Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

확인을 위해 Allelotyping PCR 살모넬라 enterica serovars Enteritidis, 해더, 하이 델베르크, 그리고 Typhimurium

doi: 10.3791/3130 Published: July 22, 2011

Summary

우리는 살모넬라균 enterica serovars Enteritidis, 해더, 하이 델베르크, 그리고 Typhimurium의 급속한 탐지를위한 멀티 플렉스 PCR을 설명합니다. 특정 살모넬라균의 serovars는 유전자와 주어진 serovar의 O - 항원 생합성 클러스터 및 flagellin 고유의 시퀀스로 PCR 다중을 대상으로 확인할 수 있습니다. Serovar는 대상 allele에 해당하는 특정 크기 amplicons (PCR 제품)의 모양에 따라 분리 살모넬라균에 다음 할당됩니다.

Abstract

이 속 독특한 살모넬라균 대상 유전자 식별을 위해 현재 상업 PCRs 테스트. 그러나,이 두 종족, 여섯 subspecies, 그리고 2,500 이상의 살모넬라균의 serovars 있으며, 모든 공공 건강에 자신의 중요성 같은 것입니다. 예를 들어, S.를 찾는 테이블 달걀 계층 농장에 enterica subspecies IIIa 애리조나는 S.의 고립에 비해 하찮은 것은 enterica subspecies I serovar Enteritidis, 테이블 계란의 소비에 연결된 살모넬라 증의 주요 원인. Serovars은 antigenic의 lipopolysaccharide의 차이 (LPS) (O 항원)과 flagellin (H1 H2와의 항원)를 기준으로 식별됩니다. 이러한 antigenic 차이는이 표현형과 관련된 유전자 및 유전자 대립 형질의 다양성의 겉모양 수 있습니다.

우리는 멀티 플렉스 PCR, allelotyping을 개발했다고 네 개의 주요 S. 사이의 유전자 차이에 대한 키 enterica subspecies I serovars는 가금류에서 발견과 미국에 상당한 인간의 질병을 앓고 있습니다. PCR 프라이머 쌍은 핵심 유전자 또는 특정 살모넬라균의 serovar 독특한 그 유전자 또는 allele 특정 크기의 amplicon을 생산하기위한 시퀀스를 타겟으로했다. 살모넬라균 serovar는이 특정 LPS에 대한 PCR 검사 결과의 조합에 따라 분리에 할당됩니다 그리고 flagellin 유전자 대립 형질. 이 문서에서 설명하는 멀티 플렉스 PCRs는 S.의 검색을위한 구체적인 enterica subspecies I serovars Enteritidis, 해더, 하이 델베르크, 그리고 Typhimurium.

우리가 분리 살모넬라균에 대한 serovar을 식별하는 멀티 플렉스 PCRs를 사용하는 방법을 보여줍니다.

Protocol

1. PCR 서식 파일의 준비

참고 :) 1) 템플릿 (DNA) 준비, 2 PCR 설정하고, 3) 겔 전기 영동 : PCR carryover 오염을 최소화하기 위해, 그것은 PCR 서로의 신체 - 별도의 몇 가지 중요한 핵심 단계를 유지하는 것이 중요합니다. 또한 pipetters의 문화 또는 시약 오염을 방지하기 위해 장벽 도움말을 사용하는 것이 좋습니다.

  1. 하나의 고립된 식민지에서 분리 살모넬라와 Luria Bertani 국물 또는 기타 복잡한 매체 (뇌 심장 주입, Superbroth 등) 1 ML의 예방. 37 야간 문화를 품어 ° C.
  2. 멸균, 1.5 ML 용량 microfuge 관 1 ML을 전송, ~ 2 분 4,500 XG에서 세균성 세포 현탁액을 원심 분리기. 펠렛 세포 수 있습니다.
  3. 가만히 따르다 뜨는은 10 분 실온에서 100 % 에탄올과 세트 1 ML에있는 세포 펠렛을 resuspend. (4500 XG, 2 분). 이전과 펠렛 세포는 1 ML PBS에서 뜨는 및 resuspend 세포를 제거합니다.
  4. 원심 분리기의 전지 (4,500 XG, 2 분.) 무균 DH 2 O. 1 ML에 뜨는 및 resuspend 세포를 폐기
  5. -20에서 DH 2 O (5 μl/95 μl DH 2 O)와 저장 ° C.의 최종 세포 현탁액 20분의 1을 희석 -20 ° C에서 PCR 템플릿으로 전체 세포의 유통 수명은 한달에 관한 것입니다.

2. PCR 설정

참고 : 준비 및 PCR 반응 믹스 (템플릿, 버퍼, oligonucletoideprimers, 세포핵과 DNA 형성 촉매의 DNA 중합 효소)의 분배는 PCR / UV 워크 스테이션에 헌신하고 낫게 한 물리적으로 별도의 방에 수행되어야합니다.

참고 : PCR 객실은 또한 PCR 설치, 일회용 라텍스 장갑에 대해 설정된 전용 pipetter 지정된 -20 ° C의 PCR 시약의 저장 냉동고 (버퍼, oligonucleotide primers, 그리고 세포핵), 효소 및 템플릿과 함께 자체 포함되어야합니다 설정 , 실험실 외투, 장벽 팁, microtiter 접시, 유리 모세관, microfuge 튜브 및 오염을 제거 표면에 10 % 표백제. PCR의 시약 하는걸 전용 pi​​petter 세트 (P10, P100, 그리고 P1000)를 사용합니다. 이 피펫 설정은 설정 워크 스테이션을 떠날 수 없어합니다.

참고 : 1.5 ML 용량 원심 튜브에 분자 생물학이나 PCR 학년 DH 2 O와 나누어지는 1 ML를 구합니다. 교차 오염 가능성을 방지하기 위해 각 사용 후 aliquoted DH 2 O를 분배. 유사한 접근 방식은 다른 PCR의 시약과 함께 권장합니다.

참고 : UV 조명 및 / 또는 10 %의 표백제로 표면을 닦고와 함께 사용하기 전에 작업 영역을 오염을 제거하다. PCR 설치를 수행하는 실험실 외투와 라텍스 장갑을 착용한다. 앞뒤 PCR의 트래픽을 최소화 PCR 반응이 thermocylcer 및 PCR 제품 (ampl​​icons) 아가로 오스 젤에 대한 구분에 incubated 아르 분야에 셋업. 당신은 PCR 설정 영역에 다시 가면, 당신이 현재 입고 장갑의 새로운 쌍을에 부착 할 것입니다 라텍스 장갑의 쌍 처분.

  1. 5x10 -4 M.의 농도 DH 2 O에서 마스터 프라이머 주식 만들기 20분의 1 DH 2 O (; 25 μm의 5 μl/95 μl DH 2 O)의 primers를 희석. 각 flagellin의 타이핑 프라이머에 대한 oligonucleotide 순서는 표 1에 설명되어 있습니다.
  2. -20 ° C의 냉장고에서 PCR의 시약과 템플릿을 검색하고, 시약 및 샘플가 얼음위에 좀 녹여 수 있습니다. 필요한 때까지 냉동실에있는 DNA 형성 촉매의 DNA 중합 효소를 남겨주세요.
  3. 로 표 1에 설명된 allelotyping PCR 반응 시약의 조합을 분배.
  4. 열 (예 : A1)의 상단에서 시작하여 다음의 상단에 열을 아래로 이동, 살균, 96 - 음, 폴리스티렌 microtiter 플레이트에서 10 라운드 바텀 우물의 각으로 PCR 반응 혼합물의 9μl 하는걸.
  5. 긍정적인 컨트롤 템플릿 (중 0.5μl 첫 잘 (A1)에 PCR 혼합 (NO DNA 제어)의 9 μl로 DH 2 O 1 μl 추가 I / g, M 입력 primers - Typhimurium과 Enteritidis; r/z10 입력 primers - 하이 델베르크와 해더, 그리고 1,2 / E, N, X를 입력 primers - Typhimurium과 해더) 잘 2 층에서 PCR 믹스 (B1) 9 μl하고, 대장균 1 μl에 K12 DH5α 세 번째 우물에 PCR 믹스 9 ML (C1).
  6. 각각의 추가 잘 들어 (D1 - H1, A2, B2), PCR 반응 혼합물의 9 μl로 해동 샘플 템플릿 1 μl를 추가합니다. I / G, M allelotyping PCR, S. 들어 enterica serovar Typhimurium (I)과 Enteritidis (G, M)은 긍정적인 제어 역할을하고, 살모넬라균 serovars 하이 델베르크 (R) 및 해더 (z10)는 R / Z 10 allelotyping 멀티 플렉스 PCR에 대한 긍정적인 컨트롤입니다.
  7. 아이다호 기술 Rapidcycler (8) 지정된 소유자로 플레이스 10 μl 용량 유리 모세관합니다.
  8. 한번 홀더에 안전, 각 유리에 모세관을 감동하여 PCR 반응 혼합물과 모세로드microtiter 접시의 바닥 웰스. 액체가 튜브를 아래로 이동하고 종료 및 열은 모세 혈관의 양쪽 끝을 밀봉하기 위해 부탄 토치로 유리 튜브를 밀봉하기 전에 PCR 믹스 사이의 공간을 제공할 수 있도록 홀더 틸트.
  9. 아이다호 기술 Rapidcycler으로 모세관 튜브와 홀더를 삽입하여 PCR을 실행하는 다른 allelotyping의 primers를 위해 표 1에서 설명한 thermocycler 프로그램을 사용합니다.
  10. thermocycler 프로그램이 완료되면 겔 전기 영동 단계로 진행합니다.

3. 젤 전기 영동

참고 : 전기 실험실에서 사용하기 위해 지정된 다른 실험 복과 일회용 라텍스 장갑의 새로운 쌍을 착용하십시오.

참고 : UV 보호 눈 안경이나 얼굴 방패를 착용하고 ethidium의 브로마이드, 특히 아가로 오스의 젤을 다룰 때 항상 장갑되었습니다.

  1. 녹은 100 ML 1.5 % (W / V) 1xTAE에서 분자 생물학 학년 아가로 오스 (또는 1X TBE) 반복적으로 정기적인 시각과 함께 2-5 분 간격으로 20 %의 전력에서 설정 전자렌지에 아가로 오스의 현탁액을 가열하여 전기 영동 버퍼 (7) 준비 검사. 그것은 물 목욕의 온도 equilibrates 때까지 60 ° C의 물을 욕조에 녹은 아가로 오스를 설정합니다.
  2. 녹은 아가로 오스를 따르고 전에 빗과 함께 겔 주형을 설정합니다. 컨트롤, 샘플 및 종료와 아가로 오스 겔의 중간에서 자신의 위치를​​ 위해 적어도 3 분자량 표준 충분한 우물을 생산하기에 충분한 이빨을 가진 젤 빗를 선택합니다.
  3. 100 ML에 ethidium 브로마이드 2 μl (10 MG / ML) 추가 용융 1.5 % (W / V) 1xTAE의 아가로 오스 (또는 TBE), 믹스로 부드럽게 소용돌이 병은 거품을 생산하지 않도록하고, 부드럽게 병의 내용을 부어 10cm 아가로 오스 겔 15에 대한 겔 주형의 중간에. 아가로 오스 겔에서 거품을 제거하는 조직 종이 또는 종이 타월의 가장자리를 사용하십시오.
  4. 아가로 오스 굳은 (~ 30-45 분)까지 실온에서 설정 겔 금형을 보자. 잠수, 1X 태 (또는 1X TBE) 전기 영동 버퍼를 포함하는 수평 전기 챔버에 젤 & 빗과 함께 겔 트레이를 전송합니다. 부드럽게 아가로 오스 겔에서 빗를 제거합니다.
  5. 이 막대기는 젤 하단에 있는지 확인하기 위해 전기 챔버의 음극 또는 긍정적인 기둥에 상대 겔 트레이의 배치를 확인합니다. 참고 : 음극을 향해 부정 청구 DNA 마이 그 레이션 (즉, "레드 실행")를 기억하십시오.
  6. 배의 DNA 로딩 염료의 40 μl와 DNA 분자량 마커 (0.25 μg / μl)의 Premix 200 μl. 처음, 중간 그리고 마지막으로 우물에 premixed DNA 분자량 마커 XIV의 4.8 μl를로드합니다.
  7. 잘 2 시작하여 각 후속 잘하는 발전, 왼쪽에서 오른쪽으로 이동 PCR 샘플 각을로드합니다. 분자량 표준을 포함​​하고있는 우물의에서 샘플을 로딩하지 마십시오.
  8. 각 유리 모세관에 포함된 샘플을로드하려면 :
    1. 그 소유자 및 유리 커터와 모세관의 에칭 끝을 모두에서 각 모세를 제거합니다.
    2. 플레이스 엄지와 양손의 집게손가락 유리 커터로 표시된 모세관의 양쪽과 모세관을 스냅.
    3. PCR 반응 혼합물의 최종 맞은편에있는 모세관 발급기를 놓고 천천히 액체가 튜브의 맨 아래에까지 시계 방향으로 플런저를 켜십시오.
    4. 읽어에 잘으로 모세관을 넣고 천천히 잘 아가로 오스로 Ficoll - 가중치 샘플을 하는걸 시계 방향으로 플런저를 켜십시오. 아닌 액체의 마지막이 모세관을 떠났을 때 너무 과거를 회전하여 모세관이나 우물에 공기 방울을 소개와 함께 소중히 잘를 조심해라.
  9. 일단 모든 샘플 및 표준이로드됩니다, V (9 볼트 / cm 아가로 오스 겔) 90 전원 공급 장치의 일정한 전압을 설정합니다.
  10. 노란색 염료 (Taurazine) 앞에는 젤의 바닥에서 1cm되면 전기 영동을 중단.
  11. 전기가 완료되면, DNA 조각과 분자량 표준을 시각화하기 위해 UV transilluminator로 젤을 전송하기만하면됩니다. 또는 열 프린터 CCD 카메라 및 인쇄 이미지를 사용하여 디지털 이미지로 : 오렌지 유리 필터 (2 X, Y 및 4.5 설정)와 폴라로이드 카메라를 사용하여 폴라로이드 필름에 이미지를 캡처합니다.
  12. 15-30 분 10 % 표백제에있는 모세관 홀더를 놓으십시오. DH 2 O 다시 PCR 설치 실에서 공기 건조하기 위해 3 번 린스.

4. 대표 멀티 플렉스 PCR 결과

살모넬라균의 allelotyping PCR에 대한 검색 결과는 1-10는 그림 1 (차선 3-12)에 나타난 다음과 같이 해석 분리합니다. O의 allele 지정이 PCR 컨트롤의 크기와 일치하는 amplicon (PCR 제품)을 기반으로 분리 살모넬라균 부여와 같은 O의 allele의 프라이머에 대한 예측 것은 (3) 사용 설정 : B - 560bp, C1 - 340bp, C2 - 400 BP, D1 - 620 BP, 그리고 E1 - 280 BP. 우리가 O 대립 유전자 B를 (10 차선 할당된 O allelotyping PCR (그림 1A)와 함께 테스트를 격리를위한 -10 살모넬라균 13), C1 (7-9 차선), C2 (차선 4, 5), D1 (레인 3)과 E1 (레인 6) 3-12 차선에서 테스트를 분리합니다. 이 같은 살모넬라균의 분리는 그림과 같은 순서로 테스트되었습니다. 1A, H1의 대립 유전자에 대한 I, G, m, R 및 z10 (그림의 1B, C). 다시 H1의 allele은 각 PCR 컨트롤의 크기와 일치 amplicon의 존재에 따라 분리 할당하고 같은 4 H1의 allele의 프라이머에 대해 예측하는 것은 (3) 사용 설정 : I - 510 BP (그림의 1B, 레인 2 ) G, M - 310 BP (그림의 1B, 레인 2), R - 170 BP (그림 1C, 레인 2) 및 z10 - 360 BP (그림 1C, 레인 2). H1의 대립 유전자는 10 살모넬라균의 격리 중 하나에 할당했다 : 나는 - 3 8을 (그림의 1B, 차선 5 & 10) 격리, G, M - 격리 1 5 (그림의 1B, 차선 3 & 7), R을 격리 6 9 조 (그림 1C, 차선 8 & 11);. 격리 2, 7, 10 (그림 1C, 차선 4, 9, 및 12)와 z10 살모넬라균이 분리 4 테스트 네 개의 H1의 대립 유전자에 대한 부정했다. 마지막으로, 살모넬라균의 분리는 1,2와 관련된 H2의 대립 유전자에 대한 PCR에 의해 시험되었다, 1.5, 1,6, 1,7 항원 복잡하고 E, N, X, E, N, z15 항원 복합. 프라이머는 H2 1,2에 대한 설정, 1.5, 1,6, 1,7 복잡​​하고 H2 E, N, X, E, N, z15 복잡한 290 BP 각각 150 BP의 amplicons (3) 생산하고 있습니다. 프라이머 세트는 최종 allele 유형, 예를 할당하는 복잡한 중 H2의 항원 내의 특정 H2의 대립 유전자를 구별 수 없습니다. 1,2에 (3) 살모넬라균은 4, 6, 80-10은 H2 1,2와 관련된 H2의 대립 유전자에 대한 긍정적인되었습니다 격리 분리;. 1.5, 1,6,, 1,7 항원 복잡한 동안 격리 2 7 E, N, X와 관련된 H2의 대립 유전자에 대한 긍정했다, E, N, z15 항원 복합 (데이터가 표시되지 않음). 살모넬라균은 1, 3, 5 두 H2의 항원 단지에 대한 부정했다 격리 동안 단 1 5, H2 flagellin에 대해서는 일반 H2 flagellin PCR (1) (데이터가 표시되지 않음)를 사용 결정 부정되었습니다 분리합니다. 이러한 결과는 각각의 분리에 할당된 추정 살모넬라균의 serovar과 함께 표 2에 요약됩니다.

그림 1
그림 1. S.와 관련된 구체적인 O 및 H의 대립 유전자 식별을위한 멀티 플렉스 PCR enterica Serovars Enteritidis, 해더, 하이 델베르크, 그리고 Typhimurium. (A) O Allele 멀티 플렉스 PCR. Flagellin의 대립 유전자 식별을 위해 (B, C) H1 Allele 멀티 플렉스 PCR : I / G, M (B)와 r/z10 (C). 레인스 1and 13 : 100 BP의 사다리 (Promega, 매디슨, 위스콘신), 레인 2 : 멀티 플렉스 PCR 컨트롤 O의 대립 유전자에 대한 B, C1, C2, D1 및 E (A), H1은 대립 유전자 I / G, M (B), 그리고 H1의 대립 유전자 r/z10 (C) 및 골목길 3-12 : 살모넬라균은 10-10 (표 2)를 분리합니다.

PCR 마스터 믹스 Thermocycler (Rapidcycler)
시약 작곡 / 농도   매개 변수 예상 크기
H1 I / G, M
DH 2 O 63 μl 프로그램 1 1 분 94 ° C
10X PCR 버퍼 20 MM MgCl 2 10 μl 프로그램이 1 S를위한 94 ° C
500 mMTris pH8 1 S 55 ° C
2.5 MG / ML BSA 20 S 72 ° C
5% Ficoll 400 40 사이클
10 mMTartrazine 슬로프는 = 2.0
프리머 I (F) * AACGAAATCAACAACAACCTGC 2 μl 프로그램 3 4 분 72 ° C 510 BP
프리머 I (R) * TAGCCATCTTTACCAGTTCCC 2 μl
뇌관 G, m은 (F) * GCAGCAGCACCGGATAAAG 2 μl 310 BP
뇌관 G, m은 (R) * CATTAACATCCGTCGCGCTAG 2 μl
DMSO 5 μl
dNTP 10 MM 2 μl
DNA 형성 촉매 5 단위 / μl 2 μl
90 μl
H1 R / Z 10
DH 2 O 55 μl 프로그램 1 1 분 94 ° C
10X PCR 버퍼 30 MM MgCl 2 10 μl 프로그램이 1 S를위한 94 ° C
500 mMTris pH8 1 S 55 ° C
2.5 MG / ML BSA 20 S 72 ° C
5% Ficoll 400 40 사이클
10 mMTartrazine 슬로프는 = 2.0
프리머 R (F) * CCTGCTATTACTGGTGATC 4μl 프로그램 3 4 분 72 ° C 170 BP
프리머 R (R) * GTTGAAGGGAAGCCAGCAG 4μl
프리머 Z 10 (F) * GCACTGGCGTTACTCAATCTC 4μl 360 BP
프리머 Z 10 (R) * GCATCAGCAATACCACTCGC 4μl
DMSO 5 μl
dNTP 10 MM 2 μl
DNA 형성 촉매 5 단위 / μl 2 μl
90 μl
PCR 마스터 믹스 Thermocycler (Rapidcycler)
시약 작곡 / 농도   매개 변수 예상 크기
H2 1,2 / E, N, X
DH 2 O 63.6 μl 프로그램 1 1 분 94 ° C
10X PCR 버퍼 20 MM MgCl 2 10 μl 프로그램이 1 S를위한 94 ° C
500 mMTris pH8 1 S 55 ° C
2.5 MG / ML BSA 20 S 72 ° C
5% Ficoll 400 40 사이클
10 mMTartrazine 슬로프는 = 2.0
프리머 1,2 (F) * AGAAAGCGTATGATGTGAAA 2 μl 프로그램 3 4 분 72 ° C 290 BP
프리머 1,2 (R) * ATTGTGGTTTTAGTTGCGCC 2 μl
뇌관 E, N, X (F) * TAACTGGCGATACATTGACTG 2 μl 150 BP
뇌관 E, N, X (R) 1 TAGCACCGAATGATACAGCC 2 μl
DMSO 5 μl
dNTP 10 MM 2 μl
DNA 형성 촉매 5 단위 / μl 2 μl
90 μl
일반 H2
DH 2 O 72 μl 프로그램 1 1 분 94 ° C
10X PCR 버퍼 30 MM MgCl 2 10 μl 프로그램이 10 S에 대해 94 ° C
500 mMTris pH8 10 S에 대해 45 ° C
2.5 MG / ML BSA 35 S 72 ° C
5% Ficoll 400 40 사이클
10 mMTartrazine 슬로프는 = 2.0
프리머 fljB (F) * CAAGTAATCAACACTAACAGTC 2 μl 프로그램 3 4 분 72 ° C 1500 BP
프리머 fljB (R) * TTAACGTAACAGAGACAGCAC 2 μl
dNTP 10 MM 2 μl
DNA 형성 촉매 5 단위 / μl 2 μl
90 μl

표 1. 살모넬라균 flagellinallelotyping PCR을 위해 프로토콜 : 구성, 조건과 예상 결과를.

* PCR의 oligonucleotide의 primers의 작업 재고 농도는 25 μm의 수 있습니다

분리 O의 Allele H1의 Allele H2의 Allele Serovar
  B C1 C2 D1 E g, M R z10 1,2, 1.5, 1,6, 1,7 E, N, X, E, N, z15 일반 1  
1 - - - + - - + - - - - - Enteritidis
2 - - + - - - - - + - + + 해더 / 이스탄불 3
3 - - + - - + - - - - - + 켄터키
4 - - - - + - - - - + - + 알 수없는
5 - + - - - - + - - - - - 몬테비데오
6 - + - - - - - + - + - + Infantis 또는 Virchow 2
7 - + - - - - - - + - + + 음반 다카
8 + - - - - + - - - + - + Typhimurium
9 + - - - - - - + - + - + 하이 델베르크
10 + - - - - - - - + + - + 하이파

표 2. Allelotyping PCR 결과 (그림 1)과 살모넬라균 Serovar 지정은 O, H1, H2 및 대립 유전자의 식별을 바탕으로

> 1 H2 PCR에 관계없이 H2의 allele (1), H2 flagellin을 가진 모든 살모넬라균에 대해 1.5 이하 amplicon을 생산하고 있습니다. 이 PCR은 biphasic 살모넬라균에서 monophasic를 구별하는 데 사용됩니다.
1.5,, 1,6, 1,7 항원 복합 (3) 2 H2 멀티 플렉스 PCR은 H2 1,2에 대한 다른 대립 유전자 간의 구별 수 없습니다.
S. 3 파지 변환 serovar 이스탄불을 생산 enterica serovar 해더 바꿀지도 모르겠어 LPS O 항원. O allelotyping PCR은 이러한 미묘한 유전 / antigenic 변경 사항을 분별 수 없습니다.

Serovar 1 O의 Allele H1의 Allele H2의 Allele
  B C1 C2 D1 E g, M R z10 1,2, 1.5, 1,6, 1,7 E, N, X, E, N, z15 일반 2
캘리포니아 + - - - - - + - - - - -
Typhimurium + - - - - + - - - + - +
하이 델베르크 + - - - - - - + - + - +
하이파 + - - - - - - - + + - +
몬테비데오 - + - - - - + - - + - +
Othmarschen - + - - - - + - - - - -
Athinai - + - - - + - - - - + +
Papuana - + - - - - - + - - + +
음반 다카 - + - - - - - - + - + +
Chincol - - + - - - + - - - + +
켄터키 - - + - - + - - - - - +
해더 / 이스탄불 3 - - + - - - - - + - + +
Enteritidis - - - + - - + - - - - -
Seremban - - - + - + - - - + - +
Campinense - - - + - - - + - - + +
로메 - - - + - - - + - - - +
포틀랜드 - - - + - - - - + + - +
Ruanda - - - + - - - - + - + +
Treguier - - - + - - - - + - - +
시미 - - - - + - - + - - + +
Weltevreden - - - - + - - + - - - +
Kristianstad - - - - + - - - + - + +
Biafra - - - - + - - - + - - +

Allelotyping PCR에 의해 식별 표 3. 살모넬라 enterica의 Serovars

굵은 글씨로 강조 1 serovars 더 일반적으로 진단 또는 식품 미생물학 실험실에 의해 발생한 것들입니다.
2 H2 PCR에 관계없이 H2의 allele (1), H2 flagellin을 가진 모든 살모넬라균에 대해 1.5 이하 amplicon을 생산하고 있습니다. 이 PCR은 biphasic 살모넬라균에서 monophasic를 구별하는 데 사용됩니다.
S. 3 파지 변환 serovar 이스탄불을 생산 enterica serovar 해더 바꿀지도 모르겠어 LPS O 항원. O allelotyping PCR은 이러한 미묘한 유전 / antigenic 변경 사항을 분별 수 없습니다.

Discussion

속 (예 : invA)에 고유한 살모넬라균 대상 유전자의 검출을위한 대부분의 상용 PCR 검사. 그러나, 모든 살모넬라균 동물 인구의 인간이나 유행에 질병을 일으킬 능력 같은 것입니다. 살모넬라 LPS O - 항원과 flagellinH1 및 H2의 항원에 antigenic 차이의 조기 인식이 antigenic 차이에 따라 2,500여 serovars에 살모넬라균의 분화로 연결했다. 속 살모넬라균에서 확인된 46 독특한 O 항원과 독특한 flagellin 86 (H) 항원이있다. 살모넬라균 하나 (H1) 또는 두 가지 (H1 & H2) flagellins을 가지고 있습니다. O, H1, 그리고 2500 살모넬라균의 serovars에 대한 H2의 항원 계정의 다양한 조합이 오늘 인정. serovar는 개별 O 및 H의 항원의 확인에서 파생된 antigenic 수식을 기반으로 할당됩니다. antigenic 수식은 O로 기록됩니다 : H1 : H2, 그리고 어디에가 "-"O - 항원에 대한 부정적인 살모넬라균에 대한 H1 H2 또는 flagellin 및 "NT"(비 typeable)의 부재를 의미합니다. 예를 들어, serovar Typhimurium의는 S. 할당됩니다 Enteritidis가 수식 D1과 분리 부여하는 동안 1,2 : I : enterica은 antigenic 수식 B로 분리 G, 미터 : -. 살모넬라균 인구에서이 antigenic 유사 따라서 쉽게 PCR에 의해 악용될 수있는 뉴클레오 티드 수준 차이의 외적 발현이다.

우리는 식별 S.위한 allelotyping PCR을 개발하기 위해 구체적인 O 및 H의 대립 유전자와 관련된 유전자 차이를 발견했습니다 enterica serovars : Enteritidis, 해더, 하이 델베르크, 그리고 Typhimurium (3). , 해더 (C2 : z10 : E, N, X), 하이 델베르크 (B - H1 : Enteritidis에 대한 H2의 antigenic 수식을 (D1 : G, M) 살모넬라균 serovar의 올바른 할당과보고 O와 관련된 모든 대립 유전자에 대한 검사가 필요합니다 : R : 1,2), 그리고 Typhimurium (B : I : 1,2). O의 allele 또는 항원, H1 g의 발견에 대한 지식이없이는 혼자 미터 allele 반드시 살모넬라균은 다른 살모넬라균의 serovars로 Enteritidis로 분리 식별하지 않습니다 Agona, 캘리포니아, 그리고 몬테비데오, 또한이 같은 allele을 가지고. allelotyping PCR 원래 포어가 살모넬라균의 serovars 언급 감지하도록 설계되었습니다 동안이 검사는 추가로 19 serovars를 (표 3) 확인할 수 있습니다. 우리 allelotyping PCR 원래 O 및 H 대립 유전자를 감지하도록 설계되었습니다. 우리는 O - 특정 antisera를 사용하여보다는 분리된 살모넬라균 문화와 함께 작업하면 O allelotyping PCR를 수행, 슬라이드 응집 검사로 O - 항원을 식별하기위한 연습에,보다 실용적이고 비용 효과가있다. 그러나, 우리는 당신의 실험실 화면 (2) 또는 살모넬라균이 FTA 카드 (6)에 제출한 격리 입력이 PCR을 사용하는 경우 O allelotyping PCR를 사용하는 것이 좋습니다, 그리고 샘플의 첫 번째 화면과 살모넬라균 특정 PCR (4 포함하지 ). PCR 또는 생화학 / antigenic 시험에 의해 살모넬라균으로 확인하는 경우에만 해당 샘플에 allelotyping의 PCRs을 제한합니다.

이 문서에서 설명하는 프로토콜은 아이다호 기술 Rapidcycler 한 많은 가열 블록 thermocyclers보다 짧은 시간 안에 반응 볼륨과 실행의 반응 조건을 확장할 수있는 핫 공기 thermocycler와 함께 사용하기위한 최적화되었습니다. 프라이머의 농도를 조정,, 또는 MgCl 2 농도를 조정 가열 블록 thermocycler와 함께 사용하기 위해이 프로토콜을 적응하기 위해서는 낮추는 / 어닐링 온도를 높여 경험적으로 반응 조건을 최적화해야 할 수 있습니다. 예를 들어, 우리는 MJ 연구 PTC - 200 thermocycler는 다음에 대한 프로토콜을 적응 있었다. 표 1에 설명되어있는 동일한 반응 볼륨 작업, concentrationof는 I 프라이머 세트는 2.5 μm의로 희석되었다 작업 주식은, 어닐링 온도 55 ° C 45 ° C, 그리고 인큐베이션 변성에 시간, 소둔 및 확장 단계에서 저하되었다 I / G, M allelotyping PCR 20 s의 길어되었습니다. 해당 긍정과 부정 컨트롤을하는 것이 출판 프로토콜을 포함하여 PCR의 초기 시작 설치 및 최적화에 필수적입니다. , 해더 (C2 : z10 : E, N, X), 하이 델베르크 (B : R - Enteritidis (D1 : G, M) 우리는 특별히 Anatum (: E, H 1,6 E1), 알려진 살모넬라균의 serovars을 획득하는 것이 좋습니다 : 1,2), 몬테비데오 (C1 : G, M, S : 1,2,7)과 Typhimurium (B : I : 1,2) 및 실험실 대장균 K12 변형 (DH5α, LE393, JM109 등 ) 각각이 문서에서 설명하는 allelotyping PCR 검사에 대한 긍정적이고 부정적인 컨트롤로. 이 살모넬라균의 serovars 몇 가지 테스트하는 allele에 따라 긍정적이거나 부정적인 중 컨트롤 역할을합니다.

특정주의 사항 및 가이드라인이와 다른 진단 PCR을 수행하는 동안 다음해야합니다. 첫째, 물리적 분리템플릿 준비, PCR은 셋업 및 겔 전기 영동 가능한 PCR을 오염과 거짓 - 탐지 잘못된보고 이월 방지에 중요합니다. 이러한 컨트롤들이 발생으로 문제를 파악하고 결과 (5)의 해석에 도움로서뿐만 아니라, 적절한 컨트롤의 포함은 일상적인 PCR에 필요합니다. 가장 중요한 일관성 특히 amplicon 크기의 amplicon (PCR 제품) 검색 andestimation에 대한 전기 조건에 관련하여, 필수입니다. 이 지점을 설명하기 위해, 우리는 의도적으로 그림 1A에서 예정보다 일찍 전기 영동을 일시 중지. 분자량 표준 (차선 1 13)와 긍정적인 제어 (레인 2) 충분히 정확하게 크기를 추정하거나 크기 작은 차이 (~ 50 BP)가있다 DNA 조각의 분리를 관찰하는 분리되지 않습니다. DNA 조각의 적절한 분리, 특히 분자량 기준은 반응을보고하는 것은 amplicon의 크기와 때로는 어떤 PCR의 일일 실행 (5 관찰이 아닌 특정 amplicons의 구분 "진정한 긍정"의 정확한 평가에 따라 달라집니다로 필수적입니다 ). 예를 들어, 그림 1B, 레인 7 (크기 ~ 700 BP)에서 불특정 amplicon있다. 염료 앞에는 아가로 오스 겔의 중간 지점에서만되었을 때 전기, 너무 일찍 중단했다, 500 BP와 700 BP의 DNA 조각 사이에 약간의 차별이있을 것입니다. 따라서, 레인 7 예제는 잘못 I와 G, m의 대립 유전자 모두에 대해 같은 긍정적인보고되었습니다 것입니다.

마지막 하나는 모든 테스트와 관련된 한계를 인식해야합니다. 1.5,, 1,6, 1,7 항원 복합, E, N, X / E H1/H2 allelotyping PCR 중 일부는 H2 1,2에 속하는 대립 유전자의 미묘한 유전적 차이를 분별하는 차별적인 힘 (권력)이 없어 , N, G, m의 allele을 포함 z15 항원 복잡하고 H1 G의 항원 복합. 다른 epitopes이 flagellar 항원에 존재에 대해 하나 또는 두 개의 아미노산의 변화는 계정. 우리가 flagellin 유전자 시퀀스 (3) 이러한 때로는 단일 기본 쌍 차이를 이용할 수 primers를 디자인하는 것은 그러므로 힘들었다. 예를 들어, 살모넬라균 serovars 더블린 (D1 : G, P : -)과 베르타은 (D1 : F, G, T : -) primers를 mallelotyping, 우리의 g와 함께 PCR 양성하고 있습니다. , 브래드 포드 (1.5 : : R B)에서, 하이 델베르크 (1,2 B : R) 라고스 (: I 1.5 B)에서 H2 allelotyping의 primers는 Typhimurium를 (1,2 : I B) 구분 수 없습니다 Glostrup에서 (C2 : z10 : E, N, z15) Winneba (B : R : 1,6) 또는 리모 (B ​​: R : 1,7) 또는 해더 (E, N, X C2 : z10). 이러한 serovars의 일부를 발생의 가능성이 있지만 : 라고스, 브래드 포드, Winneba, 리모 또는 Glustrup가 원격이고, 그것은 가능성이며, 어느 시험 '제한 또는 다른 확실한 테스트 조건을 제공합니다.

결론적으로,이 PCR 기반 serotyping가 급격히 S.를 식별하는 enterica serovars Enteritidis, 해더, 하이 델베르크와 Typhimurium, 그리고 O, H1, H2 및 대립 유전자의 19 serovars 추가와 관련된. 이 분석은 serotyping의 살모넬라균 전통 미생물 접근하기 위해 신속하고 비용 효율적인 대안입니다.

Disclosures

관심 없음 충돌 선언하지 않습니다.

Acknowledgments

이 작품은 USDA 보조금 1999-35212-8680, 2005-01378, 그리고 2010-04288-01, USDA 수식 자금과 조지아의 동물용 의약품 농업 연구 부여의 국가에 의해 지원되었습니다. 본 출판물에 설명된 프로토콜은 감독 연구 과정의 일환으로 학부에서 사용하기 위해 개발되었습니다 : MIBO 4900L, 진 4960H, BCMB 4960L, 그리고 조지아 대학에서 BIOL 4960H와 모러 여러 분자 역학 연구 프로젝트에 학생들이 사용하는 실험실. 우리는 연구 학부 교육을 통합하는 노력을 지원하기위한 많은 학부 모러와 리 연구소에서 연구를 수행한 학생 및 부서 의자, 존 글리슨 감사하고 싶습니다.

Materials

Name Company Catalog Number Comments
Luria Bertani Fisher Scientific (or any comparable source)
Microfuge tubes Fisher Scientific 1.5 ml capacity (or any comparable source)
Ethanol Fisher Scientific 200 proof (or any comparable source)
dH2O Sigma-Aldrich Molecular Biology Grade (or any comparable source; PCR only)
10 x PCR Buffer: Idaho Technologies 20 mM MgCl2 (buffer comes with BSA, Ficoll and Tartrazine)
30 mM MgCl2
40 mM MgCl2
PCR primers
DMSO
dNTP Roche Group (or any comparable source)
Taq DNA Polymerase Denville Scientific (or any comparable source)
Capillary pipettes Idaho Technologies 10 µl volume
Rapid Cycler Idaho Technologies
Agarose Bio-Rad Low EEO; Molecular Biology Grade (or any comparable source)
50 X TAE Buffer or 5X TBE Buffer Fisher Scientific (or any comparable source)
Ethidium bromide Bio-Rad (or any comparable source)
Horizontal, submersible gel electrophoresis chamber with gel mold Bio-Rad (or any comparable source)
Power supply Bio-Rad (or any comparable source)
Molecular Imager Gel Doc System Bio-Rad (or any comparable source)
Table 4. Materials

DOWNLOAD MATERIALS LIST

References

  1. Dauga, C., Zabrovskaia, A., Grimont, P. A. D. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J. Clin. Microbiol. 36, 2835-2843 Forthcoming.
  2. Hong, Y., Liu, T., Lee, M. D., Hofacre, C. L., Maier, M., White, D. G., Ayers, S., Wang, L., Berghaus, R., Maurer, J. A rapid screen of broth enrichments for Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium using an allelotyping multiplex PCR that targets O and H antigen alleles. J. Food Prot. 72, 2198-2201 (2009).
  3. Hong, Y., Liu, T., Lee, H. ofacre, Maier, C. L., White, M., Ayers, D. G., Wang, S., Berghaus, L., R, M. aurer J.Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. (2008).
  4. Liu, T., Liljebjelke, K., Bartlett, E., Hofacre, C. L., Sanchez, S., Maurer, J. J. Application of nested PCR to detection of Salmonella in poultry environments. J. Food Prot. 65, 1227-1232 (2002).
  5. Maurer, J. J. Rapid detection and limitation of molecular techniques. Ann. Rev. Food Sci. Tech. 2, 259-279 (2011).
  6. Moscoso, H., Alvarado, I., Hofacre, C. L. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 50, 391-396 (2006).
  7. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory. 2nd ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y. (1989).
  8. Wittwer, C. T., Fillmore, G. C., Hillyard, D. R. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17, 4353-4357 (1989).
확인을 위해 Allelotyping PCR<em> 살모넬라 enterica</em> serovars Enteritidis, 해더, 하이 델베르크, 그리고 Typhimurium
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).More

Maurer, J. J., Lee, M. D., Cheng, Y., Pedroso, A. An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. J. Vis. Exp. (53), e3130, doi:10.3791/3130 (2011).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter