Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Vurdere Teratogene Endringer i en sebrafisk Model of Fetal Alcohol Exposure

doi: 10.3791/3704 Published: March 20, 2012

Summary

For å forstå de molekylære mekanismene i etanol-indusert utviklingsmessige skader, har vi utviklet en sebrafisk modell av etanol eksponering og utforsker de fysiske, cellulære og genetiske forandringer som oppstår etter etanol eksponering

Abstract

Føtalt alkoholsyndrom (FAS) er en alvorlig manifestasjon av embryonale eksponering for etanol. Den presenterer med karakteristiske defekter til ansikt og organer, inkludert mental retardasjon grunn uordnede og skadet hjernens utvikling. Fetal alkohol spektrum lidelse (FASD) er et begrep som brukes til å dekke et kontinuum av fødselsskader som oppstår på grunn av mors alkoholbruk, og forekommer hos ca 4% av barn født i USA. Med 50% i fertil alder kvinner rapporterer forbruk av alkohol, og halvparten av alle svangerskap er planlagt, er utilsiktet eksponering en vedvarende problem to. For å best forstå skaden produsert av etanol, pluss lage en modell som å teste potensielle intervensjoner, utviklet vi en modell av utviklingsmessige etanol eksponering ved hjelp av sebrafisk embryo. Sebrafisk er ideelle for denne typen teratogen studien 3-8. Hvert par legger hundrevis av egg, som deretter kan samles uten å skade den voksnefisk. Sebrafisk embryo er gjennomsiktig og kan lett avbildes med et ubegrenset antall flekker. Analyse av disse embryoer etter eksponering for etanol på forskjellige doser og tidspunkter av varighet og programmet viser at brutto utviklingsmessige defekter produsert av etanol er i overensstemmelse med den menneskelige fødsel defekt. Beskrevet her er de grunnleggende teknikkene som brukes til å studere og manipulere sebrafisk FAS-modellen.

Protocol

1. Etanol Behandling av befruktede egg

  1. Sebrafisk embryoer avledet fra villtype parringer ble reist ved 28 ° C i 5 ml embryo vann. (Milli-Q vann med 60 mg / L Instant Ocean). Ulike stammer av vill type embryoer har litt forskjellige toleranser til etanol eksponering 9.
  2. Eksponering for etanol ble initiert ved Dome stadium (~ 4,3 timer etter befruktning, HPF) for ønsket lenge, opp til en 24 timers puls. Dette begynner stadiet er omtrent tilsvarer implantasjon stadiet av pattedyr embryoer, like før gastrulation. Etanol konsentrasjoner brukt varierer fra 0,2% -2,5%, volum / volum. Tester har vist at mellom 25-50% av løsningen i vannet ender opp i utvikling av embryo 10, 11. Embryoer opprettholdes på 28 ° C for ønsket tidsrom. Etter ønsket lengde av etanol eksponering, er etanol-vann løsning fjernet og erstattet med tre vasker med vanlig sebrafisk vann og vedlikeholdt FOr ønsket lenge. Spesifisiteten av mangelen avhenger av tidspunktet for debut, dosen, og lengden på pulsen av etanol.

2. Innsamling av embryoer for RNA, in situ hybridisering, antistoff, og brusk Farging

  1. Å samle mRNA for qPCR, er alder matchet embryo innsamlet i Eppendorf rør. Etter fjerning av sebrafisk vann, blir lysis buffer med TCEP lagt til. En motorisert finknuser brukes til fysisk skille embryoene i lysis løsningen. Dette blir så gått gjennom en preclear kolonne, som fjerner eventuelle undissociated store biter. Den resulterende løsningen inneholder alle de makromolekyler utgitt av lysis prosessen. RNA blir deretter ekstrahert ved å kjøre denne løsningen på en kolonne, fulgt av vask og DNAse behandling. Eluering er deretter utført ved hjelp av enten vann eller en eluering løsning levert av produsenten (5'-Prime). RNA kan konverteres til cDNA ved hjelp av standard teknikker for qPCR eller brukes i mikromatrise analyse.
  2. For in situ hybridisering og antistoff farging, embryo fra 6-24 HPF ble fiksert i 4% paraformaldehyde natten ved 4 ° C. Dette etterfølges av 3 vasker i PBS + 0,1% Tween (PBT), for å holde embryoer ikke henger sammen. Embryoet blir deretter overført gjennom en serie av tre metanol: PBT skyller inn 100% metanol, og da de kan lagres ved -20 ° C. Disse embryoene kan brukes til in situ hybridisering eller antistoff farging. Noen antistoffer virker ikke etter metanol behandling, så dette forbeholdet må tas hensyn til og dine spesifikke antistoff testet for å avgjøre om det vil fungere etter metanol behandling.
  3. For brusk farging, embryo må heves til 5 eller 6 dager etter befruktning (DPF). De blir deretter fiksert i 4% paraformaldehyde natten ved 4 ° C, etterfulgt av 3 vasker i PBT.

3. Vurdere Etanol-indusert genekspresjon Endringer og utviklingsmessige konsekvenser

    in situ hybridisering. qPCR oppnås ved hjelp av primere er designet med integrert DNA Technologies (IDT) programvare, deretter validert med 3 separate biologiske prøver. Når primere har blitt validert, er qPCR utført på cDNA opprettet fra Collected RNA prøver. Hver prøve drives i tre eksemplarer. PCR reaksjoner kjøres Platinum SYBR Grønn qPCR Super mix (Invitrogen) på en Chroma-4 PCR maskin (BioRad) eller lignende PCR maskin med et avansert deteksjon system. I tillegg til de genene bli avhørt, er det avgjørende at en kontroll sett primere brukes til å balansere små forskjeller i cDNA eller RNA forberedelse. For våre sebrafisk embryoer, bruker vi gapdh: 5'GAAGGTGGGAAACTGGTCAT3 'og 5'TTGCACCACCCTTAATGTGA3'. Gener blir analysert er så normalisert til gapdh nivåer en relativ kvantifisering av genuttrykk beregnes etter Pfaffl metode variasjon på 2 12. Den normale Beregningen forutsetter at alle gener dupliserer DNA to ganger for hver syklus, og dermed uttrykker dataene som forholdet mellom endringen i den eksperimentelle genet over endring i referansen genet, uttrykt som styrkeberegning over heltall "2", som er effektiviteten av dobling av DNA per syklus sett i en perfekt PCR reaksjon. Den Pfaffl Metoden erstatter generiske "2" med eksperimentator generert sanne effektiviteten for PCR primere valgt. Det reflekterer en mer nøyaktig refleksjon av forskjellen i PCR reaksjoner. Den fullstendige formelen er:
    (Effektiviteten av eksperimentell genet) (Ct av kontrollutvalget-CT av behandlet prøve)
    -------------------------------------------------- -----------------------------------
    (Effektiviteten av referanse gen) (Ct avkontrollutvalget - CT av behandlet prøve)
  1. For in situ hybridisering, digoxigenin (dig)-merkede riboprobes er konstruert av plasmider som inneholder deler av genet av interesse. Samme alder fostre blir eksponert for riboprobes bruker standardvilkår 13 og oppdaget ved hjelp av anti-DIG antistoffer koblet til alkalisk fosfatase som gjør plasseringen av de merkede riboprobes ved hjelp av en farge reaksjon (NBT / BCIP). Embryoet blir deretter visualiseres ved hjelp av en Leica dissekere mikroskop (figur 1B-G).
  2. For å vurdere morphogenic utvikling, er embryoer samlet på ønsket tidspunkt og undersøkt under dissekere mikroskop. For somitt form, er levende embryoer avbildes 14. For inter okulær avstand og kroppslengde, er embryoer fast i PFA. I alle tilfeller er bilder av ønsket region fanget på en dissekere mikroskop til en fast forstørrelse og målinger tatt ved hjelp av Adobe Photoshop software 10,14.
  3. For å undersøke effekten av behandlingen på utviklingslandenes brusk strukturene i larvenes sebrafisk, bruker vi Alcian Blå flekker. Fast sebrafisk larver blir behandlet med Alcian blå løsning oppløst i 80% etanol: 20% iseddik (syre alkohol) i flere timer eller over natten. Larvene blir destained i flere vask av syre alkohol før de ble overført til en 1% KOH: 3% hydrogenperoksid løsning for videre rydding av pigmentceller. Sebrafisk må være minst 4 dager gamle for å vise brusk strukturer, og disse er bedre definert i fisk som er 5 eller 6 dager gammel.
  4. Celledød i levende embryoer vurderes ved hjelp Acridine Orange (AO). AO er ikke celle gjennomtrengelig for levende celler, og binder seg til DNA i cellene med kompromitterte membraner, inkludert de som gjennomgår apoptose og nekrose. Levende embryoer inkuberes med 5 mg / ml AO i PBS i 1 time, etterfulgt av 3 vasker i PBS. Embryoet blir deretter avbildes bruker confocal mikroskop. Digital Z-serIES bildene kombineres for å lage kompositter.

4. Manipulere sebrafisk Embryo

  1. Etter identifisering av gener som er redusert med etanol eksponering, er det mulig å prøve å erstatte dem med injeksjon av mRNA designet for å erstatte den manglende genet. Avkortet mRNA er transkribert fra lineært DNA plasmider ved hjelp av RNA polymerase in vitro transkripsjon kits, i henhold til produsentens anvisning mMessage Machine, Applied Biosystems). Mellom 25-200 pg / NL av RNA er sprøytet inn 1-2 celle scene sebrafisk egg, i en løsning av 0,1 M KCl. Embryoet er da lov å komme før de blir behandlet med etanol som beskrevet ovenfor (figur 5).
  2. For eventuelle genet transkripsjoner som økte med etanol eksponering, kan de bli redusert, eller "slått ned" ved hjelp av en antisens Morpholino teknologi. Antisens morpholinos (Amos) er designet av selskapet Gene Tools, og blokkere oversettelse av RNA til protein, eller block modning og skjøting av RNA, avhengig av eksperimentelle behovet. Denne handlingen av morpholinos begrense mengden av aktive protein for genet målrettet, et underskudd som kan måles ved hjelp anitibodies hvis de er tilgjengelige. Effektiviteten av RNA-spleising morpholinos kan måles ved hjelp av RT-PCR for å oppdage de relative mengdene av spleises unspliced ​​transkripsjoner. Titrere av Morpholino kan resultere i doseavhengig aktivitet 15. AMOS fortynnes til arbeider konsentrasjoner (titrert pg til ng konsentrasjon) i Danieau løsning (58 mM NaCl, 0,7 mM KCl, 0.4 mM MgSO 4, 0,6 mm Ca (NO 3) 2, 5 mm HEPES, pH 7,6). Injeksjon finner sted på 1-2-celle stadium, da embryoene får lov til å utvikle før de blir utsatt for etanol behandling som ovenfor.

5. Representative Resultater

Sebrafisk embryo eksponering for etanol resultater i en rekke utviklings-og genetiske defekter som er relatert tilde fenotyper funnet i andre virveldyr. Vi har dokumentert unormal utvikling av aksiale vev, inkludert ryggstreng (data ikke vist 14). Den utviklingsmessige forsinkelser produsert av etanol fører tilsynelatende til forstyrrelse av riktig ryggstreng forlengelse, fører til en kortere og noen ganger forstyrret ryggstreng (data ikke vist 14). Denne tidlige forsinkelsen og ryggstreng mangel fører trolig delvis den senere unormalt i somites (figur 2), som har mistet sin sterke Chevron form som sett i de ubehandlede kontroller, og er nærmere de u-formede somites karakteristiske for fenotyper sett når sonic signalisering reduseres 14. Vinkelen på somites kan måles ved hjelp av standard programvare, og vinkelen øker fra 92,1 ± 4,6 ° i ubehandlede kontroller til 122,6 ± 6,6 ° i etanol behandlede embryoene (p <0,001).

En annen konsekvens av etanol eksponering som kan være downstream av tidlig forsinket utvikling og senere ryggstreng defekter er en forkortet lengden av embryoet (Figur 3). Selv måling embryoer å ta hensyn til kurvaturen produsert av etanol eksponering fører etanol eksponering til en forkortet trunk som er avhengig av dose av etanol embryoet ble utsatt for (figur 3E 14). Dette funnet er lik den utholdenhet av prepuberty kortvoksthet hos barn eksponert for etanol under 16 utvikling, 17, tyder på at sebrafisk-modellen er relevant for forståelsen av den menneskelige fødsel defekt.

En av de klassiske kjennetegn ved FAS er et klassisk facies, inkludert en redusert kjeve, liten øye åpning, og en jevn philtrum. Mye av disse funksjonene er knyttet til en reduksjon i midtlinjen vev. Det har blitt vist i dyremodeller at alvorlig etanol eksponering fører til enda mer uttalt fenotyper, herunder synopthalmia og cyclopia. Når exposynge sebrafisk embryoer til økte doser av etanol, synker den intraokulære avstand (IOD) i en doseavhengig måte (figur 4) i tråd med natur menneskelige fødsel defekt. Cyclopia finnes bare med svært høye doser, men lavere doser ikke gir en betydelig reduksjon i IOD (figur 4), tyder på at dette dyret modellen har en lignende feil i midtlinjen ansikts utvikling 10.

For å forstå mekanismen bak de manglene i både kropp og ansikt produsert av etanol eksponering, forsøkte vi å etablere genekspresjon endringene som skjer tidlig i utvikling og som kan rimelighet kan forventes å bidra til senere utviklingsmessige defekter. Vi gjør dette på to måter, gjør utvinning av mRNA fra embryo til en kvantitativ vurdering av nivåene av genuttrykk i etanol behandlet embryoer sammenlignet med kontroller (Figur 1a). I tillegg kan vi utføre in situhybridisering å se på mønsteret av gener, uavhengig av om signalet er redusert (Figur 1B-G 18). I dette eksemplet er to gener som uttrykk er redusert etter eksponering for etanol vist, gli1 og six3b. Når vi undersøkte i situ mønster for six3b, gjorde vi finner en reduksjon i utstrekningen av uttrykket av dette genet (figur 1 EG) i embryoer utsatt for etanol. En tilsvarende reduksjon ble funnet i genet GSC (figur BD). Både six3b og GSC er uttrykt i vevene skjebnebestemt til å bidra til kraniofaciale midtlinjen vev. Så reduksjon av disse genene ved 8 HPF er i tråd med reduksjonen i IOD fant senere som vist i Figur 4.

Når gener som påvirkes av etanol er identifisert, er det mekanismer som uttrykk for dem kan økes eller reduseres. I denne spesielle EXAmple, har vi vist 2 gener som er redusert (gli1 og six3b) av qPCR. Vi valgte å injisere mRNA å avgjøre om reversere disse genet endringene kan forbedre resultatene. For dette eksperimentet, i stedet for å injisere gli1, valgte vi å injisere Hysj, en ligand som øker gli1 nivåer. For six3b, klarte vi å injisere six3b selv. Vi fant ingen endringer når vi injisert six3b (data ikke vist), men klarte å fundamentalt redde de grove feil i sebrafisk embryoer med supplerende Hysj injeksjoner (figur 5).

Figur 1
Figur 1. Etanol eksponering endrer tidlig mønster og genuttrykk nivåer av utvalgte utviklingsmessige gener. A) qPCR resultater for embryoer hos 8hpf. Resultatene for to gener vises: six3b og gli1. Resultater vises som gjennomsnitt av tre separate eksperimenter,og dosen av etanol som vises er 2,5%. Begge genene er redusert på en måte som er betydelig fra kontroll (t-test, p <0,05). BG) In situ hybridisering av 8 HPF sebrafisk embryoer. Både GSC og six3b mønstre endres på dette tidspunkt i forhold til kontrollene. (Modifisert med tillatelse fra Loucks et al. 2007).

Figur 2
Figur 2. Somitt utvikling er endret i behandlede embryoer. Somitt struktur og vinkler er undersøkt på 48 HPF. I kontroll embryo (A), somites har en Chevron form og en skarp vinkel. Etanol utsatte sebrafisk har mer jeg-eller U-formede somites, og mindre skarpe vinkler. (Modifisert med tillatelse fra Loucks og Ahlgren 2009).

Figur 3
Figur 3. Etanol behandling avtar betydelig kroppslengde på sebrafisk.Lengden av ubehandlede og etanol-eksponerte embryoene ble målt på fem dager postfertilization. En betydelig reduksjon i lengde ble sett i alle behandlede embryoer (ANOVA, p <0,001). BD. Det var en svak, men signifikant reduksjon i den totale lengden av befruktede egg som ble behandlet med 1,0% og 1,5% etanol, mens en større reduksjon ble sett i embryoer dosert med 2,0% og 2,5% etanol. E. For å kontrollere for størrelse forskjeller i hver clutch, ble kontroll embryoer for hvert forsøk normalisert til 100, og søsken behandlede embryoer uttrykt som en prosentandel av 100. (Modifisert med tillatelse fra Loucks og Ahlgren 2009).

Figur 4
Figur 4. Etanol eksponering resulterer i en reduksjon i det intraokulære avstand (IOD) i sebrafisk embryoer. A) frontale utsikt embryoer demonstrere normale og smeltet øye fenotyper. B) Ulike doser etanol administreres i 3 timer i løpet gastrulation results i redusert IOD når fisken er undersøkt 24 timer senere. Sammenvokste øyne og cyclopia blir bare sett på det høyeste dose testet (2,4%). * Markerer en betydelig reduksjon i IOD sammenlignet med kontroller. (Modifisert med tillatelse fra Ahlgren, 2004).

Figur 5
Figur 5. Ssh-N mRNA injeksjon redder de grove feilene produsert av etanol eksponering av sebrafisk. Ett-to celle embryoer ble injisert med 100 pg / nl ssh-N mRNA og halvparten av den injiserte embryoene ble utsatt for de vanlige etanol doser 4,3 til 24 HPF. Embryoet ble analysert ved 5 DPF. Embryoet ble behandlet med 2,0% etanol sommerstid dorsally buet kortere haler, I-formede somites og øye mangler inkludert cyclopia. Rescue av disse fenotyper er sett i 71/76 av injisert embryo (93%). I disse embryoer, er kroppen rett, de somites er Chevron formet, og øynene er helt atskilt.

Discussion

Metodene som beskrives her, og resultatene vist demonstrerer bare toppen av hvordan sebrafisk kan brukes til å forhøre utviklingsmessige defekter. På grunn av tilgjengelighet til embryoet, høyt antall egg lagt for hver clutch, og høy reproduserbarhet av resultatene, disse virveldyr er ideelle for teratogene studier. Fisk kan også bli manipulert til å inneholde fluorescerende molekyler til å bruke som en visuell reporter for et bestemt gen eller vei av interesse 19. I etanol studiene, doser brukt virker ganske høyt sammenlignet med pattedyr blod alkohol nivåer. Men disse nivåene reflekterer hva som er til stede i vannet, og ikke alle av etanol leveres til embryo.

Til sammen metodene beskrevet og beskrevet ovenfor tyder på at sebrafisk embryoer er svært nyttig i å modellere menneskelige misdannelser knyttet til etanol eksponering. Videre har genekspresjon endringene finnes i sebrafisk blitt bekreftet av andrei mammalske modellsystemer 20, tyder på at utviklingsmessige virkningene av etanol blir beholdt på tvers av virveldyr. Mange av teknikkene vist ovenfor kan brukes sammen med andre miljø-eller farmasøytisk fornærmelser raskt og enkelt oppdage potensielle teratogens og avgjøre de underliggende mekanismene som bidrar til teratogenese av et bestemt stoff.

Disclosures

Vi har ingenting å avsløre.

Acknowledgments

Vi ønsker å takke Monte Westerfield, Makoto Kobayashi og Jacek Topczewski for gaver plasmider for in situ hybridisering og mRNA microinjections. Vi er takknemlige til Steph Erhard for å vises i videoen. Vi ønsker også å erkjenne hjelp av William Goossens med konfokalmikroskopi vist i videoen. Tyler Schwend gitt bilder som brukes i videoen, og Rodney Dale bistått med forberedelse til video. Vi erkjenner også at CMRC dyr omsorg personalet for deres reindrift arbeidet med sebrafisk. Dette arbeidet ble finansiert av NIH stipend R21 AA13596 til SCA.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
Vurdere Teratogene Endringer i en sebrafisk Model of Fetal Alcohol Exposure
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter