Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

وPCR لتحديد Allelotyping السالمونيلا enterica serovars الملهبة ، الهدار ، هايدلبرغ ، والتيفية الفأرية

doi: 10.3791/3130 Published: July 22, 2011

Summary

نحن تصف PCR متعددة للكشف السريع لserovars السالمونيلا الملهبة enterica ، الهدار ، هايدلبرغ ، والتيفية الفأرية. يمكن التعرف على السالمونيلا serovars محددة من خلال استهداف متعددة PCR لتسلسل الجينات وفريدة من نوعها إلى الكتلة الحيوي O - مستضد وفلاجيلين لضرب مصلي معين. يتم تعيين ضرب مصلي ثم إلى عزل السالمونيلا استنادا إلى مظهر معين amplicons الحجم ، (PCR المنتج) المقابلة لأليل الهدف.

Abstract

تقارير إتمام المشروعات التجارية الحالية اختبارات لتحديد الجينات المستهدفة السالمونيلا فريدة من نوعها لهذا جنس. ومع ذلك ، هناك اثنين من الأنواع والسلالات الست ، وأكثر من 2500 serovars السالمونيلا مختلفة ، وليست جميعها متساوية في أهميتها على الصحة العامة. على سبيل المثال ، وإيجاد س. enterica السلالات الثالث ألف أريزونا على طبقة البيض مزرعة الجدول غير ذات أهمية بالمقارنة مع عزلة س. enterica السلالات الأول ضرب مصلي الملهبة ، والسبب الرئيسي لداء السلمونيلات مرتبطة استهلاك بيض المائدة. ويتم تحديد Serovars على أساس الاختلافات في مستضدي lipopolysaccharide (LPS) (O مستضد) وفلاجيلين (H1 و H2 المستضدات). هذه الاختلافات هي مستضدي المظهر الخارجي للتنوع الجينات والأليلات الجينات المرتبطة بهذا النمط الظاهري.

طورنا allelotyping ، PCR أن مفاتيح متعددة على الاختلافات الجينية بين أربعة S. الرئيسية enterica السلالة serovars أنا وجدت في الدواجن والمرتبطة بأمراض بشرية كبيرة في الولايات المتحدة. واستهدفت أزواج التمهيدي PCR لتسلسل الجينات الرئيسية أو فريدة من نوعها لضرب مصلي السالمونيلا محددة ومصممة لإنتاج amplicon مع حجم معين لهذا الجين أو أليل. السالمونيلا ضرب مصلي تم تعيينه لعزل استند في على الجمع بين نتائج اختبار PCR محددة لLPS والأليلات فلاجيلين الجينات. في تقارير إتمام المشروعات متعددة الموصوفة في هذه المقالة هي محددة للكشف عن س. enterica السلالة أنا serovars الملهبة ، الهدار ، هايدلبرغ ، والتيفية الفأرية.

نحن هنا لشرح كيفية استخدام تقارير إتمام المشروعات متعددة لتحديد ضرب مصلي لعزل السالمونيلا.

Protocol

1. إعداد قالب PCR

ملاحظة : من أجل تقليل التلوث المرحل PCR ، فمن المهم للحفاظ على عدة خطوات رئيسية هامة في PCR جسديا منفصلة عن بعضها البعض : 1) إعداد (DNA) القالب ، 2) PCR الإعداد ، و 3) هلام إستشراد. ويوصى أيضا لاستخدام حاجز نصائح من أجل منع أو الثقافة أو كاشف تلوث pipetters.

  1. تلقيح 1 مل من مرق لوريا Bertani أو متوسطة المعقدة الأخرى (تسريب الدماغ والقلب ، Superbroth ، الخ) مع عزل السالمونيلا من مستعمرة معزولة واحدة. احتضان الثقافة بين عشية وضحاها في 37 درجة مئوية.
  2. نقل 1 مل إلى العقيمة ، أنبوب 1.5 مل microfuge القدرات ، ووقف الطرد المركزي في الخلية البكتيرية 4500 x ج لمدة 2 دقيقة ~. إلى خلايا بيليه.
  3. صب طاف ، resuspend الكرية خلية في 1 مل من الإيثانول بنسبة 100 ٪ والتي وضعت في درجة حرارة الغرفة لمدة 10 دقيقة. كما كان من قبل الخلايا بيليه (4500 x ج ، 2 دقيقة) ، وإزالة الخلايا وطاف في برنامج تلفزيوني resuspend 1 مل.
  4. خلايا جهاز الطرد المركزي (4500 x ج ، 2 دقيقة) ، والتخلص من الخلايا طاف resuspend في 1 مل من العقيمة O. 2 درهم
  5. تمييع تعليق خلية النهائي 20/01 في DH 2 O (5 μl/95 ميكرولتر درهم 2 O) وتخزينها في -20 درجة مئوية. العمر الافتراضي للخلايا كله كقالب PCR -20 درجة مئوية في حوالي شهر واحد.

2. PCR الإعداد

ملاحظة : إعداد وصرفها من مزيج تفاعل PCR (القالب ، مخازن ، oligonucletoideprimers ، النيوكليوتيدات وطق بوليميريز الحمض النووي) يحتاج إلى أن يكون أداؤها في غرفة منفصلة مخصصة جسديا ويفضل أن يكون عمله في محطة PCR / الأشعة فوق البنفسجية.

ملاحظة : تعيين PCR تصل الغرفة يجب أيضا أن تكون مكتفية ذاتيا مع المجمد -20 درجة مئوية معينة لتخزين الكواشف PCR (مخازن والشعائل قليل النوكليوتيد ، والنيوكليوتيدات) ، والانزيمات والقالب ، pipetter مخصصة لإعداد مجموعة PCR ، المتاح القفازات المطاطية والمختبر ومعطف ، نصائح الحاجز ، لوحات microtiter والزجاج الشعيرات الدموية ، وأنابيب microfuge ، والتبييض 10 ٪ لتطهير الأسطح. استخدام مجموعة pipetter مخصص (P10 ، P100 ، وP1000) إلى الاستغناء الكواشف PCR. هذا يجب أن لا تترك مجموعة ماصة للانشاء محطة.

ملاحظة : الحصول على البيولوجيا الجزيئية أو PCR الصف درهم O 2 و 1 مل قسامة إلى 1.5 مل أنابيب الطرد المركزي القدرات. الاستغناء aliquoted درهم 2 O بعد كل استعمال لتجنب احتمال التلوث عبر. ويوصى باتباع نهج مماثل مع PCR الكواشف الأخرى.

ملاحظة : تطهير منطقة العمل قبل استعماله مع الإضاءة فوق البنفسجية و / أو مسح أسفل الأسطح مع التبييض 10 ٪. ارتداء معطف المختبر وقفازات مطاطية في أداء PCR الإعداد. تقليل حركة المرور ذهابا وإيابا من PCR - تعيين ما يصل إلى المناطق التي حضنت ردود الفعل PCR في thermocylcer والمنتجات PCR (amplicons) يتم فصل المواد الهلامية على agarose. إذا كنت أعود إلى منطقة انشاء PCR ، والتخلص من زوج من القفازات المطاطية كنت ترتدي في الوقت الراهن ووضع على زوج جديد من القفازات.

  1. جعل الأسهم التمهيدي الماجستير في DH 2 س إلى تركيز 5x10 م -4 تمييع الاشعال 20/01 في DH 2 O (5 μl/95 ميكرولتر درهم 2 س و 25 ميكرومتر). يوصف تسلسل قليل النوكليوتيد لكل التمهيدي كتابة فلاجيلين في الجدول 1.
  2. استرداد PCR الكواشف والقالب من الثلاجة -20 درجة مئوية ، والسماح الكواشف والعينات إلى ذوبان الجليد من على الثلج. ترك الحمض النووي بوليميريز طق في الثلاجة لحين الحاجة إليها.
  3. الكواشف الاستغناء عن مزيج allelotyping تفاعل PCR كما هو موضح في الجدول رقم 1.
  4. الاستغناء 9μl من مزيج تفاعل PCR في كل من 10 بئرا في الجولة أسفل عقيمة ، 96 - جيدا ، لوحة البوليسترين microtiter ، بدءا من الجزء العلوي من العمود (على سبيل المثال A1) وتتحرك إلى أسفل العمود إلى أعلى المقبل.
  5. إضافة 1 ميكرولتر من 2 O درهم إلى 9 من مزيج ميكرولتر PCR (أي سيطرة DNA) إلى البئر الأولى (A1) ، 0.5μl من القوالب السيطرة الايجابية (ط / ز ، ط ، التيفية الفأرية كتابة الاشعال والملهبة ؛ r/z10 كتابة الاشعال هايدلبرغ وهدار ، و1،2 / ه ، ن ، س ، التيفية الفأرية كتابة الاشعال وهدار) إلى 9 ميكرولتر من مزيج PCR في الثانية 2 جيدا (B1) ، و 1 ميكرولتر من القولونية K12 DH5α إلى 9 مل من مزيج PCR في البئر الثالثة (C1).
  6. لكل بئر إضافية (D1 - H1 ، A2 ، B2) ، إضافة 1 ميكرولتر من قالب نموذج لإذابة ميكرولتر 9 من مزيج تفاعل PCR. لS. ط / ز ، م allelotyping PCR ، enterica ضرب مصلي التيفية الفأرية (ط) و الملهبة (ز ، م) بمثابة الضوابط الإيجابية ، والسالمونيلا serovars هايدلبرغ (ص) وهدار (Z10) هي الضوابط الإيجابية للص / ض 10 allelotyping PCR متعددة.
  7. 10 ميكرولتر مكان القدرة الزجاج في الشعيرات الدموية أصحاب المخصصة للتكنولوجيا Rapidcycler ايداهو (8).
  8. مرة واحدة في المضمون حامل ، وتحميل كل الزجاج مع مزيج شعري تفاعل PCR عن طريق لمس شعري لقاع الآبار من لوحة microtiter. إمالة حامل للسماح للتحرك السائل أسفل أنبوب وتوفير المساحة بين طرفي والمزيج PCR الحرارة قبل اغلاق أنابيب زجاجية مع الشعلة البوتان لختم كلا طرفي من الشعيرات الدموية.
  9. مكان الأنابيب الشعرية وحامل في ولاية ايداهو Rapidcycler التكنولوجيا واستخدام برامج thermocycler وصفها في الجدول (1) لالاشعال allelotyping مختلفة لتشغيل PCR.
  10. انتقل إلى الخطوة هلام إستشراد عند اكتمال برنامج thermocycler.

3. هلام إستشراد

ملاحظة : ارتداء معطف المختبر المختلفة المخصصة لاستخدامها في المختبر الكهربائي وزوج جديد من القفازات مطاطيا.

ملاحظة : ملابس فوق البنفسجية نظارات واقية أو درع العين الوجه وكانوا دائما القفازات عند التعامل مع إيثيديوم بروميد ، وخصوصا المواد الهلامية agarose.

  1. تحضير 100 مل المنصهر 1.5 ٪ (W / V) البيولوجيا الجزيئية في الصف agarose 1xTAE (أو 1X TBE) العازلة الكهربائي (7) عن طريق التسخين مرارا تعليق agarose في الميكروويف وضعت في السلطة 20 ٪ لفترات دقيقة 2-5 مع البصرية الدوري التفتيش. تعيين agarose المنصهر في حمام الماء 60 درجة مئوية حتى equilibrates إلى درجة حرارة حمام الماء.
  2. إعداد العفن هلام مع المشط قبل صب agarose المنصهر. اختيار مشط بأسنان هلام كافية لانتاج ما يكفي من الآبار لضوابط ، والعينات ، وعلى الأقل 3 معايير الوزن الجزيئي للمواضع لها في نهايات ووسط agarose هلام.
  3. إضافة 2 ميكرولتر من بروميد إيثيديوم (10 ملغ / مل) إلى 100 مل من المنصهر 1.5 ٪ (W / V) في agarose 1xTAE (أو TBE) ، زجاجة دوامة بلطف لمزج وتجنب فقاعات المنتجة ، وتصب بلطف محتويات الزجاجة في منتصف القالب الجل لمدة 15 بمقدار 10 سم agarose هلام. استخدام حافة المناديل الورقية أو منشفة ورقية لإزالة أي فقاعات في agarose هلام.
  4. السماح لمجموعة هلام العفن في درجة حرارة الغرفة حتى يتصلب agarose (~ 30-45 دقيقة). نقل علبة هلام مع الجل ومشط للالغاطسة ، والأفقية التي تحتوي على غرفة الكهربائي 1X TAE (أو 1X TBE) العازلة الكهربائي. إزالة بلطف المشط من الجل agarose.
  5. الاختيار وضع علبة هلام النسبي إلى الكاثود أو القطب الموجب للغرفة الكهربائي للتأكد من هذا القطب هو في الجزء السفلي من هلام. ملاحظة : تذكر الحمض النووي سالبة الشحنة بترحيل نحو القطب السالب (أي "تشغيل إلى الأحمر").
  6. بريميكس 200 ميكرولتر من علامات الحمض النووي الوزن الجزيئي (0.25 ميكروغرام / ميكرولتر) مع 40 ميكرولتر من الحمض النووي صبغ 6X تحميل. تحميل 4.8 ميكرولتر من الحمض النووي الجزيئية خلط الوزن ماركر الرابع عشر للآبار ، أولا المتوسطة والأخيرة.
  7. تحميل كل من العينات بدءا من 2 PCR جيدا وتقدم على كل بئر لاحقة ، والانتقال من اليسار إلى اليمين. تجنب تحميل العينة في أي من الآبار التي تحتوي على معيار الوزن الجزيئي.
  8. لتحميل العينات الواردة في كل من الزجاج الشعرية :
    1. إزالة كل شعيرة من حامله وحفر طرفي الشعرية مع قطع الزجاج.
    2. مكان الابهام والسبابة من كلتا اليدين على جانبي الشعرية التي تميزت قطع الزجاج واطبق الشعرية.
    3. مكان العبوة الشعرية على الطرف المقابل من مزيج تفاعل PCR وتتحول ببطء في اتجاه عقارب الساعة حتى المكبس السائل في الجزء السفلي للغاية من الأنبوب.
    4. ضع الشعرية في البئر إلى أن يتم تحميل وتشغيل المكبس ببطء في اتجاه عقارب الساعة في صرف عينة Ficoll المرجحة في agarose جيدا. يجب الحرص على عدم ثقب البئر مع شعري أو إدخال فقاعة الهواء إلى البئر التي تحول الكثير جدا في الماضي عندما كان آخر من يترك السائل الشعرية.
  9. حالما يتم تحميل جميع العينات والمعايير ، وضبط الجهد المستمر لامدادات الطاقة الى 90 V (9 فولت / سم agarose هلام).
  10. وقف الكهربائي مرة واحدة في صبغ أصفر (Taurazine) من الأمام هو 1 سم من الجزء السفلي من هلام.
  11. بمجرد اكتمال الكهربائي ، ونقل إلى الجل transilluminator الأشعة فوق البنفسجية لتصور شظايا من الحمض النووي والجزيئي معيار الوزن. التقاط الصورة على فيلم باستخدام كاميرا بولارويد بولارويد مع البرتقال الزجاج تصفية (الإعدادات : 2 س ، و ص 4،5) أو على شكل صورة رقمية باستخدام كاميرا CCD والصورة المطبوعة مع طابعة حرارية.
  12. مكان أصحاب الشعرية في المبيض بنسبة 10 ٪ عن 15-30 دقيقة. شطف 3 مرات مع DH 2 O والمكان مرة أخرى في غرفة الإعداد PCR في الهواء الجاف.

4. ممثل ملتيبليكس نتائج PCR

النتائج لPCR allelotyping من السالمونيلا المعزولة تظهر في الشكل 1-10 1 (الممرات 3-12) وتفسيرها على النحو التالي. يتم إعطاء تسمية أليل O لعزل السالمونيلا استنادا amplicon (PCR المنتج) مطابقة في حجمها للسيطرة PCR وكما تنبأ عن التمهيدي يا أليل تستخدم مجموعات (3) : B - 560bp ، C1 - 340bp ، C2 - 400 سنة مضت ، D1 - 620 سنة مضت ، وغليان E1 - 280. لالعزلات المختبرة مع PCR allelotyping O (الشكل 1A) ، ونحن تعيين O الأليلات ب (الحارات 10 --13) ، C1 (الممرات 7-9) ، C2 (حارات 4 ، 5) ، D1 (حارة 3) ، وE1 (حارة 6) لعزل السالمونيلا ten اختبارها في الممرات 3-12. تم اختبار هذه العزلات السالمونيلا نفسها ، وبنفس الترتيب كما الشكل. 1A ، لالأليلات H1 ط ؛ ز ، ط ، ص ، وZ10 (الشكل 1B ، C). مرة أخرى ، تم تعيين كل أليل H1 إلى عزل تعتمد على وجود تطابق في حجم amplicon لسيطرة PCR وكما تنبأ عن التمهيدي H1 أليل 4 مجموعات المستخدمة (3) : I - 510 سنة مضت (الشكل 1B ، 2 لين ؛) ز ، م BP - 310 (الشكل 1B ، 2 لين) ؛ R - 170 سنة مضت (الشكل 1C ، 2 لين) ، وZ10 - 360 سنة مضت (الشكل 1C ، لين 2). تم تعيين الأليلات H1 إلى واحد من عزل السالمونيلا عشرة : ط -- يعزل 3 و 8 (الشكل 1B ، الممرات 5 و 10) ؛ ز ، ط ، 1 و 5 يعزل (الشكل 1B ، الممرات 3 و 7) ، ص إلى وكان ليعزل Z10 2 و 7 و 10 (الشكل 1C ، الممرات 4 ، 9 ، و 12) عزل السالمونيلا 4 سلبية على الأليلات H1 four اختبار ؛ يعزل 6 و 9 (الشكل 1C ، الممرات 8 و 11). أخيرا ، تم اختبار السالمونيلا المعزولة بواسطة PCR لالأليلات H2 المرتبطة 1،2 ؛ 1،5 ؛ 1،6 ؛ 1،7 معقدة والمستضد ه ، ن ، س ، ه ، ن ، z15 معقد مستضد. التمهيدي للمجموعات H2 1،2 ؛ 1،5 ؛ 1،6 ؛ 1،7 معقدة وH2 ه ، ن ، س ، ه ، ن ، z15 معقدة تنتج 290 و 150 سنة مضت amplicons غليان ، على التوالي (3). يمكن للمجموعات التمهيدي لا يميز محددة الأليلات H2 H2 المستضد إما داخل مجمع لتعيين نوع أليل نهائية السابقين. 1،2 ، إلى عزل (3) السالمونيلا المعزولة 4 ، 6 ، 8-10 كانت ايجابية للالأليلات H2 H2 المرتبطة 1،2 ؛ 1،5 ؛ 1،6 ؛ 1،7 مستضد معقدة ، في حين يعزل 2 و وكانت ايجابية لل7 الأليلات H2 المرتبطة ه ، ن ، س ، ه ، ن ، z15 معقدة مستضد (لا تظهر البيانات). في حين السالمونيلا المعزولة 1 و 3 و 5 كانت سلبية بالنسبة للمجمعات two مستضد H2 ، يعزل فقط 1 و 5 وكانت سلبية بالنسبة للفلاجيلين H2 ، على النحو المحدد باستخدام عامة H2 فلاجيلين PCR (1) (لا تظهر البيانات). وتتلخص هذه النتائج في الجدول رقم 2 مع ضرب مصلي السالمونيلا المفترض المخصصة لكل عزل.

الشكل 1
الشكل 1. PCR متعددة لتحديد النوعية والأليلات O H المرتبطين مع س. enterica Serovars الملهبة ، الهدار ، هايدلبرغ ، والتيفية الفأرية (A) ملتيبليكس يا أليل PCR. (B ، C) ملتيبليكس أليل H1 PCR لتحديد جمع أليل فلاجيلين : ط / ز ، م (B) وr/z10 (C). حارات 1and 13 : 100 سنة مضت سلم (Promega ؛ ماديسون ، ويسكونسن) ، 2 لين : ضوابط متعددة لPCR الأليلات O B ، C1 ، C2 ، D1 ، و E (A) ، الأليلات H1 ط / ز ، م (B) ، و الأليلات H1 r/z10 (C) ، والممرات 3-12 : السالمونيلا المعزولة 1-10 (الجدول 2).

PCR ماجستير ميكس Thermocycler (Rapidcycler)
الكواشف تكوين / تركيز مبلغ   المعلمات الحجم المتوقع
H1 ط / ز ، م
DH 2 O 63 ميكرولتر البرنامج 1 94 درجة مئوية لمدة 1 دقيقة
10X PCR العازلة 20 ملي MgCl 2 10 ميكرولتر البرنامج 2 94 درجة مئوية لمدة 1 ثانية
500 mMTris pH8 55 درجة مئوية لمدة 1 ثانية
2.5 ملغ / مل BSA 72 درجة مئوية لمدة 20 ق
5 ٪ Ficoll 400 دورات لمدة 40
10 mMTartrazine منحدر = 2.0
ط التمهيدي (و) * AACGAAATCAACAACAACCTGC 2 ميكرولتر البرنامج 3 72 درجة مئوية لمدة 4 دقائق 510 سنة مضت
ط التمهيدي (ص) * TAGCCATCTTTACCAGTTCCC 2 ميكرولتر
التمهيدي ز ، م (و) * GCAGCAGCACCGGATAAAG 2 ميكرولتر 310 سنة مضت
التمهيدي ز ، م (ص) * CATTAACATCCGTCGCGCTAG 2 ميكرولتر
DMSO 5 ميكرولتر
dNTP 10 ملي 2 ميكرولتر
طق 5 وحدات / ميكرولتر 2 ميكرولتر
90 ميكرولتر
H1 ص / ض 10
DH 2 O 55 ميكرولتر البرنامج 1 94 درجة مئوية لمدة 1 دقيقة
10X PCR العازلة 30 ملم MgCl 2 10 ميكرولتر البرنامج 2 94 درجة مئوية لمدة 1 ثانية
500 mMTris pH8 55 درجة مئوية لمدة 1 ثانية
2.5 ملغ / مل BSA 72 درجة مئوية لمدة 20 ق
5 ٪ Ficoll 400 دورات لمدة 40
10 mMTartrazine منحدر = 2.0
التمهيدي ص (و) * CCTGCTATTACTGGTGATC 4μl البرنامج 3 72 درجة مئوية لمدة 4 دقائق 170 سنة مضت
التمهيدي ص (ص) * GTTGAAGGGAAGCCAGCAG 4μl
التمهيدي ض 10 (و) * GCACTGGCGTTACTCAATCTC 4μl 360 سنة مضت
ض التمهيدي 10 (ص) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 ميكرولتر
dNTP 10 ملي 2 ميكرولتر
طق 5 وحدات / ميكرولتر 2 ميكرولتر
90 ميكرولتر
PCR ماجستير ميكس Thermocycler (Rapidcycler)
الكواشف تكوين / تركيز مبلغ   المعلمات الحجم المتوقع
H2 1،2 / ه ، ن ، س
DH 2 O 63.6 ميكرولتر البرنامج 1 94 درجة مئوية لمدة 1 دقيقة
10X PCR العازلة 20 ملي MgCl 2 10 ميكرولتر البرنامج 2 94 درجة مئوية لمدة 1 ثانية
500 mMTris pH8 55 درجة مئوية لمدة 1 ثانية
2.5 ملغ / مل BSA 72 درجة مئوية لمدة 20 ق
5 ٪ Ficoll 400 دورات لمدة 40
10 mMTartrazine منحدر = 2.0
1،2 التمهيدي (و) * AGAAAGCGTATGATGTGAAA 2 ميكرولتر البرنامج 3 72 درجة مئوية لمدة 4 دقائق 290 سنة مضت
1،2 التمهيدي (ص) * ATTGTGGTTTTAGTTGCGCC 2 ميكرولتر
ه التمهيدي ، ن ، س (و) * TAACTGGCGATACATTGACTG 2 ميكرولتر 150 سنة مضت
التمهيدي ه ، ن ، س (ص) 1 TAGCACCGAATGATACAGCC 2 ميكرولتر
DMSO 5 ميكرولتر
dNTP 10 ملي 2 ميكرولتر
طق 5 وحدات / ميكرولتر 2 ميكرولتر
90 ميكرولتر
عام H2
DH 2 O 72 ميكرولتر البرنامج 1 94 درجة مئوية لمدة 1 دقيقة
10X PCR العازلة 30 ملم MgCl 2 10 ميكرولتر البرنامج 2 94 درجة مئوية لمدة 10 ثانية
500 mMTris pH8 45 درجة مئوية لمدة 10 ثانية
2.5 ملغ / مل BSA 72 درجة مئوية لمدة 35 ق
5 ٪ Ficoll 400 دورات لمدة 40
10 mMTartrazine منحدر = 2.0
fljB التمهيدي (و) * CAAGTAATCAACACTAACAGTC 2 ميكرولتر البرنامج 3 72 درجة مئوية لمدة 4 دقائق 1500 سنة مضت
fljB التمهيدي (ص) * TTAACGTAACAGAGACAGCAC 2 ميكرولتر
dNTP 10 ملي 2 ميكرولتر
طق 5 وحدات / ميكرولتر 2 ميكرولتر
90 ميكرولتر

الجدول 1. بروتوكول للالسالمونيلا flagellinallelotyping PCR : تكوينه وشروط ، والنتائج المتوقعة.

* تركيز العمل في البورصة الاشعال قليل النوكليوتيد PCR هو 25 ميكرومتر

عزل يا أليل H1 أليل H2 أليل ضرب مصلي
  B C1 C2 D1 E أنا ز ، م ص Z10 1،2 ؛ 1،5 ؛ 1،6 ؛ 1،7 ه ، ن ، س ، ه ، ن ، z15 عام 1  
1 -- -- -- + -- -- + -- -- -- -- -- الملهبة
2 -- -- + -- -- -- -- -- + -- + + الهدار / اسطنبول 3
3 -- -- + -- -- + -- -- -- -- -- + كنتاكي
4 -- -- -- -- + -- -- -- -- + -- + غير معروف
5 -- + -- -- -- -- + -- -- -- -- -- مونتيفيديو
6 -- + -- -- -- -- -- + -- + -- + الطفلية أو فيرخوف 2
7 -- + -- -- -- -- -- -- + -- + + مبانداكا
8 + -- -- -- -- + -- -- -- + -- + التيفية الفأرية
9 + -- -- -- -- -- -- + -- + -- + هايدلبرغ
10 + -- -- -- -- -- -- -- + + -- + هيفاء

الجدول 2. Allelotyping نتائج PCR (الشكل 1) والسالمونيلا وبناء على تسمية ضرب مصلي تحديد O ، H1 ، H2 والأليلات

> 1 H2 PCR تنتج 1.5 كيلوبايت amplicon لجميع السالمونيلا امتلاك H2 فلاجيلين ، بغض النظر عن H2 أليل (1). ويستخدم هذا PCR لتمييز حيد الطور من السالمونيلا ثنائي الطور.
(2) يمكن H2 PCR متعددة لا يميز بين الأليلات مختلفة لH2 1،2 ؛ 1،5 ؛ 1،6 ؛ 1،7 معقدة مستضد (3).
3 تحويل بالعاثية س. enterica ضرب مصلي هدار يغير المستضد O LPS لإنتاج ضرب مصلي اسطنبول. يمكن للallelotyping O PCR لا نستشف هذه التغيرات الجينية خفية / مستضدي.

ضرب مصلي 1 يا أليل H1 أليل H2 أليل
  B C1 C2 D1 E أنا ز ، م ص Z10 1،2 ؛ 1،5 ؛ 1،6 ؛ 1،7 ه ، ن ، س ، ه ، ن ، z15 عامة 2
كاليفورنيا + -- -- -- -- -- + -- -- -- -- --
التيفية الفأرية + -- -- -- -- + -- -- -- + -- +
هايدلبرغ + -- -- -- -- -- -- + -- + -- +
هيفاء + -- -- -- -- -- -- -- + + -- +
مونتيفيديو -- + -- -- -- -- + -- -- + -- +
Othmarschen -- + -- -- -- -- + -- -- -- -- --
Athinai -- + -- -- -- + -- -- -- -- + +
Papuana -- + -- -- -- -- -- + -- -- + +
مبانداكا -- + -- -- -- -- -- -- + -- + +
Chincol -- -- + -- -- -- + -- -- -- + +
كنتاكي -- -- + -- -- + -- -- -- -- -- +
الهدار / اسطنبول 3 -- -- + -- -- -- -- -- + -- + +
الملهبة -- -- -- + -- -- + -- -- -- -- --
سيريمبان -- -- -- + -- + -- -- -- + -- +
Campinense -- -- -- + -- -- -- + -- -- + +
لومي -- -- -- + -- -- -- + -- -- -- +
بورتلاند -- -- -- + -- -- -- -- + + -- +
Ruanda -- -- -- + -- -- -- -- + -- + +
TREGUIER -- -- -- + -- -- -- -- + -- -- +
سيمي -- -- -- -- + -- -- + -- -- + +
Weltevreden -- -- -- -- + -- -- + -- -- -- +
Kristianstad -- -- -- -- + -- -- -- + -- + +
بيافرا -- -- -- -- + -- -- -- + -- -- +

الجدول 3. السالمونيلا Serovars enterica المحددة من قبل PCR Allelotyping

(1) أبرزت في serovars جريئة هي الأكثر شيوعا التي يواجهها التشخيص أو الطعام المختبر الميكروبيولوجي.
2 H2 PCR تنتج 1.5 كيلوبايت amplicon لجميع السالمونيلا امتلاك H2 فلاجيلين ، بغض النظر عن H2 أليل (1). ويستخدم هذا PCR لتمييز حيد الطور من السالمونيلا ثنائي الطور.
3 تحويل بالعاثية س. enterica ضرب مصلي هدار يغير المستضد O LPS لإنتاج ضرب مصلي اسطنبول. يمكن للallelotyping O PCR لا نستشف هذه التغيرات الجينية خفية / مستضدي.

Discussion

معظم المتاحة تجاريا اختبارات PCR للكشف عن الجينات أهداف السالمونيلا فريدة للجنس (مثلا invA). ومع ذلك ، ليس كل السالمونيلا متساوون في قدرتهم لتسبب المرض لدى البشر أو انتشار المرض في قطعان الحيوانات. التعرف المبكر للخلافات في مستضدي LPS السالمونيلا O - مستضد وflagellinH1 ومستضدات H2 قد تؤدي إلى التفريق بين السالمونيلا إلى أكثر من 2500 serovars بناء على هذه الاختلافات مستضدي. وهناك 46 مستضدات O و 86 متميزا متميزة مستضدات فلاجيلين (H) التي تم تحديدها في جنس السالمونيلا السالمونيلا قد تكون في حوزتها واحد (H1) أو مختلفين (H1 و H2) flagellins. اعترفت مجموعة مختلفة من O ، H1 ، H2 ومستضدات حساب serovars السالمونيلا 2500 اليوم. يتم تعيين ضرب مصلي على أساس صيغة مستضدي المستمدة من تحديد هوية الفرد ومستضدات O H. يتم كتابة الصيغة كما مستضدي O : H1 : H2 ، وحيث "--" ، ويشير إلى غياب أو فلاجيلين H1 H2 و "NT" (غير typeable) لالسالمونيلا سلبية على O - مستضد. على سبيل المثال ، يتم تعيين لضرب مصلي التيفية الفأرية S. enterica عزل مع الصيغة مستضدي B : ط : 1،2 بينما تعطى الملهبة لعزل مع D1 الصيغة : ز ، م : -. هذا الاختلاف في عدد السكان مستضدي السالمونيلا هو مظهر الخارجي لخلافات على المستوى النوكليوتيدات أنه لا يمكن بالتالي يمكن استغلالها بسهولة من قبل PCR.

حددنا الاختلافات الجينية المرتبطة O محددة والأليلات H لوضع allelotyping PCR لتحديد س. enterica serovars : الملهبة ، الهدار ، هايدلبرغ ، والتيفية الفأرية (3). احالة صحيحة والإبلاغ عن ضرب مصلي السالمونيلا يتطلب اختبار لجميع الأليلات المرتبطة O : H1 : الصيغ مستضدي H2 للأمعاء (D1 : ز ، م : --) ، الهدار (C2 : Z10 : ه ، ن ، س) ، هايدلبرغ (B : ص : 1،2) ، والتيفية الفأرية (B : الأول : 1،2). أليل دون معرفة أو المستضد O ، عن العثور على ز H1 ، م أليل وحدها لا تحدد بالضرورة عزل السالمونيلا الملهبة والسالمونيلا وغيرها serovars : أغونا ، كاليفورنيا ، ومونتيفيديو ، كما تملك هذه الأليل نفسه. بينما كان مصمما أصلا للallelotyping PCR للكشف عن الصدارة المذكورة serovars السالمونيلا ، وهذا يمكن اختبار تحديد مبلغ إضافي 19 serovars (الجدول 3). كان مصمما أصلا لدينا allelotyping PCR للكشف عن O و H الأليلات. في الممارسة العملية ، فقد أصبح أكثر عملية وفعالة من حيث التكلفة بالنسبة لنا للتعرف على O - المستضد من خلال اختبار تراص الشريحة ، وذلك باستخدام O - أمصال مضادة محددة ، بدلا من أداء allelotyping O PCR عند العمل مع الثقافات السالمونيلا المعزولة. ومع ذلك ، فإننا نوصي باستخدام allelotyping O PCR إذا المختبر الخاص يستخدم هذا PCR كشاشة (2) أو لكتابة المقدمة السالمونيلا المعزولة على بطاقات اتفاقية التجارة الحرة (6) ، وتشتمل على السالمونيلا PCR محددة مع الشاشة الأولى من عينات (4 ). الحد من تقارير إتمام المشروعات allelotyping لعينات فقط تلك التي يتم تحديدها من قبل والسالمونيلا PCR أو الاختبارات البيوكيميائية / مستضدي.

وقد تم تحسين البروتوكول الموصوفة في هذه المقالة للاستخدام مع Rapidcycler التكنولوجيا ايداهو ، وهو thermocycler الهواء الساخن الذي يسمح احد لتقليص حجم التفاعل وظروف التفاعل يعمل في وقت أقل من كثير thermocyclers كتلة التدفئة. ربما على التكيف مع هذا البروتوكول للاستخدام مع التدفئة thermocycler كتلة يتطلب تحسين ظروف التفاعل تجريبيا عن طريق خفض / رفع درجات الحرارة الصلب ، وتعديل تركيزات التمهيدي ، أو تعديل MgCl 2 التركيزات. على سبيل المثال ، كان علينا أن نكيف بروتوكول للبحوث PTC MJ - 200 thermocycler على النحو التالي. العمل مع وحدات التخزين نفس رد الفعل المذكورة في الجدول رقم 1 ، والأوراق المالية العاملة concentrationof كان المخفف مجموعة التمهيدي الأول إلى 2.5 ميكرومتر ، وخفض درجة الحرارة الصلب من 55 درجة مئوية إلى 45 درجة مئوية ، وحضانة مرات في تمسخ ، الصلب والإرشاد الخطوات وقد تطول الى 20 ق لPCR ط / ز ، allelotyping م. وجود الضوابط المناسبة الإيجابية والسلبية لا بد في البدء الأولية والأمثل لأي PCR ، بما في ذلك البروتوكولات التي تم نشرها. نوصي الحصول على serovars السالمونيلا المعروفة ، وتحديدا الشرجية (E1 : ه ، ح : 1،6) ، الملهبة (D1 : ز ، م : --) ، الهدار (C2 : Z10 : ه ، ن ، س) ، هايدلبرغ (B : ص : 1،2) ، مونتفيديو (C1 : ز ، م ، ق : 1،2،7) والتيفية الفأرية (B : الأول : 1،2) ؛ والقولونية مختبر K12 سلالة (DH5α ، LE393 ، JM109 ، الخ. ) ، والضوابط الإيجابية والسلبية على التوالي للاختبارات PCR allelotyping الموضحة في هذه المقالة. والعديد من هذه serovars السالمونيلا بمثابة الضوابط إما إيجابية أو سلبية ، اعتمادا على أليل يتم اختباره.

احتياطات معينة ومبادئ توجيهية ينبغي اتباعها أثناء أداء هذه وغيرها من أي PCR التشخيص. الأول ، الفصل الماديإعداد القالب ، PCR مجموعة المتابعة ، وهلام إستشراد أمر حاسم في منع PCR ممكن المرحل التلوث والتقارير الكاذبة الخاطئة من ايجابيات. بالإضافة إلى ذلك ، إدراج الضوابط المناسبة أمر ضروري في أي PCR الروتينية وهذه الضوابط تحديد المشاكل التي تنشأ والمساعدة في تفسير النتائج (5). الأهم من ذلك ، والاتساق أمر ضروري ، خاصة فيما يتعلق بالشروط الكهربي لandestimation amplicon الكشف (PCR المنتج) من حجم amplicon. لتوضيح هذه النقطة ، علقنا الكهربائي عمدا في وقت سابق من المقصود في الشكل 1A. ليست معايير الوزن الجزيئي (حارات 1 و 13) والسيطرة الايجابية (حارة 2) فصل كاف لتقدير الأحجام بدقة أو مراعاة الفصل بين شظايا الحمض النووي ، حيث أن هناك اختلافات صغيرة (~ 50 BP) في الأحجام. فصل كاف من شظايا من الحمض النووي ، ولا سيما معايير الوزن الجزيئي ، كما من الضروري إبلاغ ايجابيات يعتمد على تقدير دقيق لحجم amplicon والتمييز "الإيجابي الحقيقي" من المنظمات غير محددة amplicons التي لوحظ في بعض الأحيان في إدارة اليومية في أي PCR (5 ). على سبيل المثال ، هناك amplicon غير محددة في الشكل 1B ، لين 7 (~ 700 شركة بريتيش بتروليوم في الحجم). وكان الكهربائي قد توقفت في وقت مبكر جدا ، عندما كانت الجبهة صبغ فقط عند نقطة منتصف الطريق في agarose هلام ، لن يكون هناك فرق بسيط ما بين 500 سنة مضت ، والحمض النووي شظايا BP 700. لذا ، كان من عينة في حارة 7 ، عن طريق الخطأ إيجابية لكلا الأول وغرام ، الأليلات م.

أخيرا ، يحتاج المرء إلى التعرف على القيود المرتبطة بأي اختبار. العديد من PCR allelotyping H1/H2 لم يكن لديك القدرة على التمييز لتمييز الفروق الدقيقة في الأليلات الوراثية تنتمي إلى 1،2 H2 ، 1،5 ، 1،6 ، 1،7 معقد مستضد ؛ ه ، ن ، س / ه ، ن ، z15 معقدة مستضد والمستضد G H1 معقدة ، والذي يتضمن أليل ز م. واحد أو اثنين من التغييرات من الأحماض الأمينية حساب الحواتم مختلفة موجودة في هذه المستضدات سوطي. لذا كان من الصعب بالنسبة لنا لتصميم الاشعال التي يمكن أن تستغل هذه الزوج قاعدة واحدة أحيانا اختلافات في التسلسل الجيني فلاجيلين (3). على سبيل المثال ، السالمونيلا serovars دبلن (D1 : ز ، ع : --) وبيرتا (D1 : و ، ز ، ر : --) هي أيضا PCR إيجابية مع ز لدينا ، mallelotyping الاشعال. يمكن للallelotyping الاشعال H2 لا يميز التيفية الفأرية (B : الأول : 1،2) من لاغوس (B : الأول : 1،5) ، هايدلبرغ (B : ص : 1،2) من برادفورد (B : ص : 1،5) ، Winneba (B : ص : 1،6) ، أو ريمو (B : ص : 1،7) ، أو هدار (C2 : Z10 : ه ، ن ، س) من جلوستروب (C2 : Z10 : ه ، ن ، z15). في حين أن احتمال مواجهة بعض هذه serovars : لاغوس ، برادفورد ، Winneba ، ريمو Glustrup أو بعيد ، بل هو احتمال ويتطلب توفير إما إخلاء بشأن الحد من الاختبارات "أو اختبار آخر مؤكد.

في الختام ، وهذا المصلي PCR المستندة يحدد بسرعة س. enterica serovars الملهبة ، الهدار ، هايدلبرغ والتيفية الفأرية ، والإخراج ، H1 ، H2 والأليلات المرتبطة 19 serovars إضافية. هذا الاختبار هو سريع وفعال من حيث التكلفة البديلة لنهج الميكروبيولوجية التقليدية إلى السالمونيلا المصلي.

Disclosures

الإعلان عن أي تضارب في المصالح.

Acknowledgments

وقد تم دعم هذا العمل عن طريق منح وزارة الزراعة الأميركية 1999-35212-8680 ، 2005-01378 ، و2010-04288-01 وصناديق وزارة الزراعة الأميركية الفورمولا ودولة المنحة جورجيا الطب البيطري للبحوث الزراعية. تم تطوير بروتوكول وصفها في هذا المنشور لاستخدامها من قبل الطلاب الجامعيين كجزء من الدورات البحوث الموجهة : MIBO 4900L ، 4960H الجينات ، BCMB 4960L ، و4960H بيول في جامعة جورجيا واستخدامها من قبل الطلاب في العديد من مشاريع البحوث الوبائية الجزيئية في مورير المختبر. نود أن نشكر العديد من الطلاب الذين أدوا الجامعية البحوث والمختبرات في مورير لي ، ورئيس قسم لدينا ، وجون Glisson لدعم جهودنا الرامية إلى دمج التعليم الجامعية في مجال البحث.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
وPCR لتحديد Allelotyping<em> السالمونيلا enterica</em> serovars الملهبة ، الهدار ، هايدلبرغ ، والتيفية الفأرية
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter