µL of 10 µM RNA probes, labeled as CALB2 3' UTR (ARE), CALB2 3' UTR (mtARE), and Unrelated-RNA (IRE), into 0.5 mL thin-wall microcentrifuge tubes and incubate in a PCR machine at 85 °C for 5 min. Place the tubes immediately on ice.
   NOTE: This step is important, as it promotes the relaxation and accessibility of the RNA probe for labeling.
4. For a single 30 µL reaction, add to the RNA-containing tube the following 10 µL mix: 3 µL of nuclease-free water, 3 µL of 10x RNA Ligase Reaction Buffer, 1 µL of RNase Inhibitor (40 U/µL), 1 µL of Desthiobiotinylated Cytidine Bisphosphate (1 mM), and 2 µL of T4 RNA ligase (20 U/µL).
   NOTE: To prepare a master mix A for 3 samples in excess (3.2), mix 9.6 µL of nuclease-free water, 9.6 µL of 10x RNA Ligase Reaction Buffer, 3.2 µL of RNase Inhibitor (40 U/µL), 3.2 µL of Desthiobiotinylated Cytidine Bisphosphate (1 mM), and 6.4 µL of T4 RNA ligase (20 U/µL).
5. Add carefully 15 µL of PEG 30% to the reaction. Use another tip to mix the reaction. Incubate the reaction overnight at 16 °C.
6. The next day, prepare the following: 5 M NaCl (fresh/nuclease-free), chloroform: isoamyl alcohol in 24:1 ratio (e.g., per reaction - 96 µL chloroform and 4 µL of isoamyl alcohol), ice-cold 100% ethanol, and ice-cold 70% ethanol.
7. Add 70 µL of nuclease-free water to the RNA-labeling reaction tubes. Add 100 µL of chloroform: isoamyl alcohol and vortex briefly. Spin-down at 13,000 x g for 3 min. Carefully remove ONLY the upper phase and transfer to a new nuclease-free 1.5 mL tube; avoid touching the lower phase.
8. Add 10 µL of 5 M NaCl, 1 µL of glycogen, and 300 µL of ice-cold 100% ethanol. Place the tube at -20 °C for 2 h.
   NOTE: At this step, the experiment can be continued on the following day.
9. Centrifuge at 13,000 x g and 4 °C for 15 min. Carefully discard the supernatant without disturbing the pellet. Add 300 µL of ice-cold 70% ethanol and centrifuge again at 13,000 x g and 4 °C for 5 min.
10. Discard the supernatant completely and air-dry the pellet (15 min). Resuspend the pellet in 20 µL of nuclease-free water.
    NOTE: Proceed with RNA pulldown on the same day.
11. Incubate the RNA at 90 °C for 2 min and place it on ice. Place the labeled RNA on the ice during the following step of pre-washing of the streptavidin magnetic beads.
    NOTE: A longer incubation time may damage the RNA probe.

3. RNA-Protein Pulldown

1. Pre-washing streptavidin-magnetic beads and incubation with desthiobiotin-RNA
   1. Use 50 µL of streptavidin magnetic beads per 50 pmol RNA. However, this should be optimized depending on the experiment.
   2. Vortex the tube with streptavidin-magnetic beads for 15 s, and quickly remove 200 µL (master mix; enough for 3+1 reactions) into a clean 1.5 mL safe-lock tube using cut pipette tips. Place the tube on a magnetic stand so that the beads collect at the side of the tube and wait 1 min. Remove the resuspension liquid.
   3. To wash the beads, remove the tube from the magnetic stand, add 400 µL of 0.1 M NaOH, and 0.05 M NaCl solution, and gently pipet up and down several times. Place the tube back on the magnetic stand. Wait 1 min and collect the supernatant. Repeat this step again.
   4. Wash the beads with 200 µL of 100 mM NaCl. Remove the supernatant.
   5. Add 200 µL of 20 mM Tris (pH 7.5), resuspend beads by pipetting, place the tube on the magnetic stand, wait for 1 min, and remove the supernatant. Repeat the step.
   6. Remove the tube from the magnetic stand, add 200 µL of 1x RNA Capture buffer, and resuspend streptavidin magnetic beads by briefly vortexing. Remove 50 µL of streptavidin magnetic beads and add to each labeled RNA tube using a cut pipette tip. Incubate the tubes for 30 min at room temperature on a roller.
2. Binding of the protein to RNA
   1. Place the tubes into a magnetic stand, wait 1 min, and remove the supernatant.
   2. Add 50 µL of 20 mM Tris (pH 7.5) to the beads and resuspend by pipetting. Place the tubes into a magnetic stand, wait 1 min, and remove the supernatant. Repeat this step.
   3. Add 100 µL of 1x Protein-RNA binding buffer to the beads and resuspend by pipetting.
   4. In the meantime, prepare the following mix: 10 µL of 10x Protein-RNA binding buffer, 30 µL of 50% glycerol, 50 µg of cytoplasmic proteins, and nuclease-free water up to 100 µL.
      NOTE: Prepare a master mix B for 3 samples in excess (3.3) as follows: 33 µL of 10x Protein-RNA binding buffer, 99 µL of 50% glycerol, 165 µg of cytoplasmic proteins and nuclease-free water up to 330 µL. Keep the tube of master mix B on ice.
   5. Place the tubes into the magnetic stand, wait 1 min, and collect the supernatant. Add 100 µL of master mix B, resuspend by gently pipetting up and down, and avoid creating bubbles. Incubate reaction tubes for 60 min at 4 °C on a roller.
3. Washing and elution
   1. Place the tubes into a magnetic stand, collect the supernatant (which is flow through - FT), and transfer it into a new tube.
      NOTE: Keep this FT on ice for later analysis.
   2. Pipette 100 µL of 1x Wash buffer on the beads, resuspend gently, put back into the magnetic stand, wait 1 min, and discard the supernatant. Repeat this step 2 times.
   3. Add 40 µL of Elution Buffer to the magnetic beads, mix by pipetting up and down, and incubate at 37 °C on a tube shaker (950 rpm) for 30 min.
   4. Place the tubes into a magnetic stand, wait 1 min, and collect the eluted sample (which is eluate - E). Place on ice and use for downstream analysis.
      NOTE: At this step, each tested RNA probe consists of a flow-through (FT) and eluate (E) sample.

Representative Results

Figure 1: Western blot analysis of 5 µg of cytosolic and nuclear protein fraction. PARP protein is present in the nuclear fraction (N) but absent from the cytosolic (C) fraction. α-tubulin is present in the cytosolic fraction (C) but absent in the nuclear fraction (N).

Table 1: Sequences of RNA probes

RNA probe	Sequence	Concentration
CALB2 3' UTR (ARE) 25nt	UCGCUGUAUGAUUUAGGCUUCUAUG	10 µM
CALB2 3' UTR (mtARE) 25nt	UCGCUGUAUGGUCUGGGCUUCUAUG	10 µM
Unrelated RNA - IRE 28nt	UCCUGCUUCAACAGUGCUUGGACGGAAC	10 µM

Materials

Name	Company	Catalog Number	Comments
NE-PER Nuclear and cytoplasmic extraction kit	Thermo Fisher Scientific	78833
Pierce Protease Inhibitor Tablets, EDTA-free	Thermo Fisher Scientific	A32965
Pierce BCA Protein Assay Kit	Thermo Fisher Scientific	23225
Pierce Magnetic RNA-protein Pull-Down Kit	Thermo Fisher Scientific	20164	Includes magnetic beads and therefore the kit need to be stored at 4 °C
Pierce RNA 3’ End Desthiobiotinylation Kit	Thermo Fisher Scientific	20163	The kit is a part of the "Pierce Magnetic RNA-protein Pull-Down Kit", and needs to be stored at -20 °C unlike the pull-down kit (4 °C).
DynaMag-2, magnetic stand	Thermo Fisher Scientific	12321D
RPMI - 1640 medium	Sigma-Aldrich	R8758
FBS - Filtrated Bovine Serum	Pan Biotech	P40-37500
Penicillin - streptomycin (100x)	Sigma-Aldrich	P4333
L-Glutamine solution (200 mM)	Sigma-Aldrich	G7513
0.25% Trypsin-EDTA (1x)	Gibco by Life technologies	25200-056
RNaseZap RNase Decontamination Solution	Thermo Fisher Scientific	AM9780
RNA oligo synthesis	Mycrosynth AG, Switzerland	-	The synthesis scale - 0.04 µmol - HPLC-purified
Bovine serum albumin	Sigma-Aldrich	A7030
Hydrochloric Acid (HCl) 6 M	PanReac AppliChem	182883.1211
Ultra Pure 1 M Tris, pH 7.5	Thermo Fisher Scientific	15567027
Glycerol	Thermo Fisher Scientific	17904	50% sterile aliquots to be stored at -20°C
Pierce Streptavidin magnetic beads	Thermo Fisher Scientific	88817	Please note that these magnetic beads have an average diameter of 1 µm (range from 0.5 - 1.5 µm). Furthermore, Dynabeads-M280 Streptavidin, which are beads of homogenouse size 2.8 µm, are also used in RNA-pulldown but be aware that this may affect purification process.
Aluminiumsulfate-(14-18)-hydrate	Sigma-Aldrich	368458
Ortho-phosphoric acid	Applichem	A0637