Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Evaluering Teratogene Ændringer i en Zebrafisk Model af Føtalt Alkohol Eksponering

doi: 10.3791/3704 Published: March 20, 2012

Summary

For at forstå de molekylære mekanismer i ethanol-induceret udviklingsmæssige skader, har vi udviklet en zebrafisk model af ethanol eksponering og er ved at undersøge de fysiske, cellulære og genetiske ændringer, der opstår efter ethanol eksponering

Abstract

Føtalt Alkohol Syndrom (FAS) er en alvorlig manifestation af embryonale eksponering til ethanol. Det præsenterer med karakteristiske fejl til ansigt og organer, herunder mental retardering på grund af uorden og beskadigede hjernens udvikling. Føtalt Alkohol spektrum forstyrrelse (FASD) er en term, der anvendes til at dække et kontinuum af medfødte defekter, der opstår på grund af moderens alkoholforbrug, og forekommer hos ca 4% af børn født i USA. Med 50% af den fødedygtige alder kvinder rapportering forbrug af alkohol, og halvdelen af alle graviditeter er uplanlagte, er utilsigtet eksponering en løbende udstedelse 2. For bedst muligt at forstå de skader, der produceres af ethanol, samt producerer en model med til at afprøve mulige interventioner, udviklede vi en model af udviklingstoksicitet ethanol eksponering ved hjælp af zebrafisk embryo. Zebrafisk er ideelle til denne form for teratogen undersøgelse 3-8. Hvert par lægger hundredvis af æg, som derefter kan indsamles uden at skade den voksnefisk. Zebrafisken embryo er transparent og kan let afbildes med et vilkårligt antal pletter. Analyse af disse embryoner efter udsættelse for ethanol i forskellige doser og tidspunkter af varighed og ansøgningen viser, at de grove udviklingsmæssige defekter produceret af ethanol er i overensstemmelse med den menneskelige misdannelse. Beskrevet her er de grundlæggende teknikker, der anvendes til at studere og manipulere zebrafisk FAS model.

Protocol

1. Ethanol Behandling af embryoer

  1. Zebrafisk embryoner fra vildtype-parringer blev rejst ved 28 ° C i 5 ml foster vand. (Milli-Q-vand med 60 mg / L Instant Ocean). Forskellige stammer af vildtype-fostre har lidt forskellige tolerancer til ethanol eksponering 9.
  2. Eksponering for ethanol blev initieret ved kuppel trin (~ 4,3 timer efter befrugtning, HPF) til den ønskede længde af tid, op til en 24 timers puls. Denne første etape svarer nogenlunde til implantering fase af pattedyr embryoner, lige inden gastrulation. Ethanolkoncentrationer anvendes intervallet fra 0,2% -2,5%, volumen / volumen. Tests har vist, at mellem 25-50% af opløsningen i vand ender i det udviklende embryo 10, 11. Embryoer holdes ved 28 ° C i det ønskede tidsrum. Efter den ønskede længde af ethanol eksponering, er ethanol-vand-opløsningen fjernet og erstattet med tre vaskninger med regelmæssig zebrafisk vand og holdes for det ønskede tidsrum. Specificiteten af ​​defekten afhænger af tidspunktet for indtræden, dosis og varigheden af ​​impulsen af ​​ethanol.

2. Samling af embryoer til RNA in situ hybridisering, antistof og brusk farvning

  1. At indsamle mRNA for qPCR, er alder matchede embryoner i eppendorfrør. Efter fjernelse af zebrafisk vand, lyseringspuffer med TCEP tilsat. En motoriseret knuser anvendes til fysisk at adskille embryonerne i lyseopløsning. Dette føres derefter gennem en præclear søjle, der fjerner eventuelle udissocierede store stykker. Den resulterende opløsning indeholder alle de makromolekyler, der frigives ved lysis processen. RNA ekstraheres derefter ved at køre denne opløsning på en søjle, efterfulgt af vask og DNase-behandling. Eluering udføres derefter under anvendelse af enten vand eller en elueringsopløsning tilvejebragt af producenten (5'-Prime). RNA'et kan omdannes til cDNA under anvendelse af standardteknikker til qPCR eller anvendes i mikromatrix-analyse.
  2. For in situ hybridisering og antistof-farvning, embryoer fra 6 til 24 HPF blev fikseret i 4% paraformaldehyd natten over ved 4 ° C. Dette efterfølges af 3 vaske i PBS + 0,1% Tween (PBT), for at holde embryoner i at klæbe sammen. Embryoer overføres derefter gennem en række af tre methanol: PBT vasker i 100% methanol, hvorefter de kan opbevares ved -20 ° C. Disse embryoer kan anvendes til in situ hybridisering eller antistoffarvning. Nogle antistoffer virker ikke efter methanol behandling, denne advarsel så skal tages i betragtning, og din specifikke antistof testet for at bestemme om det vil fungere efter methanol behandling.
  3. For brusk farvning skal embryoer hæves til 5 eller 6 dage efter befrugtning (dpf). De bliver derefter fikseret i 4% paraformaldehyd natten over ved 4 ° C, efterfulgt af 3 vaske i PBT.

3. Vurdering af ethanol-induceret genekspression Ændringer og udviklingsmæssige konsekvenser

    og in situ hybridisering. qPCR opnås ved hjælp af primere designet med integreret DNA Technologies (IDT) software, og derefter valideret ved anvendelse af 3 forskellige biologiske prøver. Når primere er blevet valideret, er qPCR udføres på cDNA skabt ud fra indsamlede RNA-prøver. Hver prøve kørt tredobbelt. PCR-reaktioner kørt platin SYBR Green qPCR Super blanding (Invitrogen) i en Chroma-4 PCR maskine (BioRad) eller lignende PCR maskine med en flerfarvet detektionssystem. Ud over de gener, der forespurgt, er det vigtigt, at en kontrolgruppe af primere anvendes til at afbalancere små forskelle i cDNA eller RNA-præparat. For vores zebrafisk embryoner, bruger vi GADPH: 5'GAAGGTGGGAAACTGGTCAT3 'og 5'TTGCACCACCCTTAATGTGA3'. Gener, der analyseres derefter normaliseret til GAPDH niveauer en relativ kvantificering af genekspression beregnes under anvendelse af Pfaffl fremgangsmåden variation 2 12. Den normale Beregningen antager, at alle gener overlapning DNA to gange for hver cyklus, og således udtrykker dataene i forhold til ændringen i den eksperimentelle genet over ændringen i reference-genet, udtrykkes som strøm beregninger over hele tal "2", som er effektiviteten af ​​en fordobling af DNA per cyklus set i en perfekt PCR-reaktion. Den Pfaffl erstatter den generiske "2" med eksperimentatoren genereret sande effektivitet for PCR valgte primere. Det afspejler en mere nøjagtig afspejling af forskellen i PCR-reaktioner. Den fulde formel er:
    (Effektivitet af eksperimentel gen) (Ct af kontrolprøve-CT af behandlet prøve)
    -------------------------------------------------- -----------------------------------
    (Effektivitet reference gen) (Ct afkontrolprøve - CT af behandlet prøve)
  1. For in situ hybridisering, (dig) digoxigenin-mærkede riboprober er konstrueret af plasmider indeholdende dele af genet af interesse. Aldersmatchede embryoer udsættes for riboprober under anvendelse af standardbetingelser 13 og detekteres under anvendelse af anti-Dig-antistoffer koblet til alkalisk phosphatase som tillader placeringen af de mærkede riboprober med en farvereaktion (NBT / BCIP). Embryoer derefter visualiseret under anvendelse af et Leica dissektionsmikroskop (fig. 1B-G).
  2. For at vurdere morfogent udvikling, er embryoner opsamles på det ønskede tidspunkt og undersøgt under dissektionsmikroskop. For somit form, er levende fostre afbildet 14. For bl.a. okulær afstand og kropslængde, er embryoner fastsat i PFA. I alle tilfælde er billeder af den ønskede region indfanget på et dissektionsmikroskop med en fast forstørrelse taget, og målinger med Adobe Photoshop software 10,14.
  3. For at undersøge effekten af ​​behandlingen på udviklingslandene bruskstrukturer i larve zebrafisk, bruger vi Alcian blå farvning. Fast zebrafisk larver behandlet med Alcian blå opløsning opløst i 80% ethanol: 20% iseddikesyre (syre-alkohol) i flere timer eller natten over. Larver affarvet i adskillige vaske af syre-alkohol, før de overføres til en 1% KOH: 3% hydrogenperoxidopløsning til yderligere rensning af pigment celler. Zebrafisk skal være mindst 4 dage gamle at vise brusk strukturer, og disse er bedre defineret i fisk, er 5 eller 6 dage gamle.
  4. Celledød i levende embryoner vurderes ved anvendelse af acridinorange (AO). AO er ikke celle-permeable for levende celler, og binder til DNA i celler med kompromitterede membraner, herunder undergår apoptose og nekrose. Levende embryoner inkuberes med 5 mg / ml AO i PBS i 1 time, efterfulgt af 3 vaske i PBS. Embryoer derefter afbildes ved hjælp af konfokal mikroskopi. Digital Z-SerIES billeder kombineres for at skabe kompositter.

4. Manipulering af Zebrafisk Embryo

  1. Efter identifikation af gener, der faldt ethanol eksponering, er det muligt at forsøge at erstatte dem med injektion af mRNA udformet til at erstatte den manglende gen. Udjævnede mRNA transkriberet fra lineariserede DNA-plasmider med RNA-polymerase in vitro transcriptionsvektorer kits ifølge producentens instruktioner (mMessage Machine, Applied Biosystems). Mellem 25-200 pg / nl af RNA injiceres 1-2 cellestadieembryoner zebrafisk æg i en opløsning af 0,1 M KCI. Fostre fik derefter lov at komme før den blev behandlet med ethanol som beskrevet ovenfor (fig. 5).
  2. For enhver gen-transkripter, der er forhøjet med ethanol eksponering, kan de blive reduceret, eller "slået-down" ved hjælp af en antisense morpholino teknologi. Antisense morpholinos (AMOS) er designet af firmaet Gene Tools, og blokere oversættelse af RNA til protein, eller block modning og splejsning af RNA, afhængigt af eksperimentelle behov. Denne virkning af morpholinos begrænse mængden af ​​aktivt protein til målrettet gen, et underskud, der kan måles ved anvendelse Antistofdannelse hvis de er tilgængelige. Effektiviteten af ​​RNA-splejsningssystemer morpholinos kan måles under anvendelse af RT-PCR til påvisning af de relative mængder af splejsede og ikke-splejsede transkripts. Titrering af morpholino kan resultere i dosisafhængig aktivitet 15. AMOS fortyndes til arbejder koncentrationer (titreret pg til ng koncentration) i Danieau opløsning (58 mM NaCl, 0,7 mM KCI, 0,4 mM MgSO4, 0,6 mM Ca (NO3) 2, 5 mM HEPES, pH 7,6). Injektion finder sted på 1-2-celle stadiet, derefter embryoer får lov at udvikle sig, inden de underkastes ethanol behandles som ovenfor.

5. Repræsentative resultater

Zebrafisk embryo udsættelse for ethanol resulterer i en række udviklings-og genetiske defekter, der er relateret tilfænotyperne findes i andre hvirveldyr. Vi har dokumenteret unormal udvikling af aksiale væv, herunder rygstrengen (data ikke vist 14). Udviklingsmæssige forsinkelse som ethanol tilsyneladende fører til forstyrrelse af korrekt rygstrengen forlængelse, hvilket fører til en kortere og undertiden afbrudt rygstrengen (data ikke vist 14). Denne tidlige forsinkelse og rygstrengen defekt sandsynligvis fører til dels de senere abnormiteter i somitter (fig. 2), som har mistet deres stærke chevron form som set i de ubehandlede kontroller, og som er tættere på de U-formede somitter karakteristiske fænotyper ses, når sonisk signalering reduceres 14. Vinklen af somitter kan måles ved anvendelse af standard software, og vinklen øges fra 92,1 ± 4,6 ° i de ubehandlede kontroller 122,6 ± 6,6 ° i ethanol behandlede embryoer (p <0,001).

En anden konsekvens af ethanol eksponering, der kan være downstream tidlig forsinket udvikling og senere rygstrengen defekter er en afkortet længde af embryo (figur 3). Selv måling embryoer for at tage hensyn til krumningen fremstillet af ethanol eksponering, ethanol eksponering fører til en kortere stammen, der er afhængig af dosis af ethanol embryonet blev udsat for (figur 3E 14). Dette resultat svarer til de vedvarende prepuberty korte statur hos børn udsat for ethanol under udvikling 16, 17, tyder på, at zebrafisk model er relevant for forståelsen af den menneskelige misdannelse.

Et af de klassiske kendetegn ved FAS er en klassisk facies, herunder en reduceret kæbe, små øjne åbning, og en glat philtrum. Mange af disse egenskaber er relateret til en reduktion i midterlinien væv. Det er blevet påvist i dyremodeller, at alvorlig ethanol eksponering fører til endnu mere udtalte fænotyper, herunder synopthalmia og cyclopia. Når exposynge zebrafisk embryoer øgede doser af ethanol, intraokulære afstanden (IOD) falder på en dosisafhængig måde (figur 4) i overensstemmelse med arten af det humane misdannelse. Cyclopia findes kun med meget høje doser, men lavere doser kan frembringe en signifikant reduktion i IOD (figur 4), hvilket antyder, at denne dyremodel har en lignende defekt i midterlinien ansigtet udvikling 10.

For at forstå mekanismen bag de mangler både kroppen og ansigtet fremstillet af ethanol eksponering, søgte vi at etablere genekspressionssystemer ændringer, der forekommer tidligt i udviklingen og som med rimelighed kan forventes at bidrage til senere udviklingsmæssige defekter. Vi gøre dette på to måder, ekstraktion af mRNA fra embryoer tillader en kvantitativ vurdering af niveauerne af genekspression i ethanol behandlede embryoer sammenlignet med kontroller (figur 1A). Desuden kan vi udføre in situhybridisering til se på mønstret af gener, uanset hvorvidt signalet formindskes (fig. 1B-G 18). I dette eksempel er to gener, hvis ekspression er formindsket efter udsættelse for ethanol vist gli1 og six3b. Når vi undersøgt in situ mønster for six3b, fandt vi en reduktion i den rumlige udstrækning af ekspressionen af dette gen (fig. 1 EG) i embryoner der er udsat for ethanol. En tilsvarende reduktion blev fundet i genet GSR (fig. BD). Både six3b og GSC udtrykkes i væv, der er bestemt til at bidrage til kraniofaciale midterlinjen væv. Således reduktion af disse gener ved 8 HPF er i overensstemmelse med reduktionen i IOD findes senere som vist i figur 4.

Når gener, der er ramt af ethanol er identificeret, er der mekanismer, som udtryk for dem kan øges eller mindskes. I dette særlige EXAmple har vi vist, 2-gener, der er reduceret (gli1 og six3b) ved qPCR. Vi valgte at injicere mRNA at afgøre, om at vende denne gen-ændringer kan forbedre resultaterne. Til dette eksperiment, i stedet for injektion gli1 valgte vi at indsprøjte Shh, en ligand, som forøger gli1 niveauer. For six3b, var vi i stand til at injicere six3b sig selv. Fandt vi ingen ændringer når vi injiceret six3b (data ikke vist), men var i stand til grundlæggende redde de grove fejl i zebrafisk embryoner med supplerende Shh injektioner (figur 5).

Figur 1
Figur 1. Ethanol eksponering ændrer den tidlige mønster og genekspressionsniveauer af udvalgte udviklingsmæssige gener. A) qPCR resultater embryoer 8hpf. Resultaterne for to gener vises: six3b og gli1. Resultaterne er vist som gennemsnit af tre separate forsøg,og dosen af ​​ethanol vist er 2,5%. Begge gener er reduceret på en måde, der er signifikant fra kontrol (t-test, p <0,05). BG) In situ-hybridisering af 8 HPF zebrafisk embryoer. Både GSC og six3b mønstre er ændret på dette tidspunkt i forhold til kontrolgruppen. (Modificeret med tilladelse fra Loucks et al. 2007).

Figur 2
Figur 2. Somit udvikling ændres i behandlede embryoer. Somit struktur og vinkler er undersøgt på 48 HPF. I kontrol-embryoer (A), somitter har en vinkel form og en skarp vinkel. Ethanol eksponerede zebrafisk har flere I-eller U-formede somitter, og mindre skarpe vinkler. (Modificeret med tilladelse fra Loucks og Ahlgren 2009).

Figur 3
Figur 3. Ethanol behandling signifikant nedsætter kropslængde i zebrafisk.Længden af ​​ubehandlede og ethanol-eksponerede embryoer blev målt ved 5 dage postfertilization. En signifikant reduktion i længden blev set i alle behandlede embryoer (ANOVA, p <0,001). BD. Der var en lille, men signifikant reduktion i den totale længde af embryoer blev behandlet med 1,0% og 1,5% ethanol, hvorimod en større reduktion blev set i embryoer doseret med 2,0% og 2,5% ethanol. E. Til kontrol for størrelsesforskelle i hver kobling blev kontrol embryoer til hvert eksperiment normaliseret til 100, og søskende behandlede embryoer udtrykt som en procentdel af 100. (Modificeret med tilladelse fra Loucks og Ahlgren 2009).

Figur 4
Figur 4. Ethanol eksponering resulterer i en reduktion i den intraokulære afstand (IOD) i zebrafisk embryoner. A) systemer til frontal udsigt til embryoner viser normale og smeltet øjne fænotyper. B) Forskellige doser ethanol administreret i 3 timer under gastrulation resÜLTS i faldet IoD når fisk er undersøgt 24 timer senere. Fusionerede øjne og cyclopia ses kun ved den højeste dosis testet (2,4%). * Angiver en signifikant reduktion i IOD sammenlignet med kontroller. (Modificeret med tilladelse fra Ahlgren, 2004).

Figur 5
Figur 5. SHH-N mRNA injektion redder de grove fejl, der produceres af ethanol eksponering af zebrafisk. En til to celle embryoer blev injiceret med 100 pg / nl SHH-N mRNA og halvdelen af de injicerede embryoner blev udsat for faste ethanol doser fra 4,3 til 24 HPF. Embryoer blev analyseret ved 5 dpf. Embryoner behandlet med 2,0% ethanol udviser dorsalt buet kortere haler, I-formede somitter og øjen-defekter, herunder cyclopia. Redning af disse fænotyper ses i 71/76 af injicerede embryoner (93%). I disse embryoer, er legemet lige, somitter er Chevron formet, og øjnene er helt adskilt.

Discussion

De her beskrevne metoder, og de viste resultater demonstrerer kun toppen af ​​hvordan zebrafisk kan anvendes til at forespørge udviklingsmæssige defekter. På grund af tilgængeligheden af ​​embryonet, høje antal æg, der for hver kobling, og høj reproducerbarhed af resultaterne disse hvirveldyr er ideelle til teratogenisitetsundersoegelser. Fisk kan også manipuleres til at indeholde fluorescerende molekyler til anvendelse som en visuel reporter for et bestemt gen eller pathway af interesse 19. I ethanol undersøgelser synes de anvendte doser ret højt sammenlignet med pattedyr alkohol i blodet. Men disse niveauer afspejler, hvad der er til stede i vandet, og ikke alle af ethanol leveres til fosteret.

Tilsammen er de beskrevne metoder og beskrevet ovenfor, tyder på, at zebrafisk embryoner er meget nyttige i modellering menneskelige fosterskader relateret til ethanol eksponering. Desuden har genekspressionssystemer ændringer fundet i zebrafisk blevet bekræftet af andrei mammale modelsystemer 20, hvilket antyder, at de udviklingsmæssige virkningerne af ethanol fastholdes på tværs hvirveldyr. Mange af de teknikker påvist ovenfor kan bruges sammen med andre miljø-eller farmaceutiske fornærmelser til hurtigt og nemt at afsløre potentielle teratogener og bestemme de underliggende mekanismer, der bidrager til teratogenese af et bestemt stof.

Disclosures

Vi har intet at afsløre.

Acknowledgments

Vi vil gerne takke Monte Westerfield, Makoto Kobayashi og Jacek Topczewski for gaver af plasmider til in situ hybridisering og mRNA microinjections. Vi er taknemmelige for Steph Erhard for optræder i videoen. Vi ønsker også at anerkende bistand fra William Goossens med konfokal mikroskopi vist i videoen. Tyler Schwend forudsat billeder brugt i videoen, og Rodney Dale bistået med forberedelse til videoen. Vi anerkender også de CMRC dyret plejepersonalet for deres opdræt arbejde med zebrafisk. Dette arbejde blev finansieret af NIH tilskud R21 AA13596 til SCA.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
Evaluering Teratogene Ændringer i en Zebrafisk Model af Føtalt Alkohol Eksponering
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter