Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Bedömning Teratogena Förändringar i ett Zebrafish modell av Fetal Alcohol Exponering

doi: 10.3791/3704 Published: March 20, 2012

Summary

För att förstå de molekylära mekanismer etanol-inducerad utvecklings skada, har vi utvecklat en zebrafisk modell för etanol exponering och utforskar de fysiska, cellulära och genetiska förändringar som uppstår efter etanol exponering

Abstract

Fetalt alkoholsyndrom (FAS) är en allvarlig manifestation av embryonal exponering för etanol. Det uppvisar karakteristiska defekter i ansiktet och organ, innefattande psykisk utvecklingsstörning grund oordnade och skadade hjärnan utveckling. Fetalt alkoholsyndrom spektrum störning (FASD) är en term som används för att täcka ett kontinuum av medfödda defekter som uppstår på grund av moderns alkoholkonsumtion, och förekommer hos ca 4% av barnen födda i USA. Med 50% i fertil ålder kvinnor rapportering av alkohol, och hälften av alla graviditeter är oplanerade, är oavsiktlig exponering en fortlöpande utgivning 2. För att bäst förstå den skada som produceras av etanol, plus ger en modell som för att testa potentiella interventioner, har vi utvecklat en modell för utvecklande etanol exponering med zebrafisk embryo. Zebrafisk är idealiska för denna typ av teratogen studie 3-8. Varje par lägger hundratals ägg, som sedan kan samlas utan att skada den vuxnafisk. Zebrafisk embryot är transparent och kan lätt avbildas med ett godtyckligt antal fläckar. Analys av dessa embryon efter exponering för etanol vid olika doser och tider för tid och visar ansökan att grova utvecklingsdefekter produceras av etanol är förenliga med mänskliga defekt. Som beskrivs här är de grundläggande tekniker som används för att studera och manipulera zebrafisk FAS modellen.

Protocol

1. Etanol Behandling av embryon

  1. Zebrafiskembryon härledda från vildtyp-parningar höjdes vid 28 ° C i 5 ml embryot vatten. (Milli-Q-vatten med 60 mg / L Instant Ocean). Olika stammar av vild-typ embryon har lite olika toleranser etanol exponering 9.
  2. Exponering för etanol initierades vid kupolen steget (~ 4,3 timmar efter befruktningen, HPF) för den önskade längden av tid, upp till en 24 h-puls. Denna utgångspunkt är i stort sett motsvarar implantation stadium däggdjur embryon, strax före gastrulation. Etanolkoncentrationer används varierar från 0,2% -2,5%, volym / volym. Tester har visat att mellan 25-50% av lösningen i vatten hamnar i det utvecklande embryot 10, 11. Embryon hölls vid 28 ° C under önskad tid. Efter att den önskade längden av etanol exponering, är etanol-vatten-lösning avlägsnades och ersattes med tre tvättar med regelbunden zebrafisk vatten och hölls for önskad tidslängd. Specificiteten hos defekten beror på tiden för början, dosering, och längden av pulsen för etanol.

2. Samling av embryon för RNA in situ hybridisering, Antikropp, och brosk Färgning

  1. För att samla mRNA för qPCR är åldersmatchade embryon som samlats in i Eppendorf-rör. Efter avlägsnande av den zebrafisk vatten, lyseringsbuffert med TCEP tillsattes. En motoriserad pulverisator används för att fysiskt separera embryona i lys-lösning. Detta får sedan passera genom en kolonn preclearn, som avlägsnar eventuella icke dissocierade stora bitar. Den resulterande lösningen innehåller alla makromolekyler som frigörs från den lys-processen. RNA extraherades sedan genom att köra denna lösning på en kolonn, följt av tvättar och DNas-behandling. Eluering utförs sedan med användning av antingen vatten eller en elueringslösning som tillhandahålls av tillverkaren (5 '-Prime). RNA-, kan omvandlas till cDNA med användning av standardtekniker för qPCR eller användas i mikromatris-analys.
  2. För in situ hybridisering och antikroppsfärgning, embryon från 6 till 24 HPF fixerades i 4% paraformaldehyd över natten vid 4 ° C. Detta följs av 3 tvättar i PBS + 0,1% Tween (PBT), för att hålla embryon från att klibba ihop. Embryona överförs sedan genom en serie av 3 metanol: PBT tvättar i 100% metanol, vid vilken punkt de kan lagras vid -20 ° C. Dessa embryon kan användas för hybridisering in situ eller antikroppsfärgning. Vissa antikroppar fungerar inte efter metanol behandling, så detta förbehåll bör beaktas och din specifika antikroppar testas för att avgöra om det kommer att fungera efter metanol behandling.
  3. För brosk-färgning, embryon behöver höjas till 5 eller 6 dagar efter befruktning (dpf). De fixerades sedan i 4% paraformaldehyd under natten vid 4 ° C, följt av 3 tvättar i PBT.

3. Bedöma Etanol-inducerade Gene Expression Ändringar och utvecklingsmässiga följderna

    in situ hybridisering. qPCR uppnås med hjälp av primers utformade med integrerat DNA Technologies (IDT) programvara, och bekräftas med 3 separata biologiska prover. När primers har validerats är qPCR utförs på cDNA skapat från insamlade RNA prover. Varje prov körs i triplikat. PCR-reaktioner körs Platinum SYBR Green qPCR Super mix (Invitrogen) på en Chroma-4 PCR-maskin (BioRad) eller liknande PCR maskin med en flerfärgad detekteringssystem. Förutom de gener som avlästs, är det kritiskt att en kontroll uppsättning primrar används för att balansera små skillnader i cDNA: t eller RNA-preparation. För våra zebrafiskembryon använder vi GAPDH: 5'GAAGGTGGGAAACTGGTCAT3 "och 5'TTGCACCACCCTTAATGTGA3". Gener som analyseras normaliseras sedan till GAPDH nivåer en relativ kvantifiering av genuttryck beräknas med användning av metoden Pfaffl variant 2 12. De normala beräkningsmetoderna förutsätter att alla gener är att duplicera DNA två gånger för varje cykel, och därmed uttrycker de uppgifter som ett förhållande av förändringen i den experimentella genen över förändringen i referens-genen, uttryckt som drivmedel beräkningar över heltalet "2", som är effektiv dubblering av DNA per cykel visad i ett perfekt PCR-reaktion. Den Pfaffl metod ersätter den generiska "2" med försöksledaren genererade sanna effektivitet för den valda PCR primers. Det återspeglar en mer korrekt bild av skillnaden i PCR-reaktioner. Den fullständiga formeln är:
    (Efficiency of experimental gen) (Ct kontroll prov-Ct av behandlade prov)
    -------------------------------------------------- -----------------------------------
    (Effektivitet av referens-gen) (Ct ikontrollprov - Ct av behandlade prov)
  1. För in situ-hybridisering, (dig) digoxigenin-märkta riboprober är konstruerade av plasmider innehållande delar av genen av intresse. Åldersmatchade embryona exponeras för riboprober under standardbetingelser 13 och detekteras med användning av anti-dig-antikroppar kopplade till alkaliskt fosfatas som tillåter lokalisering av de märkta riboprober med användning av en färgreaktion (NBT / BCIP). Embryona därefter visualiseras med användning av en Leica dissektionsmikroskop (figur 1B-G).
  2. För att bedöma morfogen utveckling, embryon samlas vid önskad tidpunkt och undersöktes under dissektionsmikroskop. För somit form, är levande embryon avbildas 14. För mellan ögonen avstånd och kroppslängd, är embryon fixeras i PFA. I samtliga fall är bilder av den önskade regionen infångas på ett dissekerande mikroskop vid en fast förstoring och togs mätningar med användning av Adobe Photoshop Software 10,14.
  3. För att undersöka effekten av behandling på utvecklingsländernas brosk strukturer i larver zebrafisk, använder vi Alcian blå färgning. Fast zebrafisk larver behandlas med Alcian blue-lösning upplöstes i 80% etanol: 20% isättika (syra-alkohol) under flera timmar eller över natten. Larver avfärgades i flera tvättar i sur alkohol innan de överfördes till en 1%-ig KOH: 3% väteperoxid-lösning för ytterligare clearing av pigmentceller. Zebrafisk måste vara minst 4 dagar gamla för att visa brosk strukturer, och dessa definieras bättre fisk som är 5 eller 6 dagar gammal.
  4. Celldöd i levande embryon bedöms med användning av akridinorange (AO). AO är inte cellpermeabla till levande celler, och binder till DNA i celler med komprometterade membran, inklusive de som genomgår apoptos och nekros. Levande embryon odlas med 5 mg / ml AO i PBS under 1 timme, följt av 3 tvättar i PBS. Embryona därefter avbildas med det konfokala mikroskopet. Digital Z-SerIES bilder kombineras för att skapa kompositer.

4. Manipulera zebrafisk Embryo

  1. Efter identifiering av gener som minskade med etanol exponering, är det möjligt att försöka ersätta dem med användning av injektion av mRNA för att ersätta den saknade genen. Utjämnade mRNA som transkriberas från linjäriserade DNA-plasmider med användning av RNA-polymeras in vitro transkriptions-kit, enligt tillverkarens instruktioner (mMessage Maskin, Applied Biosystems). Mellan 25-200 pg / nl av RNA injiceras i 1-2 zebrafisk cellstadiet ägg, i en lösning av 0,1 M KCl. Embryon tilläts sedan att återhämta sig innan den behandlades med etanol såsom beskrivits ovan (Figur 5).
  2. För vilken gen som helst transkript som ökade med etanol exponering, kan de minska eller "nedtryckta" med användning av en antisens morfolino-teknik. Antisens morpholinos (Amos) är utformade av de verktyg företaget Gene, och blockerar translation av RNA till protein, eller BLOCK mognad och skarvning av RNA, beroende på den experimentella behov. Denna verkan av morpholinos begränsa mängden aktivt protein för den målsökta genen, ett underskott som kan mätas med användning av Antikroppsbildning om de är tillgängliga. Effektiviteten av RNA-splitsning morpholinos kan mätas med användning av RT-PCR för att detektera de relativa mängderna av splitsade och osplitsade transkript. Titrering av den morfolino kan resultera i dosberoende aktivitet 15. AMOS späds till arbets koncentrationer (titrerades pg till ng koncentration) i Danieau lösning (58 mM NaCl, 0,7 mM KCl, 0,4 mM MgSO 4, 0,6 mM Ca (NO3) 2, 5 mM HEPES, pH 7,6). Injektion sker vid 1-2-cellstadiet, då embryona får utvecklas innan den utsätts för etanolbehandling som ovan.

5. Representativa resultat

Zebrafisk embryo exponering för etanol resulterar i ett antal utvecklings-och genetiska defekter som är relaterade tillde fenotyper som finns i andra ryggradsdjur. Vi har dokumenterat onormal utveckling av axiella vävnader, inklusive notokord (data ej visade 14). Förseningen i utveckling produceras av etanol leder uppenbarligen störningar på ordentlig notokord töjning, vilket leder till en förkortad och ibland stört notochord (data visas inte 14). Denna tidiga dröjsmål och notochord fel leder sannolikt delvis på de senare avvikelser i somiter (figur 2), som har förlorat sin starka chevron form som framgår av obehandlade kontroller, och är närmare till U-formade somiter kännetecknar fenotyper ses vid sonic signalering minskar 14. Vinkeln på somiter kan mätas med standardprogramvara och vinkeln ökar från 92,1 ± 4,6 ° i de obehandlade kontroller till 122,6 ± 6,6 ° i de behandlade etanol embryon (p <0,001).

En annan konsekvens av etanol exponering som kan vara downstream av tidig utvecklingsförsening och senare notochord defekter är en förkortad längd av embryot (Figur 3). Även mätning av embryon för att ta hänsyn till den krökning som produceras av etanol exponering leder etanol exponering för en förkortad trunk som är beroende av dosen av etanol embryot utsattes för (figur 3E 14). Denna upptäckt liknar de fortsatta förpuberteten kortväxthet hos barn som exponerats för etanol under utveckling 16, 17, vilket tyder på att zebrafisk modellen är relevant för förståelsen av det mänskliga defekt.

En av de klassiska egenskaperna hos FAS är en klassisk facies, däribland en minskad käke, liten att öppna ögonen, och en smidig philtrum. Mycket av dessa funktioner är relaterade till en minskning av mittlinjen vävnaderna. Det har visats i djurmodeller att svår etanol exponering leder till ännu mer uttalade fenotyper, inklusive synopthalmia och cyclopia. När Exposjunga zebrafiskembryon till ökade doser av etanol, minskar intraokulärt avståndet (lOD) på ett dosberoende sätt (figur 4) i överensstämmelse med naturen hos den mänskliga defekt. Cyclopia finns endast med mycket höga doser, men lägre doser inte producerar en betydande minskning av IOD (Figur 4), vilket tyder på att denna djurmodell har en liknande defekt i mittlinjen ansikts utveckling 10.

För att förstå mekanismen bakom de brister i både kropp och ansikte producerad av etanol exponering, försökte vi fastställa förändringar genuttryck som förekommer tidigt i utvecklingen och som rimligen kan förväntas bidra till senare utvecklings-defekter. Vi gör detta på två sätt, tillåter extraktion av mRNA från embryon för en kvantitativ utvärdering av nivåer av genexpression i etanol behandlade embryon jämfört med kontroller (Figur 1 A). Dessutom kan vi utföra in situhybridisering för att titta på mönstret av gener, oberoende av huruvida eller inte signalen minskas (Figur 1B-G 18). I detta exempel används två gener vars uttryck sjunker efter exponering för etanol visat gli1 och six3b. När vi undersökte in situ mönster för six3b, gjorde vi finna en minskning i den rumsliga delen av uttrycket av denna gen (figur 1 T.EX.) i embryon som exponerats för etanol. En liknande reduktion återfanns i den gen GSC (figur BD). Både six3b och GSC uttrycks i vävnader avsedda att bidra till kraniofaciala mittlinjen vävnader. Så minskning av dessa gener vid 8 HPF är förenlig med den minskning av IOD fann senare som visas i figur 4.

När gener som påverkas av etanol identifieras, det finns mekanismer genom vilka uttryck av dem kan ökas eller minskas. I detta speciella example har vi visat 2 gener som minskat (gli1 och six3b) med qPCR. Vi valde att injicera mRNA för att avgöra om motverka dessa genförändringar kan förbättra resultaten. För detta experiment, i stället för insprutning av gli1, valde vi att injicera Shh, en ligand som ökar gli1 nivåer. För six3b, kunde vi tillföra six3b själv. Vi fann inga förändringar när vi injiceras six3b (data visas ej) men kunde i grunden rädda de grova brister i zebrafiskembryon med extra Shh injektioner (Figur 5).

Figur 1
Figur 1. Etanol exponering förändrar den tidiga mönstret och gen nivåer uttryck av utvalda utvecklingsstörningar gener. A) qPCR resultat för embryon på 8hpf. Resultaten för två gener visas: six3b och gli1. Resultaten visas som medelvärde av tre separata experiment,och dosen av etanol som visas är 2,5%. Båda generna reducerades på ett sätt som är signifikant från kontroll (t-test, p <0,05). BG) In situ-hybridisering av 8 HPF zebrafiskembryon. Både rådets generalsekretariat och six3b mönster förändras vid denna tidpunkt jämfört med kontroller. (Ändrad med tillstånd från Loucks et al. 2007).

Figur 2
Figur 2. Somit utveckling ändras i behandlade embryon. Somit struktur och vinklar granskas vid 48 HPF. I kontrollexperiment embryon (A), somiter har en vinkelform och en skarp vinkel. Etanol exponerade zebrafisk har fler I-eller U-formade somiter, och mindre skarp vinkel. (Ändrad med tillstånd från Loucks och Ahlgren 2009).

Figur 3
Figur 3. Etanol behandling minskar betydligt kroppslängd i zebrafisk.Längden av obehandlade och etanol-exponerad embryon mättes vid 5 dagar postfertilization. En signifikant reduktion i längd noterades i alla behandlade embryon (ANOVA, p <0,001). BD. Det fanns en liten men signifikant minskning i den totala längden av embryon som behandlats med 1,0% och 1,5% etanol, under det att en större minskning sågs med embryon som fick 2,0% och 2,5% etanol. E. För att kontrollera skillnader i storlek i varje koppling, var kontrollgrupperna embryon för varje experiment normaliserades till 100, och syskon behandlade embryon uttrycks som en procentsats av 100. (Ändrad med tillstånd från Loucks och Ahlgren 2009).

Figur 4
Figur 4. Etanol exponering resulterar i en minskning av det intraokulära avstånd (lOD) i zebrafiskembryon. A) front utsikt över embryon visar normala och smält ögon fenotyper. B) Olika doser av etanol administrerades i 3 timmar under gastrulation resÜLTS i minskad lOD när fisken granskas 24 timmar senare. Brända ögon och cyclopia endast ses vid den högsta testade dosen (2,4%). * Betecknar en signifikant reduktion i IOD jämfört med kontroller. (Modifierad med tillstånd från Ahlgren, 2004).

Figur 5
Figur 5. Shh-N-mRNA injektion räddar de grova fel som produceras av etanol exponering av zebrafisk. En till två cellembryon injicerades med 100 pg / nl SHH-N-mRNA och hälften av de injicerade embryon exponerades för de vanliga etanol doser från 4,3 till 24 HPF. Embryon analyserades vid 5 dpf. Embryon som behandlats med 2,0% etanol uppvisar dorsalt böjd kortare svansar, I-formade somiter och defekter öga, inklusive cyclopia. Räddning av dessa fenotyper kan ses i 71/76 av injicerade embryon (93%). I dessa embryon är kroppen rak, somitema är chevron formade och ögonen är helt separerade.

Discussion

De metoder som beskrivs här och som visas resultaten visar bara toppen av hur zebrafisk kan användas för att förhöra utvecklings defekter. På grund av tillgängligheten av embryot, höga antalet ägg som för varje koppling och hög reproducerbarhet av resultaten, dessa ryggradsdjur är idealiska för teratogenicitet. Fisk kan också manipuleras till att innehålla fluorescerande molekyler använda som en visuell reporter för en speciell gen eller reaktionsväg av intresse 19. I etanol studierna använda doserna verkar ganska hög jämfört med blod från däggdjur alkohol nivåer. Dessa avspeglar vad som finns i vattnet, och inte alla av etanolen levereras till embryot.

Tagna tillsammans, de metoder som beskrivs och som beskrivs ovan tyder på att zebrafiskembryon är mycket användbara vid modellering humana medfödda defekter relaterade till etanol exponering. Vidare har genuttryck förändringar funna i den zebrafisk bekräftats av andrai däggdjur modellsystem 20, vilket tyder på att utvecklingseffekterna av etanol behålls hela ryggradsdjur. Många av de tekniker visade ovan kan användas med andra miljö-eller farmaceutisk förolämpningar för att snabbt och enkelt upptäcka eventuella teratogener och bestämma de underliggande mekanismer som bidrar till teratogenes av ett visst ämne.

Disclosures

Vi har inget att lämna ut.

Acknowledgments

Vi vill tacka Monte Westerfield, Makoto Kobayashi och Jacek Topczewski för gåvor av plasmider för in situ hybridisering och mikroinjektioner mRNA. Vi är tacksamma för Steph Erhard för visas i videon. Vi vill också att erkänna hjälp av William Goossens med konfokalmikroskopi som visas i videon. Tyler Schwend som bilder som används i videon, och Rodney Dale hjälpte till med förberedelserna för videon. Vi erkänner också CMRC personalen djuret vård för djurhållning arbete med zebrafisk. Detta arbete har finansierats av NIH anslag R21 AA13596 till SCA.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
Bedömning Teratogena Förändringar i ett Zebrafish modell av Fetal Alcohol Exponering
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter