Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

تقييم التغييرات المشوهة في نموذج الزرد من التعرض الكحول الجنينية

doi: 10.3791/3704 Published: March 20, 2012

Summary

من أجل فهم الآليات الجزيئية للضرر الإيثانول الناجم عن النمو، وضعنا نموذجا الزرد من التعرض الايثانول ويتم استكشاف البدنية، وإجراء التعديلات الخلوية، والجينية التي تحدث بعد التعرض للايثانول

Abstract

متلازمة الكحول الجنينية (فاس) هو مظهر حاد من التعرض الجنينية إلى الإيثانول. ويعرض مع العيوب المميزة للوجه وأجهزتها، بما في ذلك التخلف العقلي نتيجة لنمو الدماغ المختلين والتالفة. الكحول الجنينية اضطراب طيف (FASD) هو مصطلح يستخدم لتغطية سلسلة متصلة من العيوب الخلقية التي تحدث نتيجة لاستهلاك الكحول والأمهات، ويحدث في حوالي 4٪ من الأطفال الذين ولدوا في الولايات المتحدة. مع 50٪ من النساء في سن الانجاب وأبلغت عن استهلاك الكحول، ونصف حالات الحمل غير المخطط لها أن تكون، والتعرض غير المتعمد هو مسألة استمرار 2. وضعنا من أجل فهم أفضل للضرر التي تنتجها الإيثانول، بالإضافة إلى إنتاج نموذج الذي لاختبار التدخلات المحتملة، وهذا نموذج من التعرض الايثانول التنموية باستخدام الأجنة الزرد. الزرد مثالية لهذا النوع من الدراسة مشوه 3-8. كل زوج يضع مئات من البيض، وعندئذ يمكن جمعها دون الإضرار الكبارالأسماك. الجنين الزرد غير شفاف، ويمكن تصويرها بسهولة مع أي عدد من البقع. تحليل من هذه الأجنة بعد التعرض للايثانول في جرعات مختلفة وأوقات مدة ويظهر تطبيق هذا للخلل الجسيم التنموية التي تنتجها الايثانول تتسق مع عيب خلقي الإنسان. الموصوفة هنا هي التقنيات الأساسية المستخدمة لدراسة ومعالجة نموذج FAS الزرد.

Protocol

1. معالجة الايثانول من الأجنة

  1. وأثيرت الأجنة الزرد المستمدة من البرية من نوع التزاوج عند 28 درجة مئوية في 5 مل من الماء جنين. (ملي-Q المياه مع 60 ملغم / لتر فورية المحيط). سلالات مختلفة من البرية من نوع الأجنة يكون التحمل مختلفة قليلا الى الايثانول التعرض 9.
  2. وقد بدأ التعرض للايثانول في مرحلة قبة (~ آخر ساعة 4،3 التسميد، HPF) لمدة من الوقت المطلوب، ما يصل الى نبض مدار 24 ساعة. هذه المرحلة بداية ما يعادل تقريبا إلى مرحلة زرع أجنة الثدييات، فقط قبل تكون المعيدة. استخدمت تركيزات الإيثانول مجموعة من 0.2٪ -2.5٪، حجم / حجم. وقد أثبتت التجارب أن ما بين 25-50٪ من الحل في المياه يصل في النهاية إلى الجنين النامي 10 و 11. تتم المحافظة على الأجنة في 28 درجة مئوية لمدة من الوقت المطلوب. بعد طول المطلوب من التعرض الإيثانول، تتم إزالة حل الإيثانول في المياه واستبدالها مع ثلاثة من الماء يغسل الزرد العادية والمحافظة على FOص الطول المطلوب من الزمن. خصوصية الخلل يعتمد على الوقت من بداية، الجرعة، ومدة النبضة من الايثانول.

2. مجموعة من الأجنة لRNA، في التهجين الموضعي، جسم، وتلطيخ الغضروف

  1. لجمع مرنا لqPCR، يتم جمع عمر الأجنة المتطابقة في أنابيب إيبندورف. بعد إزالة المياه الزرد، يضاف العازلة تحلل مع TCEP. ويستخدم الطاحن الآلية لفصل جسديا الأجنة في حل تحلل. ثم يتم تمرير هذا من خلال عمود preclear، الذي يزيل أي قطعة undissociated كبير. الحل الناتج يحتوي على جميع الجزيئات الصادرة عن عملية تحلل. ثم يتم استخراج الحمض النووي الريبي عن طريق تشغيل هذا الحل على عمود، تليها يغسل والعلاج الدناز. يتم تنفيذ ثم شطف باستخدام الماء أو محلول شطف المقدمة من قبل الشركة المصنعة (5'-رئيس الوزراء). ويمكن تحويل الحمض النووي الريبي إلى [كدنا] باستخدام تقنيات قياسية لqPCR أو استخدامها في الدقيقةمجموعة تحليل.
  2. لتهجين في الموضع وتلوين الأجسام المضادة، أجنة 6-24 كانت ثابتة في HPF بارافورمالدهيد 4٪ بين عشية وضحاها في 4 درجة مئوية. ويتبع هذا بنسبة 3 يغسل في برنامج تلفزيوني + 0.1٪ توين (PBT)، للحفاظ على الأجنة من الالتصاق معا. ثم يتم نقل الأجنة من خلال سلسلة من 3 الميثانول: PBT يغسل الميثانول إلى 100٪، وعند هذه النقطة يمكن تخزينها عند درجة حرارة -20 درجة مئوية. ويمكن استخدام هذه الأجنة لتهجين موضعية أو تلطيخ الجسم المضاد. بعض الأجسام المضادة لا تعمل بعد العلاج الميثانول، وحتى هذا التحذير ينبغي أن يؤخذ في الحسبان، والأجسام المضادة المحددة الخاصة بك اختبار لتحديد ما اذا كانت ستعمل بعد العلاج الميثانول.
  3. لتلطيخ الغضروف والأجنة في حاجة إلى أن ترفع إلى 5 أو 6 أيام الإخصاب آخر (DPF). يتم إصلاحها بعد ذلك في امتصاص العرق 4٪ بين عشية وضحاها في 4 درجات مئوية، تليها 3 غسلات في PBT.

3. تقييم الإيثانول الناجم عن التغييرات التعبير الجيني والآثار التنموية

    وتهجين موضعية. ويتحقق qPCR باستخدام بادئات مصممة مع تقنيات الحمض النووي المتكاملة (IDT) البرمجيات، والتحقق من صحتها بعد ذلك باستخدام 3 عينات بيولوجية منفصلة. بمجرد التحقق من صحة الاشعال، ويتم تنفيذ qPCR على [كدنا] من عينات الحمض النووي الريبي خلق التي تم جمعها. يتم تشغيل كل عينة في ثلاث نسخ. يتم تشغيل تفاعلات PCR البلاتين SYBR الأخضر qPCR سوبر مزيج (إينفيتروجن) على جهاز PCR كروما-4 (BioRad) أو ما شابه ذلك آلة PCR مع نظام كشف متعدد الألوان. بالإضافة إلى الجينات استجوابه، فمن الأهمية بمكان أن يتم استخدام عنصر تحكم مجموعة من المشارع لموازنة الفروق الصغيرة في إعداد [كدنا] أو الحمض النووي الريبي. لدينا الأجنة الزرد، ونحن نستخدم gapdh: 5'GAAGGTGGGAAACTGGTCAT3 'و5'TTGCACCACCCTTAATGTGA3 ". تم تطبيع ثم الجينات التي يجري تحليلها لمستويات gapdh يتم حساب الكمي النسبي في التعبير الجيني باستخدام اختلاف طريقة Pfaffl في 2 12. الحساب العادي يفترض أن جميع الجينات والحمض النووي تكرار مرتين في كل دورة، ويعرب عن هكذا بيانات كنسبة من التغيير في الجين تجريبية على مدى التغير في الجين المرجعية، كما أعرب عن حسابات السلطة على "2" عدد صحيح، وهو كفاءة مضاعفة من الحمض النووي في كل دورة ينظر في تفاعل PCR الكمال. طريقة Pfaffl محل عام "2" مع مجرب ولدت كفاءة حقيقية للالاشعال PCR الذي تم اختياره. أنه يعبر عن انعكاس أكثر دقة من الفرق في تفاعلات PCR. الصيغة الكاملة هي:
    (الكفاءة من الجينات التجريبية) (ط م من السيطرة عينة-CT عينة من المعالجة)
    -------------------------------------------------- -----------------------------------
    (الكفاءة من الجينات مرجع) (ط م منعينة السيطرة - ط م من عينة المعالجة)
  1. لتهجين موضعية، digoxigenin (حفر)، وصفت هي التي شيدت riboprobes من البلازميدات المحتوية على أجزاء من الجينات في المصالح. ويتعرض سن المطابقه الأجنة إلى riboprobes استخدام الظروف القياسية 13 و الكشف عن استخدام الألغام المضادة للحفر الأجسام المضادة بالإضافة إلى الفوسفاتيز القلوية التي تسمح للموقع riboprobes المسمى باستخدام رد فعل اللون (NBT / BCIP). وبعد ذلك تصور أجنة باستخدام مجهر لايكا تشريح (الشكل 1B-G).
  2. لتقييم التنمية morphogenic، يتم جمع الأجنة في الوقت المطلوب وفحصها تحت المجهر تشريح. لشكل الجسيدة، يتم تصوير الأجنة الحية 14. لمسافة بين العين وطول الجسم، ويتم إصلاح الأجنة في منهاج العمل. في جميع الحالات، يتم التقاط صور للمنطقة المطلوب على مجهر تشريح في التكبير الثابتة والقياسات المأخوذة باستخدام أدوبي فوتوشوب سوفتواريه 10،14.
  3. لدراسة الآثار المترتبة على العلاج على هياكل غضروف النامية في الزرد اليرقات، ونحن نستخدم تلطيخ الأزرق Alcian. وتعامل ثابت يرقات اسماك الزرد مع حل الزرقاء Alcian الذائبة في الايثانول 80٪: 20٪ حامض الخليك الجليدي (الكحول حامض) لعدة ساعات أو بين عشية وضحاها. وdestained اليرقات في يغسل عدة من الكحول حمض قبل نقله إلى KOH 1٪: 3٪ محلول بيروكسيد الهيدروجين لإزالة المزيد من الخلايا الصبغية. الزرد تحتاج إلى أن تكون على الأقل 4 أيام من العمر لإظهار هياكل الغضروف، ويتم تعريفها على نحو أفضل في هذه الأسماك التي تحتوي على 5 أو 6 أيام من العمر.
  4. ويتم تقييم موت الخلايا في الأجنة الحية باستخدام برتقالية الأكريدين (AO). AO غير قابلة للاختراق الخلية إلى الخلايا الحية، ويربط على الحمض النووي في الخلايا مع أغشية للخطر، بما في ذلك تلك التي تمر موت الخلايا المبرمج والنخر. وحضنت الأجنة الذين يعيشون مع 5 ملغ / مل AO في برنامج تلفزيوني لمدة 1 ساعة، ثم يغسل بنسبة 3 في برنامج تلفزيوني. والتقط ثم أجنة باستخدام مجهر متحد البؤر. الرقمية Z-سريتم الجمع بين الصور المنشأ لإنشاء المركبة.

4. التلاعب في الأجنة الزرد

  1. بعد التعرف على الجينات التي انخفضت بنسبة تعرض الايثانول، فمن الممكن لمحاولة استبدالها باستخدام حقن مرنا مصممة لتحل محل الجينات في عداد المفقودين. وكتب مرنا توج من البلازميدات DNA خطي باستخدام الحمض النووي الريبي بوليميراز في مجموعات النسخ المختبر، وفقا لتعليمات الشركات المصنعة (mMessage آلة، النظم البيولوجية التطبيقية). بين 25-200 يتم حقن جزء من الغرام / NL من الحمض النووي الريبي في الخلايا البيض 1-2 الزرد المرحلة، في حل من بوكل 0.1 M. ويسمح بعد ذلك لاستعادة أجنة قبل أن يتم تعامل مع الايثانول على النحو المبين أعلاه (الشكل 5).
  2. عن أي نصوص الجينات التي تزيد من التعرض للايثانول، ويمكن اختصارها، أو "خلع" باستخدام تكنولوجيا morpholino بواسطة العقاقير. تم تصميم العقاقير morpholinos (عاموس) من قبل شركة أدوات جين، ومنع ترجمة من الحمض النووي الريبي إلى البروتين، أو الكحولCK نضوج والربط من الحمض النووي الريبي، وهذا يتوقف على الحاجة التجريبية. هذا العمل من morpholinos الحد من كمية البروتين النشط لهذا الجين المستهدف، وهو العجز الذي يمكن قياسه باستخدام anitibodies إذا كانت متوفرة. ويمكن قياس كفاءة morpholinos الربط الجيش الملكي النيبالي باستخدام RT-PCR للكشف عن الكميات النسبية للمحاضر وتقسم unspliced. يمكن Titrating من morpholino يؤدي إلى الجرعة التي تعتمد على نشاط 15. مخففة عاموس لتركيزات العمل (معاير خريج إلى تركيز نغ) في حل Danieau (58 مم كلوريد الصوديوم، 0.7 مم بوكل، 0.4 ملم MgSO 0.6 الكالسيوم ملم (NO 3) 2، HEPES 5 مم، ودرجة الحموضة 7.6). حقن ينعقد في مرحلة 1-2-الخلية، ثم يسمح للأجنة لتطوير قبل التعرض الى الايثانول علاج على النحو الوارد أعلاه.

5. ممثل النتائج

الزرد تعرض الجنين إلى نتائج الايثانول في عدد من العيوب والنمائية والوراثية التي ترتبطمن الظواهر الموجودة في الفقاريات الأخرى. وقد وثقت نحن تنمية غير طبيعية من الأنسجة المحورية، بما في ذلك الحبل الظهري (لا تظهر البيانات 14). وتأخر في النمو التي تنتجها الايثانول يؤدي على ما يبدو لتعطيل استطالة الحبل الظهري مناسب، مما يؤدي إلى تقصير الحبل الظهري وعطلت في بعض الأحيان (لا تظهر البيانات 14). هذا التأخير في وقت مبكر، والحبل الظهري خلل يؤدي على الأرجح في جزء منه إلى تشوهات في وقت لاحق و somites (الشكل 2)، التي فقدت شكلها شيفرون قوية كما رأينا في ضوابط غير المعالجة، وأقرب إلى و somites على شكل حرف U سمة من الظواهر المشاهدة عند يتم تخفيض الإشارات الصوتية 14. ويمكن قياس زاوية و somites باستخدام البرمجيات القياسية، والزيادات في زاوية من 92.1 ± 4.6 درجة في عناصر التحكم غير المعالجة إلى 122.6 ± 6.6 درجة في الأجنة الايثانول المعالجة (P <0.001).

آخر نتيجة لتعرض الايثانول التي قد تكون downstreaم من تأخر في النمو في وقت مبكر والعيوب في وقت لاحق الحبل الظهري هو تقصير طول الجنين (الشكل 3). قياس حتى الأجنة على أن تأخذ في الاعتبار انحناء تنتج عن التعرض الإيثانول، وتعرض الايثانول يؤدي إلى تقصير الجذع الذي يعتمد على جرعة من الايثانول تعرض الجنين إلى (الشكل 3E 14). هذه النتيجة مشابهة لاستمرار مكانة مقتبل البلوغ قصير وجدت في الأطفال المعرضين للإيثانول خلال تطوير 16، 17، مما يدل على أن نموذج الزرد هو ذات الصلة لفهم من عيب خلقي الإنسان.

واحدة من الخصائص التقليدية لFAS هو الوجه الكلاسيكي، بما في ذلك انخفاض الفك، صغير فتح العين، والنثرة السلس. وتتعلق الكثير من هذه الميزات إلى انخفاض في الأنسجة خط الوسط. وقد تجلى ذلك في النماذج الحيوانية التي الشديدة التعرض الايثانول يؤدي إلى الظواهر أكثر وضوحا، بما في ذلك synopthalmia وتصقلب. عندما المعرضالغناء الأجنة الزرد لجرعات زائدة من الإيثانول، والمسافة داخل العين (IOD) يقلل بطريقة تعتمد على الجرعة (الشكل 4) بما يتفق مع طبيعة الإنسان عيب خلقي. وجدت فقط تصقلب مع جرعات عالية جدا، ولكن الجرعات المنخفضة لا تنتج انخفاضا كبيرا في IOD (الشكل 4)، مما يوحي بأن هذا نموذج حيواني لديه خلل مماثل في تطوير الوجه خط الوسط 10.

سعينا من أجل فهم الآلية الكامنة وراء الخلل في الجسم على حد سواء وجها التي تنتجها تعرض الايثانول، لوضع التغييرات التعبير الجيني التي تحدث في وقت مبكر في عملية التنمية، وربما بشكل معقول أن من المتوقع أن تسهم في وقت لاحق العيوب التنموية. ونحن نفعل ذلك من ناحيتين، استخراج مرنا من أجنة يسمح لإجراء تقييم كمي لمستويات التعبير الجيني في الأجنة الايثانول العلاج مقارنة مع الضوابط (الشكل 1A). وبالإضافة إلى ذلك، لا يمكننا القيام بها في الموقعتهجين لإلقاء نظرة على نمط من الجينات، بغض النظر عن ما إذا كان أو لم يكن، انخفض إشارة (الشكل 1B-G 18). في هذا المثال، يتم عرض اثنين من الجينات التي التعبير ينخفض ​​بعد التعرض للايثانول، وgli1 six3b. فعلنا نحن عندما درست في نمط الوضع الطبيعي للsix3b، والعثور على حدوث انخفاض في مدى المكاني للتعبير عن هذا الجين (الشكل 1 EG) في الاجنة المعرضة للايثانول. وعثر على تخفيض مماثل في GSC الجين (الشكل دينار بحريني). وأعرب كل من six3b وGSC في الأنسجة متجهة إلى المساهمة في الأنسجة خط الوسط القحفي. حتى الحد من هذه الجينات في 8 HPF يتسق مع انخفاض في IOD وجد لاحقا كما هو مبين في الشكل (4).

وحالما يتم تحديد الجينات التي تتأثر الإيثانول، وهناك آليات يمكن من خلالها زيادة التعبير منهم أو ينقص. في هذا إكساء خاصmple، لقد أظهرنا 2 الجينات التي انخفضت (gli1 وsix3b) بواسطة qPCR. اخترنا لحقن مرنا لتحديد ما إذا عكس هذه التغييرات الجينية يمكن أن تحسن النتائج. لهذه التجربة، بدلا من الحقن gli1، اخترنا لحقن SHH، ليجند الذي يزيد gli1 المستويات. لsix3b، كنا قادرين على حقن six3b نفسها. وجدنا أي تغييرات عندما نقوم بحقن six3b (لا تظهر البيانات) لكنهم تمكنوا من انقاذ أساسا للخلل الجسيم في الأجنة الزرد مع التكميلي SHH الحقن (الشكل 5).

الشكل 1
تعرض شخصية الايثانول 1. تغيير نمط في وقت مبكر، ومستويات التعبير الجيني الجينات تنموية مختارة. أ) نتائج qPCR للأجنة في 8hpf. يتم عرض النتائج على اثنين من الجينات: six3b وgli1. النتائج كما هو مبين في المتوسط ​​من ثلاث تجارب منفصلة،والجرعة من الايثانول أظهرت 2.5٪. وخفضت كل من الجينات بطريقة غير هام من سيطرة (T-اختبار، P <0.05). BG) التهجين الموضعي من 8 الأجنة الزرد HPF. يتم تغيير كلا GSC وأنماط six3b عند هذه النقطة مرة مقارنة بالمجموعة الضابطة. (تم التعديل بإذن من Loucks وآخرون 2007).

الشكل 2
يتم تبديل تنمية شخصية الجسيدة 2. في الأجنة المعالجة. ويتم فحص هيكل الجسيدة والزوايا في 48 HPF. في الأجنة سيطرة (A)، somites لها شكل شيفرون وبزاوية حادة. الزرد الايثانول يتعرض لها أكثر الزوايا I-somites أو على شكل حرف U، والحادة أقل. (تم التعديل بإذن من Loucks وآلغرين 2009).

الشكل (3)
3 الشكل. علاج الإيثانول يقلل بشكل ملحوظ طول الجسم في الزرد.تم قياس طول الأجنة غير المعالجة والايثانول المكشوفة في postfertilization 5 أيام. واعتبر انخفاض كبير في طول في جميع الأجنة المعالجة (أنوفا، ف <0.001). دينار بحريني. كان هناك انخفاض طفيف لكن كبير في الطول الكلي للأجنة تعامل مع 1.0٪ و 1.5٪ من الإيثانول، في حين كان ينظر الى أكبر انخفاض في الأجنة مداوى مع 2.0٪ و 2.5٪ من الإيثانول. هاء للسيطرة على حجم الخلافات في كل قابض، وتطبيع الأجنة لمراقبة كل تجربة على 100، والأجنة الأشقاء المعالجة معبرا عنه بنسبة مئوية من 100. (تم التعديل بإذن من Loucks وآلغرين 2009).

الشكل 4
الشكل 4. النتائج تعرض الايثانول في خفض المسافة داخل العين (IOD) في الأجنة الزرد. A) وجهات النظر أمامي الأجنة شرح الظواهر العين العادية وتنصهر. B) جرعات مختلفة من الايثانول تدار لمدة 3 ساعات خلال الدقة تكون المعيدةانخفضت ults في IOD عندما يتم فحص الأسماك على مدار 24 ساعة في وقت لاحق. وينظر فقط عيون تنصهر وتصقلب على أعلى جرعة اختبار (2.4٪). * تشير إلى انخفاض كبير في IOD مقارنة بالمجموعة الضابطة. (تعديل بإذن من آلغرين، 2004).

الشكل 5
الشكل 5. حقن مرنا SHH-N تنقذ العيوب الجسيمة التي تنتجها تعرض الايثانول من الزرد. تم حقن الاجنة خلية واحدة لمدة مع 100 مرنا SHH-N الغرام / NL وتعرض نصف عدد الأجنة حقن جرعات الايثانول الى مستوى 4،3 حتي 24 HPF. وقد تم تحليل الأجنة في 5 DPF. معرض للمنحني الأجنة تعامل مع الايثانول 2.0٪ ظهريا أقصر الذيول، somites أنا الشكل، وعيوب العين بما في ذلك تصقلب. وينظر الى الانقاذ من هذه الظواهر في 71/76 المؤرخ الأجنة حقن (93٪). في هذه الأجنة، والجسد هو مستقيم، و somites هي شيفرون الشكل، ويتم فصلها تماما العينين.

Discussion

ووصف الطرق هنا والنتائج أظهرت شرح مجرد غيض من كيف يمكن استخدام الزرد لاستجواب العيوب التنموية. بسبب سهولة الحصول على الجنين، ارتفاع عدد البيض الذي تضعه كل القابض، واستنساخ عالية من نتائج، وهذه الفقاريات تعتبر مثالية لدراسات ماسخة. ويمكن أيضا أن الأسماك يمكن التلاعب بها لتحتوي على جزيئات الفلورسنت لاستخدام كمراسلة البصرية لجين معين أو مسار من مصلحة 19. في دراسات الإيثانول، والجرعات المستخدمة تبدو مرتفعة جدا مقارنة مع الثدييات مستويات الكحول في الدم. ومع ذلك، هذه المستويات تعكس ما هو موجود في الماء، ويتم تسليم ليس كل من الإيثانول إلى الجنين.

أخذت معا، الأساليب المذكورة والمفصلة أعلاه تشير إلى أن الأجنة الزرد مفيدة للغاية في نمذجة العيوب الخلقية البشرية الناجمة عن التعرض لالايثانول. وعلاوة على ذلك، تم تأكيد التغييرات التعبير الجيني وجدت في الزرد من قبل الآخرينفي النظم نموذج الثدييات 20، مما يدل على أن يتم الاحتفاظ الآثار التنموية من الايثانول عبر الفقاريات. ويمكن استخدام العديد من التقنيات أثبتت أعلاه مع غيرها من الشتائم البيئية أو الأدوية بسرعة وسهولة كشف teratogens المحتملة، وتحديد الآليات الكامنة التي تسهم في إمساخ من مادة معينة.

Disclosures

ليس لدينا ما يكشف.

Acknowledgments

نود أن نشكر مونتي Westerfield، ماكوتو كوباياشي وTopczewski جاسيك للهدايا من البلازميدات للتهجين في الموضع وإبر دقيقة جدا مرنا. ونحن ممتنون لارهارد Steph عن الظهور في شريط الفيديو. ونود أيضا أن نعترف المساعدة من غوسنز وليام مع متحد البؤر المجهري يظهر في شريط الفيديو. تايلر Schwend قدمت الصور المستخدمة في الفيديو، ورودني دايل ساعد في التحضير للفيديو. نحن نعترف أيضا رعاية الحيوان CMRC الموظفين لعملهم مع تربية اسماك الزرد. وقد تم تمويل هذا العمل من قبل المعاهد الوطنية للصحة منح R21 AA13596 إلى هيئة السلع التموينية.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
تقييم التغييرات المشوهة في نموذج الزرد من التعرض الكحول الجنينية
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter