Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Evaluación de los cambios teratogénicos en un modelo de pez cebra de la exposición fetal al alcohol

doi: 10.3791/3704 Published: March 20, 2012

Summary

A fin de comprender los mecanismos moleculares de los daños en el desarrollo inducido por etanol, hemos desarrollado un modelo de pez cebra de la exposición de etanol y están explorando las alteraciones físicas, celulares y genéticos que se producen después de la exposición de etanol

Abstract

El síndrome de alcoholismo fetal (SAF) es una manifestación grave de la exposición de embriones de etanol. Se presenta con defectos característicos en la cara y los órganos, incluido el retraso mental debido al desarrollo del cerebro desordenado y dañado. Fetal alcohol trastorno del espectro (EDAF) es un término usado para cubrir una serie continua de defectos congénitos que se producen debido al consumo materno de alcohol, y ocurre en aproximadamente el 4% de los niños nacidos en los Estados Unidos. Con el 50% de las mujeres en edad fértil y notificado un consumo de alcohol, y la mitad de todos los embarazos no planificados es, la exposición involuntaria es un problema constante 2. A fin de comprender mejor los daños producidos por el etanol, además de producir un modelo con el que poner a prueba las posibles intervenciones, hemos desarrollado un modelo de exposición de etanol mediante el desarrollo de embriones de pez cebra. El pez cebra es ideal para este tipo de estudio teratógeno 3-8. Cada pareja pone cientos de huevos, que luego pueden ser recogidos sin dañar el adultopeces. El embrión de pez cebra es transparente y puede ser fácilmente imágenes con cualquier número de manchas. El análisis de estos embriones después de la exposición a etanol a diferentes dosis y tiempos de duración y muestra la aplicación que los defectos graves de desarrollo producidos por el etanol son consistentes con el defecto congénito humano. A continuación se describen las técnicas básicas utilizadas para estudiar y manipular el modelo FAS de pez cebra.

Protocol

1. El etanol tratamiento de los embriones

  1. Embriones de pez cebra derivados de tipo salvaje apareamientos se elevaron a 28 ° C en 5 ml de agua embrión. (Agua Milli-Q con 60 mg / L Instant Ocean). Las diferentes cepas de tipo salvaje embriones tienen tolerancias ligeramente diferentes para el etanol de la exposición 9.
  2. La exposición a etanol se inició en la etapa de cúpula (~ 4,3 horas después de la fertilización, HPF) para la longitud de tiempo deseado, hasta un pulso de 24 horas. Esta etapa inicial es más o menos equivalente a la fase de implantación de los embriones de mamíferos, justo antes de la gastrulación. Las concentraciones de etanol utilizadas oscilan entre el 0,2% -2,5%, volumen / volumen. Las pruebas han demostrado que entre 25-50% de la solución en el agua termina en el embrión en desarrollo 10, 11. Los embriones se mantienen a 28 ° C durante el período de tiempo deseado. Después de la longitud deseada de la exposición de etanol, la solución de etanol-agua es eliminado y reemplazado con tres lavados de agua pez cebra regular y mantenido FOr la longitud de tiempo deseado. La especificidad del defecto depende del tiempo de inicio, la dosis y la duración del pulso de etanol.

2. Recolección de embriones para el ARN, hibridación in situ, anticuerpos, y la tinción de cartílago

  1. Para la recolección del mRNA para qPCR, edad embriones encontrados se recogen en tubos Eppendorf. Tras la eliminación del agua pez cebra, tampón de lisis con TCEP se añade. Un pulverizador motorizado se utiliza para disociar físicamente los embriones en la solución de lisis. Este se pasa entonces a través de una columna preclear, que elimina todos los trozos grandes no disociadas. La solución resultante contiene todas las macromoléculas liberadas por el proceso de lisis. ARN se extrae a continuación mediante la ejecución de esta solución en una columna, seguido de lavados y el tratamiento DNAsa. La elución se realiza a continuación utilizando ya sea agua o una solución de elución proporcionado por el fabricante (5'-emergencia). El ARN puede ser convertido a cDNA utilizando técnicas estándar para qPCR o utilizados en micromatriz de análisis.
  2. Para la hibridación in situ y la tinción de anticuerpos, los embriones de 6 a 24 HPF se fijaron en paraformaldehído al 4% durante toda la noche a 4 ° C. Esto es seguido por 3 lavados en PBS + 0,1% Tween (PBT), para mantener los embriones se peguen entre sí. Los embriones se transfieren entonces a través de una serie de 3 metanol: PBT lava en 100% de metanol, en cuyo punto se puede almacenar a -20 ° C. Estos embriones se pueden utilizar para la hibridación in situ o tinción de anticuerpos. Algunos anticuerpos no funcionan después de tratamiento con metanol, por lo que esta advertencia debe ser tomada en cuenta y su anticuerpo específico probados para determinar si va a trabajar después del tratamiento con metanol.
  3. Para la tinción de cartílago, los embriones deben ser elevado a 5 ó 6 días después de la fertilización (dpf). Luego se fija en el 4% de paraformaldehído durante la noche a 4 ° C, seguido de 3 lavados en PBT.

3. La evaluación inducida por etanol cambios de expresión génica y consecuencias en el desarrollo

    la hibridación in situ. qPCR se logra utilizando los cebadores diseñados con Integrated DNA Technologies (IDT) de software, y luego validado utilizando 3 muestras biológicas distintas. Una vez que los cebadores se han validado, qPCR se realiza en ADNc creado a partir de recolectó muestras de ARN. Cada muestra se realizaron por triplicado. Las reacciones de PCR se ejecutan platino SYBR Green qPCR super mezcla (Invitrogen) en una máquina de croma-4 PCR (BioRad) o similar de la máquina PCR con un sistema de detección multicolor. Además de los genes siendo interrogado, es crítico que un control conjunto de cebadores se utiliza para equilibrar las pequeñas diferencias en la preparación de ADNc o ARN. Para nuestros embriones de pez cebra, se utiliza GAPDH: 5'GAAGGTGGGAAACTGGTCAT3 'y 5'TTGCACCACCCTTAATGTGA3'. Los genes analizados se normalizan a los niveles de GAPDH una cuantificación de la relación de la expresión génica se calcula utilizando la variación del método Pfaffl el 2 de 12. El cálculo normal supone que todos los genes están duplicando el ADN dos veces por cada ciclo, y por lo tanto expresa los datos como una proporción del cambio en el gen experimental sobre el cambio en el gen de referencia, expresado como cálculos de potencia durante el entero "2", que es la eficiencia de la duplicación de ADN por ciclo visto en una perfecta reacción de PCR. El método sustituye a la Pfaffl genérica "2" con el experimentador genera la verdadera eficacia de la PCR elegido. Esto refleja una reflexión más precisa de la diferencia en las reacciones de PCR. La fórmula completa es:
    (Eficiencia de la genética experimental) (Ct de la muestra de control-Ct de la muestra tratada)
    -------------------------------------------------- -----------------------------------
    (Eficiencia de los genes de referencia) (Ctmuestra de control - Ct de la muestra tratada)
  1. Para la hibridación in situ, digoxigenina (DIG)-etiquetados ribosondas se construyen a partir de plásmidos que contienen porciones del gen de interés. Emparejados por edad embriones son expuestos a ribosondas utilizando condiciones estándar 13 y detectado usando anticuerpos anti-dig acoplados a fosfatasa alcalina, que permite la localización de los ribosondas marcadas utilizando una reacción de color (NBT / BCIP). Los embriones son y visualizado en un microscopio Leica disección (Figura 1B-G).
  2. Para evaluar el desarrollo morfogénica, los embriones se recogen en el momento deseado y se examina bajo el microscopio de disección. Por la forma somite, embriones vivos se visualizan 14. Para la distancia entre oculares y de la longitud del cuerpo, los embriones se fijan en PFA. En todos los casos, las imágenes de la región deseada son capturados en un microscopio de disección con un aumento fijo y las mediciones realizadas con Adobe Photoshop software 10,14.
  3. Para examinar los efectos del tratamiento sobre las estructuras del cartílago en desarrollo de la larvas de pez cebra, se utiliza la tinción de azul Alcian. Larvas de pez cebra fijo se tratan con una solución de azul Alcian disolvió en etanol al 80%: 20% de ácido acético glacial (alcohol ácido) durante varias horas o durante la noche. Las larvas se destiñeron en varios lavados de alcohol de ácido antes de ser transferido a un 1% de KOH: 3% de solución de peróxido de hidrógeno para la compensación adicional de las células de pigmento. El pez cebra tienen que ser por lo menos 4 días de edad para mostrar las estructuras del cartílago, y éstos están mejor definidos en los peces que son 5 o 6 días.
  4. La muerte celular en embriones de vida se evaluó a través de naranja de acridina (AO). AO no es permeable a las células a las células vivas, y se une al ADN en las células con membranas comprometidas, incluidos los sometidos a la apoptosis y necrosis. Embriones vivos se incubaron con 5 mg / AO ml en PBS durante 1 hora, seguido de 3 lavados en PBS. Los embriones son entonces imágenes utilizando el microscopio confocal. Digital Z-Series imágenes se combinan para crear materiales compuestos.

4. La manipulación del embrión de pez cebra

  1. Después de la identificación de genes que se disminuyó la exposición de etanol, es posible tratar de reemplazar mediante la inyección de ARNm diseñado para sustituir el gen que falta. ARNm tope se transcribe a partir de plásmidos de ADN linealizado utilizando ARN polimerasa en kits de transcripción in vitro, de acuerdo con las instrucciones del fabricante (mMessage máquina, Applied Biosystems). Entre 25-200 pg / nl de ARN se inyecta en 1-2 huevos de pez cebra celulares etapa, en una solución de 0,1 M de KCl. Los embriones se deja entonces para recuperar antes de ser tratados con etanol como se ha descrito anteriormente (Figura 5).
  2. Para las transcripciones de genes que se incrementan por la exposición al etanol, que puede reducirse, o "derribado" por medio de una tecnología antisentido morfolino. Antisentido morfolinos (AMO) son diseñados por las herramientas de la empresa de genes, y bloquear la traducción del ARN en proteínas, o block la maduración y empalme de ARN, dependiendo de la necesidad de experimentación. Esta acción de morfolinos limitar la cantidad de proteína activa para el gen blanco, un déficit que se puede medir utilizando anitibodies si están disponibles. La eficiencia de los morfolinos empalme de ARN se puede medir por medio de RT-PCR para detectar las cantidades relativas de las transcripciones longitudinalmente y unspliced. Titulante del morfolino puede resultar en dosis-dependiente de la actividad 15. OMAs se diluyen a concentraciones de trabajo (titularse pg a concentración ng) en Danieau solución (58 mM de NaCl, 0,7 mM de KCl, 0,4 mM de MgSO 4, 0,6 mM de Ca (NO 3) 2, 5 mM HEPES, pH 7,6). Inyección se lleva a cabo en la fase 1-2-célula, a continuación, los embriones se permite a desarrollar antes de ser sometido a tratamiento etanol como anteriormente.

5. Los resultados representativos

La exposición embrión de pez cebra a los resultados de etanol en una serie de defectos en el desarrollo y genéticos que están relacionados conlos fenotipos encontrado en otros vertebrados. Hemos documentado el desarrollo anormal de los tejidos axiales, incluyendo la notocorda (datos no mostrados 14). El retraso en el desarrollo producido por etanol al parecer conduce a la disrupción de alargamiento apropiada notocorda, dando lugar a una acortado y ocasionalmente interrumpido notocorda (datos no mostrados 14). Este retraso temprano y defecto notocorda probable conduce en parte a las anomalías más adelante en los somitas (Figura 2), que han perdido su fuerte forma cheurón como se ve en los controles no tratados, y están más cerca de los somitas en forma de U característicos de los fenotipos observados cuando sónica de señalización se reduce 14. El ángulo de los somitas se puede medir el uso de software estándar, y aumenta el ángulo de 92,1 ± 4,6 ° en los controles no tratados a 122,6 ± 6,6 ° en los embriones tratados con etanol (p <0,001).

Otra consecuencia de la exposición de etanol que podría ser downstream de retraso del desarrollo temprano y posteriores defectos notocorda es una longitud acortada del embrión (Figura 3). Incluso la medición de embriones para tener en cuenta la curvatura producida por la exposición de etanol, la exposición etanol conduce a un tronco acortado que es dependiente de la dosis de etanol se expuso que el embrión (Figura 3E 14). Este hallazgo es similar a la persistencia de la talla de la prepubertad corta en los niños expuestos al etanol durante el desarrollo de 16, 17, lo que sugiere que el modelo del pez cebra es relevante para la comprensión de los defectos de nacimiento humano.

Una de las características clásicas de la FAS es una facies clásicas, incluyendo una mandíbula reducida, apertura de los ojos pequeños, y un surco nasolabial liso. Gran parte de estas características están relacionados con una reducción en los tejidos línea media. Se ha demostrado en modelos animales que la exposición a etanol severa conduce a fenotipos aún más pronunciada, incluyendo synopthalmia y ciclopía. Cuando la exposicióncantar embriones de pez cebra a dosis crecientes de etanol, la distancia intraocular (IOD) disminuye de un modo dependiente de la dosis (Figura 4) compatible con la naturaleza del defecto congénito humano. Cyclopia sólo se encuentra con dosis muy altas, pero las dosis más bajas no producen una reducción significativa en el IOD (Figura 4), ​​lo que sugiere que este modelo animal tiene un defecto similar en el desarrollo de la línea media facial 10.

Con el fin de comprender el mecanismo subyacente de los defectos, tanto en el cuerpo y la cara producido por la exposición a etanol, se trató de determinar los cambios de expresión génica que se producen temprano en el desarrollo y que razonablemente se puede esperar de contribuir a los defectos de desarrollo posteriores. Esto se hace de dos maneras, la extracción de ARNm a partir de embriones permite una evaluación cuantitativa de los niveles de expresión génica en embriones de etanol tratados en comparación con los controles (Figura 1A). Además, se puede realizar in situhibridación para mirar el patrón de genes, independientemente de si o no la señal se disminuye (Figura 1B-G 18). En este ejemplo, dos genes cuya expresión se disminuye después de la exposición a etanol se muestran, Gli1 y six3b. Cuando se analizó el patrón de in situ para six3b, encontramos una reducción en la extensión espacial de la expresión de este gen (Figura 1 EG) en los embriones expuestos a etanol. Una reducción similar se encontró en el SGC gen (Figura BD). Tanto six3b y el GSC se expresan en los tejidos destinados a contribuir a los tejidos craneofaciales la línea media. Así la reducción de estos genes en 8 HPF es consistente con la reducción de IOD encontrado más tarde, como se muestra en la Figura 4.

Una vez que los genes que se ven afectados por el etanol se identifican, hay mecanismos por los cuales puede ser la expresión de ellos aumenta o disminuye. En este particular, EXAMPLE, hemos mostrado 2 genes que han disminuido (Gli1 y six3b) por qPCR. Elegimos para inyectar ARNm para determinar si las inversiones de los cambios genéticos pueden mejorar los resultados. Para este experimento, en lugar de la inyección de Gli1, se optó por inyectar shh, un ligando que aumenta los niveles de Gli1. Para six3b, hemos sido capaces de inyectar six3b sí mismo. No se encontraron cambios cuando se inyectan six3b (datos no mostrados), pero fueron capaces de rescatar fundamentalmente los graves defectos en embriones de pez cebra con el suplemento de shh inyecciones (Figura 5).

Figura 1
Figura 1. La exposición etanol cambia el patrón de principios y los niveles de expresión génica de los genes de desarrollo seleccionados. A) qPCR resultados de los embriones en 8hpf. Los resultados de dos genes se muestran: six3b y Gli1. Los resultados muestran como media de tres experimentos separados,y la dosis de etanol que se muestra es del 2,5%. Ambos genes se reducen de manera significativa desde el control (t-test, p <0,05). BG) La hibridación in situ de 8 embriones de pez cebra HPF. Tanto el SGC y los patrones de six3b se alteran en este momento en comparación con los controles. (Modificado con permiso de Loucks et al. 2007).

Figura 2
Figura 2. Desarrollo somitas se altera en embriones tratados. Estructura de los somitas y los ángulos son examinados a las 48 HPF. En los embriones de control (A), somitas tienen una forma de Chevron y un ángulo agudo. Pez cebra expuesto al etanol tiene más ángulos I o somitas en forma de U, y fuerte menos. (Modificado con permiso de Loucks y Ahlgren 2009).

Figura 3
Figura 3. Tratamiento con etanol reduce significativamente la longitud del cuerpo en el pez cebra.La longitud de los embriones no tratados y etanol-expuesta se midieron a 5 días postfertilización. Una reducción significativa en la duración se observó en todos los embriones tratados (ANOVA, p <0,001). BD. Se observó una reducción ligera pero significativa en la longitud total de embriones tratados con 1,0% y 1,5% de etanol, mientras que una mayor reducción se observó en embriones dosificados con 2,0% y 2,5% de etanol. E. Para controlar las diferencias de tamaño en cada embrague, los embriones de control para cada experimento se normalizaron a 100, y los embriones hermanos tratados expresado como un porcentaje de 100. (Modificado con permiso de Loucks y Ahlgren 2009).

Figura 4
Figura 4. Resultados etanol de exposición en una reducción de la distancia intraocular (IOD) en embriones de pez cebra. A) vistas frontales de los embriones muestran fenotipos de los ojos normales y con fusible. B) Las diferentes dosis de etanol administrada durante 3 horas durante la resolución de la gastrulaciónULTS en disminución de iod, cuando los peces se examinan 24 horas después. Ojos fundidos y ciclopía sólo se ven en la dosis más alta probada (2,4%). * Indica una reducción significativa en comparación con los controles IOD. (Modificado con autorización de Ahlgren, 2004).

Figura 5
Figura 5. Shh-N inyección de ARNm rescata a los grandes defectos producidos por la exposición al etanol de pez cebra. Uno-dos embriones de células se inyectaron con 100 pg / nl shh-N ARNm y la mitad de los embriones inyectados fueron expuestos a las dosis estándar de etanol 4,3 a 24 HPF. Los embriones fueron analizados a las 5 de DPF. Los embriones tratados con 2,0% de etanol exhiben dorsal curvada colas más cortas, las somitas en forma de I, y los defectos de los ojos, incluyendo ciclopía. Rescate de estos fenotipos se ve en 71/76 de embriones inyectados (93%). En estos embriones, el cuerpo es recta, los somitas son en forma de chevron, y los ojos están separados por completo.

Discussion

Los métodos descritos aquí y los resultados mostrados demuestran que la punta del pez cebra cómo se puede utilizar para interrogar a defectos de desarrollo. Debido a la accesibilidad del embrión, elevado número de huevos puestos por cada embrague, y una alta reproducibilidad de los resultados, estos vertebrados son ideales para los estudios teratogénicos. Los peces también pueden ser manipuladas para contener moléculas fluorescentes para usar como un reportero visual para un gen particular o vía de interés 19. En los estudios de etanol, las dosis utilizadas parecen ser bastante alta en comparación con los niveles en sangre de mamíferos alcohol. Sin embargo, estos niveles reflejan lo que está presente en el agua, y no todo el etanol se entrega al embrión.

En conjunto, los métodos descritos y detallados anteriormente sugieren que los embriones de pez cebra son muy útiles en el modelado de los defectos congénitos humanos relacionados con la exposición de etanol. Por otra parte, los cambios de expresión génica que se encuentran en el pez cebra han sido confirmados por otrosen los sistemas modelo de mamífero 20, lo que sugiere que los efectos sobre el desarrollo de etanol se conservan a través de los vertebrados. Muchas de las técnicas demostradas anteriormente se puede utilizar con otros insultos ambientales o farmacéutica para detectar rápida y fácilmente teratógenos potenciales y determinar los mecanismos subyacentes que contribuyen a la teratogénesis de una sustancia particular.

Disclosures

No tenemos nada que revelar.

Acknowledgments

Queremos agradecer a Monte Westerfield, Makoto Kobayashi y Topczewski Jacek por los dones de plásmidos para la hibridación in situ y la microinyección de mRNA. Estamos muy agradecidos a Steph Erhard por aparecer en el video. También queremos agradecer la asistencia de William Goossens con la microscopía confocal se muestra en el video. Tyler Schwend siempre las imágenes utilizadas en el video, y Rodney Dale contribuyó a la preparación para el vídeo. También agradecemos al personal de cuidado de los animales CMRC por su trabajo con la cría del pez cebra. Este trabajo fue financiado por el NIH subvención R21 AA13596 SCA.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
Evaluación de los cambios teratogénicos en un modelo de pez cebra de la exposición fetal al alcohol
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter